Gasterosteus_aculeatus Locus RPL37
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL37
Gasterosteus_aculeatus
RPL37
groupXIV
SNORD72
2497..2575
4398
CTCCTCTGCATTTCAAGTATTGACAGAGATGCGTGTTTGACAATACTTTTACTGACGGA
ATTTTTGTAGCGTTACTTTAAGTAAATCCCTGAACCATCTATAAGACGGAAACACACAAA
AAGCAGGCATTCTAAGCAAAGAAACACAGATCTCCTGATCTCATTGTTCTCTTGGCCGTG
GCCCTGAGGGCCTGCAGCCCTCCCAGACCAGATCGCATATCCCTCCAGCGGGTTCTGGCC
CTAGAGCTCCTCCTGGTTGGACACGCACCAAAAAGCTGCTCCGGGTAAAGCAGAGCAATG
CTCATTTCCACCAGCTACCCACAGTTCTTGTCTTTGAGTTTAAATTGCCATTATGAGTTT
AGAACATATCCATGGATATGTTCTAAACTGTACTGTAGGCACAAAGTACGACCCCCGTTA
TGATAACAACAACTTAACTAGCACAAGACATGACACATATAGCTAGTCTACTTTGTGTTC
AATCATTTTTCCAACATCATTGCCTTAATGTTTTTGTTATAGTTTTAAAACTATAGCCTA
ATGTCATATCTTGAAAAAAAGATTGGATGATATTGTGGGATCTGCAGCCTTATCTACAAA
CACAAATCCACCTAACAATCTTTTTACCCTCATTCATTGTACCACTGCTTGACCCTTATC
ATTGCATGGGTTACAGATTAAATTACGGTTTACTGTGTTTTTTTCCTGCCCCACAAGCAA
CAAAATCATCATGAATAATCTCCTGGTTGTTATAATTACATCGGTTTGCGCTGTCAAAAT
GCTGCATAACATACGTCGTTATCATTACATCGGGTTGCACTGTCAAAATGCTGCATAAAA
TACGTTAATTATATATACAGTGAGGGAAATTAAATTAACACTAAACATATTAGCATATTA
GCTAAGCGCTACACGGGGTCACATTTCGGTGTTACACAGGAAGCAGCACGGATGTGATTT
TATGCGTCGCGGGACGCTCTTCCGGTCTCTTTTCCCTTAGCCGCCGGACGAAGATGGTAC
GTTGGAACGTTGGCAGACAGAAATCTCTTAACATCTGTGAATCGAGTCGCTTATCTGACG
CGATTAGCTGATTTTAGTTCTTCGAATAAACGTCGTAAGCGTTCGGGTGAAGTATTTTTG
AGATGAAGCTTTGTTTTAATGCGATTATTGATGTTCTTGTTGCATCGAGCCAGCGTTTGT
TTGCTGCTCGTAGCATTGAGATTCAGGGCACAGAATGGGCCCGCGTTTGCCGTGAAAGGA
CCACGTAACGTGTATGTAACGTAGATGATCTTCTGTCATACCCGGGGGAATTGGTTGAAG
AATGAATTGCTTTTTTCATCCGTCGTGTAAATGTAGCCGGCTAGCTGTGCTTACTGGCTA
GCTCTTCCATAGTGGTTAGCATTGCTAGCTAGCCGCTTCGTCCGCCTCTAAATGTGCTTC
TGCTGTCGATGCAACGCTGCCACCGCGCCGACTCTTTAATGCAGCCGCACACGGGTATGT
GGTCTATATGTCTGATTTCGGGGTCTTCGAATCAATGCGGTCTTTTTGTAATGACTATTG
GGTTACCAGTAGCCAACATCAAGTGTCGGAAGTCGCGTGCCGAGTCTTGTCAGTGATGTT
CTCAAAAAACAAATGTCTGAACGTATGATTTCCAGTGATTTCATCTTTGTTTACTGAGAC
AAGACCGCCGGACCCTTGACCCCGTGGAAGAAGTAACGCATCCGGGGAATCTCCTCCTAT
AAACTCCCCTTTTCTCTTGTATTCTCATTCCTCAGACCAAGGGAACATCCTCCTTCGGTA
AGCGCCGGAACAAGACGCACACCCTGTGCCGTCGTTGCGGTGCCAAGGCTTACCATCTGC
AGAAGTCCTCCTGTGGCAAGTGTGGTTACCCCCAGAAGCGCAAGAGAAAGTGTGAGGCAC
CAAACACTCAACATTCCCTTCACGTGTGCTGGTTAAACACCTGCAGTACGAGTCATTAAG
AGTTGTTAGTTGCGGGTGTCTTGTCACACTTTTGATTCATGCTGTGTTGTTTTTGTAGAC
AACTGGAGCGCTAAGGCCAAGAGGAGGAACACAACTGGAACCGGTCGTCTGAGACACCTG
AAGGTCGTCTACCGCAGGTTCAGGTGAGACCTTTGGCGCTTGTGTACTTGAGATCAAGTG
TTTCTAGATGTGACTGCTGTATGCAGAAAGCTATGTGTTGGTGCAAAGACTCATTTGTAA
GTAATACTGCCAAAGACCACAGTGAGATTGTTTGCTTCAGGTCAAACCGTTAGATGCAGT
AAGCACACGTGTTTGGTTTATCAACTACAAACATTGGATCTGCTTTTGGTGTGTTGACAA
ATTCCCTCTTGCAATATAAACAACATCCCTTAATTAGATATTTATCTGCAAAAAGGAAAG
GACTTTGACTGAAACGTTAAACAGGTGTTTATAAAATGCCCGAACAATATAATCAAGAAC
CTATATTATGAAGTTATATTTCAGGACTCTTCAATGATGCTTACCAATGATGCTGAAAAA
TAAATGTCTGAACAAATGATTTCTATATGATATCAACATTTTCTCTGAGGTAAGCTTTAT
TGTCTTGATAGATCAGGTACATGAGAATTAACATCTGAGTGTAGCTCTATTTAAGTTGCC
TGTTGTGCTAAAGGGTCACTATTGTAACAAAGACTCCAGTCGAACCACATGAAGATGTGG
CTTCATGTAGCCTTAAGTTCAGGATCCGTTTGTTGGTAACTGACCCGACTTGCTGGAAAT
GAGCAGTTTGTTAGATCTGTCAACAGTATATTTAATGAGATTAGATGACACATCTCTGTA
AATTGGACTCCTGGTTGTTGTTCGTGACCAGTTGGTTAAGAAATGGCACGGACGTAGCCT
TTGTTTATCATTCGTGCCACAGACAAATTCGTCTTTCAAACAAATCAAGATCTAAATATT
TGGTTTAAGATGAATTCTCTCTACAGCTGTGATTGTTTTAGCTAGTTACCTCGCTAGTTC
ACAGACCAATCTGTGACTTCCCAGCATTCCGTGGTAAACTATGGGGCATAGAACTATTTG
CAAATGTTTTGGATCACTGCTCGAATCGTAATTTCCTGCCTAAACCCCTTTTTCTGTGTT
GTGTCTCAGGAATGGTTTCAGGGAAGGAACAACCCCCAAACCCAAACGTGCAGCAGTGGC
CGCCTCCAGCTCATCCTAAATACACATTTTGTTTTGAATAAATGTGATGTTAAACCGGGG
TTTCCGTCTTTTCTCTTGGTCTATAAGCTTCGTTGTCCAGTGCAAGCGACACGGGGAGTT
AATACTGGATTCCCCCTCAGTTCATTTGTGCATATCTAGGAAAAAGTAATTTTGTAAAAT
CTAAAACAAACCTGAAATAAATGTGTTTCCAGAAATGCGAACTATTGTTTTAGTGTTGGT
GGTTTTGCAGTGAGATCGCTGGGTAACCACTCATCCATAATGTAGCTAGATTAATTGTTT
AAATGGTTGCTAAAATAAACCCATGATGCAATCTTATCTAAATCTTTTGAGGGGGGAATT
CTTGCCAAAAGTGATTAGAGGAAAATGTTGATGTGCACATAGCTGCCGCTCTTCTTAAAC
TGAGCACAGAACTCTGACCAAACGCGTTGCTCGCACACTGGAGATGAGAGTTCAGCTTCT
TGATCAAAATCCTGTAAATACCATCTACCCAACGGGCCGCAGGTTAAATGTTTCTACGCT
TTGAACGCCAGTCACCCTCCCTGCTTCACTGGAGCTGCTGGAAGAAAAGCTCTCATGGCA
AAGCACCAGTTCCCAACCCTCGTCAACGGAATTGGTCTAAATATTTATCCCAAGCAATAC
TGAGATTTACAAATCTCAAACAAAGATTGGTGCTTTATGGCGAGCAGCTGGACGACGTCA
GAGGAGACCACCGTGGTGAAGAGACCTTCAGGGGCCAAATGTGGTGGAACAGTTTGAAAT
GCTGCAGCAGGTTACAGTAAAGCAGCATGCAAAAAACTTATGTTTAACGCCTTCGAGGAA
TATCCGAGCCGTGGGGTTTTTCCCCCCACCGGCCTCTACAATGTCAACATCAAATGTGCC
TTCATCTGTTGGATCGGGAGCGTCCCAACTTCTGCAACCTCATGCTGCAGAAGGAGCGTC
TGGCTTCCACGAGTGCAAAGGTTTACCAGAAGCAATGTTTCTCCAACACAACTGTCCGAA
TCCCAGCTGCAAAAAAAACACCACCTGTGGGAAATCATTGCAAGATCTTCCCATCCACGC
CGTCCTGACACATCTCCTCTACTTTGACCTTTTGACCCTTTACCGGCGCTGTTCCTGCTC
TCTGTCAGATGCGGTGTCTTCCATGTGGAGTGAAACATTCCACGCAGACGTCAGCGCCTC
CGTGTGCAGCTCAGCGTCG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 1775..1910, 2038..2122, 3129..3398
1013..1015, 1775..1910, 2038..2122, 3129..3195
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved