Gasterosteus_aculeatus Locus RPS8
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPS8
Gasterosteus_aculeatus
RPS8
groupIII
SNORD38
1487..1556
4175
TCAAACCTTCCCATGAACCTTTGCGATTCCTCTTTCTAGCCGGCGCCTGAGAATGGGTA
CGTGTTTTCATGCTCGGGTCGGAGGGAGAATCTTTGTCCATCTGATGTTTTATGAAAGGA
ATATTTCTTTAATAGTTTGCTATCTATTTGCTAAACATTATTTGAAGAGATGCGTCTTTA
ACTTAGCTGACTACAGTCAGTTTGTTGCGTTTTAATGAAAAGATTTGTGAAGGCTTTGCG
AAGTCCTCCAAGATGGCTGCACTCGTTGGCCATGGAGTTGGCGTAAGTGTGATAGAAAAA
GGCAAAATTCGCTGTTAATGAGGTATTCTAATATTGAAATGCGATCCAGTGTTCTGTTTA
AATTCTGTCCTTCGGGATTAATGTTTACGTTCTTCAAAGCTCCAAGCTATTGGCGAGGCA
AAGTCGATTTTAGCATTAGCTAGCCGGTTAACGCTGAACATGTCACGTTGCTATGCTAAA
ATTCATCGTAATGGTCGAAATAATTATTATTTTTAAATTAATGTAGCCACTTGCAATCTT
GCATATGCCGAACCTGTATCTGTAACTAACGTTTACGTAAGCAAGTCCTAACGTGGACAC
ACGAGTTGCATGTTAGCCCTTAGTAGGCCTACGTTTCTTTTGAGGGCCCAACATTTCTGT
TGTGACTGGTGAATTGGAAGCGTTTTGACAAACACGTGCTTCCCATTCCGTTTAATAGAA
CTTCAAATTAATATAGGAATTCTGACTTTCATTTTGAATAATCGTTAATGCAGCTAACCA
TCGTACTCAATTCACGGAAGTGCAGGCACCATTCAGCTGATGGAGGGATCTTAGAAATGG
CTTGAGCTACATGATGAAACCAATGGAATCCATAATTAATATTGCGGACAACCTATACCT
TGGAGAACTGATTGCCCAAGCTCAGAAAATAACACTGCAGTGTCCTTTTTGTTGTATCAT
GATTTAACCCCCGCTCTTGTCTATTCTAATCTTGTATTTCAGGTATCTCCAGGGATAACT
GGCATAAACGCCGCAAGACCGGTGGTAAACGCAAGCCCTACCACAAGAAAAGGAAGTATG
AACTTGGGCGCCCTCCTGCAAACACAAAGGTATGTATGAGCCAGTGTTCACCTACTCACC
TACTAGATTTTGTAAAGCGTGAGTGATGAAAACATGACCTTAGGTTTGTCTTTTTGAGCC
GTCTTGGTTCAAAGTTCTAGACCTACCAATGTTAGGACTTGTCATAGTTACACTGACCCG
CTTCAACATATGCACTGTACGGTTTACAATTGTCATAACTTTTATCGACACAAATTAATG
TGTGTGTGTTCTCTAGATCGGACCTCGTCGTATCCACACCGTGAGGGTCCGTGGTGGAAA
CAAGAAGTATCGTGCTCTGAGGCTGGATGTTGGCAACTTCTCATGGGGATCAGAGTGTAA
GTTAATTTCCTGTTCTATTTTTCATCACACTGCCTTTGGTACACGTCTTTCTATGATGAT
AACTTTGTTCAGTTCTGCTACTGATTGCAAATGGTGATAATACGACACCTGAGTAAGGCC
TGTTTCCAATGTGTTGCCCTTTTAAAGATATGTTTGACTAAAATAGTGGGAGAATTGACA
GCTAATGGCGTTTTAATATATGAATGCAGGCTGCACACGCAAGACCAGAATTATCGATGT
GGTCTACAATGCCTCAAACAACGAGCTTGTCCGAACCAAGACCCTGGTGAAGAACTGCAT
CGTCTTGGTCGACAGCCTTCCCTACAGGCAGTGGTATGAGGCCCACTTTGCCACTCCGCT
GGGACGCAAGAAGGGAGCAAAGCTGGTACGTGTGCCAGAATTAATGTTTGTTTTTATGCC
GTTAAGTGAAATACAAATTTATCATGGCCCTTCGCCTGGTACTAGTAGGTAGCTGAATTC
CCTTCATGGAAATTGGTCGCACCTCCATATATTTGCTGGCCTGTTGCACTAGTCCGACAT
TAAAGTCTAAAATGCACTTTTCAGGGGATGCTTGATGGTGGGCATATACTTGGTTACAAC
TTGCGTCACCAACCGAAAAGTAGTTTGATCTCCCCAAAAGTCTTTCAATGAAGATAACTT
CAGTTCTGCTACTGAATGACAGTGATGAAAATGAAGACCCCCCCCCTTGCGCTGTTAATG
TAGTTTAGGAGAGTTGTGAGCTTTTCATTTGCTTGAATGTGCACCAACTGAAGTGTATTC
CCCCCCTCTACTGTAGACCCCTGAGGAGGAAGAGGTCCTTAACAAGAAAAGATCAAAGAG
GACCCAGAAGAAGTACGATGAGCGTAAAAAGACAGCCAAGATCAGCCCGCTCTTGGAAGA
GCAGTTCCAGCAGGGAAAGCTCCTTGGTAAGTCCACATGTCAAGTATTGTAGTAGCTATC
CTAAAATGCTTCAGGGTTATTTAATCCGCATCTTTGTAAAGACTGGTTGCTGTTAGTGGT
TAAAACACAAGACTCCAGTATCTTGTTAGATGTGTCTGACCTGTTTCCTGGGGTTCATAA
TTTAATTTAAATATTCTCATATTTTTATAGCGATGTCATTTTGATAATCTGGTCTTTTGA
TGTTTGGATACATTCCACTTTATTTAGATATAAATTTCTACGTTCAACCAGATTTAAAAG
CACTAGAATACTATTTTCCTTCATGGCATGCGTTAGACTGTCTGATTTGGTGCACGTCTT
TCAATGAAGATAACTTCAGTTCTGCTACTGAATGAAAGTGATGTTATTAACTACTGAGAA
AGACCTGTTGCCTACATGGACCTCTGCTGCATTGTTGATTCACCCCATCTGGGGAAGTTG
GATGGTTGAACTTGCCCCCTATACCTGTGTTGCCACCAAATAAAAACTTCTACCGATTAT
GTATTACAATGTAGTTCCATAACATTTCTGCAACCTCAAACAAATTATTTGAGTCACTTA
CTATTTGTTTGCTTAGAATTTGGTTTATCCAGCTCATCACTGATTATTTTCTCCCCTCCT
GCAGCTTGCATTGCATCCAGACCGGGCCAGTGCGGCAGGGCAGACGGCTACATCCTGGAA
GGAAAAGAGCTTGAGTTCTACCTGAGGAAGATCAAGGCCAAGAAAGGCAAATAGATGTAC
AGCTGTTTGATACTTCAATAAAATACGAACGCCACAAACTGTCTGCTGACACTTCATGAC
TGGATGTGTTTAAATCTTGTGACCAGCTTGGACATAACATGTGAGAACATTTTATAAAGT
GCATTAATTCTAATCTATATATTAAGTATTAGTTGGTAACCCGTTTAATATAGTGTAAAA
ATATATTGAAATAATGGCGGTTTTATGTAATTTAAACTTACGATTTATTAAACCAATAAA
CTTAAGGTGCCTGCATGTTCTACAATAAAATCAAAGTAACTGTTCGTGGGGGAAAAGACT
GACAAGTCTGTACTCTGCGCCAATTATTGATATCAAACCAGAAATCCAGCTCCTCGTGCA
TTGAGACCTCAATTAAAGCCATTTACCCATTTAATACAATCCACCTACAATCACCTGAAT
AATGTTATGGATTAGAGCATTTACGTCTGGACCAGATGTGGAAAAACTTCCTTTAATCTT
CAGAAGTAAACTTGACTAAGAGTCGAAACCAAACGCGCAGAAGCGGTGCTCAGTTCTTGT
GTTCCACACATCTGGAACAAGCTCTCAAAGCTGCCAGTCTGCTAAGATGAAGACTTCTGT
TAACGTATAAATCTTAAATCTGATTTAGGATTTCCAATTTTAACCCTTTAAAAAGTCCTT
TGTGAGTTTGCTTCAAATCCCATTCACAAGCAAATTTCTCTATTTTTCAATAATATTCAC
AGGGAAATCTGTTAAAGCATGTCATCGTAAGTGAATACAGTGGTTCTGTCACCAACTCAA
CTTTTTCTGTCAAGACCCACTTTGGAGGAAGAAAAAGTTCATAGGCCAACGCCCAACTCA
ATTGTAGCAAATCAGTCCATGTTGACTGGTTACAATTGAGCAAACTGATTTGAGAGTAAA
CTCTTCATCCCTTCAGGAACTTGGTGTCTCAGGCTCTGCTCTCTCCCTTCTCTCGTTCTA
CCTTAAGGGCTGCTCCTACCGGGTAACCTGGAGAGGATCCGTGTCGGAACCTTGTCCTTT
TACTACTGGAGTTCCTCAGGGTTCCTTCCTGGGTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 1336..1435, 1649..1824, 2236..2365, 3004..3175
1001..1108, 1336..1435, 1649..1824, 2236..2365, 3004..3110
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved