Gasterosteus_aculeatus Locus RPL7A
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL7A
Gasterosteus_aculeatus
RPL7A
groupXIV
SNORD24, SNORD24, SNORD36, SNORD36, SNORD36
1166..1240, 1517..1585, 1896..1963, 2180..2248, 2847..2914
4199
AGGTCTGCGCTTTAGAAGCCACGTCGTCACGGCGCAACCCTCGCGGTATTTAAGTTACC
CAGAATCCCTCGGTCCTCCTTTCAGCCTGAACCGACATGGTGGGTACATAGCTGAGCGTT
CTCCGGACCGATTCAATCTTTTGTATCTGCCTGCATCCCTTAATGTATGCGCTTTCTTAC
TCTGTAAAATAGACTAATGGCGTGAGTGAACCTTGTAAGTGTAAGTCGTGTCGATATTTC
GCGTGGATGTTTTTATTTTTCGGGGTAGAACTTAGAAGTTCACCGTTCTGTAGCCGTTAG
CATTTGCACCGTGTCTCCGCCTCAGAAGCTCAAGCGAATCACGGAACACACGCTTATTTG
GGGGGAAACTGTCCCGTAGTCTGCATTTTCAAGTATACGTGTGTTCGGCCGGTCGTTTTT
GAGTTAAGTTAATTAAGGTTAGTGATGTTGAGCGTGATTTTCCATGTAACGGGACACAAG
TGTGTGTGTGTGTGTCCGGGTGATTAGCTGCATGGGCCCGTTGCCTCTTCCTGCTGACAT
GAAGTGCTGTCGGCACTCACAGCTCAGATTTTATCGCTACGCCACGTACAGATGTTGTCA
GCTTAGCTCGGTAGTTGTTAAAAGAGGTTATTGATACGTTAAATATATGACCGGTCTGTT
TTAATGTTTGCATTCAAGCTAGTGGCTTCGGTGTTGGATTTATGTAGCATGCTAGCCGCT
TAGACTGCAACATGCAGAATGGTCATGCTAAGCGCCATGCAATGCGTCTGAGGTTTGCTT
TGTTAAAGGATTTAAATATTGGGCTTTTTAAATAGTTTTTGTGTTCCATATTCCCAGTTG
GGCTAAGATAGAAATGGTAGAGCAGGGCAACTTTCATGCAAAGCAATGGATGCTTAAGCT
GATGCATGCTGCTGAATTTGAGCCGTGAGATATTCATGTTGGATTTCTGAAATTGCTTTC
TTTGATTCATGGTGTTCATTCAACTGGGTTTCCTGTATTTTACAGCCTAAGGGAAAGAAG
GCTAAGGGGAAGAAGGTGGCACCTGCCCCTTCGGTGGCCAAGAAACATGACGCCAAAAAA
GTAGTCAACCCCTTGTTCGAGAAGAGGCCAAAGAACTTTGGCATCGGTGAGTGTCCCTTT
TTGTTAGAATTGAGTACTTTTAACCGTGCAGATGATGACCACAATATTTGCTATCTTAAC
TTCCTTGCCGACAAACCATTATCACCAAGATCGCTGATGCACGTATGATGGGACAATGAA
GACCCTCGAGTGTGACTTCAAATACCGATGAATTAAACTTCTCCCCCGCCCCTACAGGCC
AGGATATCCAGCCAAAGCGTGATTTGACACGCTTTGTGAAATGGCCTCGTTACATCCGCC
TGCAGAGGCAGCGCTCCATCCTCTACAAGCGTCTGAAGGTCCCCCCTGCGATCAACCAGT
TCACCCAGGCTCTGGACCGCCAGACCGGTGAGTTAGGAGAGCGATGGTGTTGTAGGCTGT
TGAGTGCTTAATAGCGTCGCAAATGATGTGAAAGAATATTTGCTAACTGAGCAGCTGTGC
TGACAACCACCAAGATCACTGATGCCTCTCAGAAATGTACATTATCCACGTTGCACACAG
TCGTGTAAACTGTTGGGTGACTAATTTGTATTATGTTCTCTTCAGCCACACAGCTGTTCA
AGCTGGCCCACAAGTACAGGCCAGAGACAAAGCAGGAGAAGAAGCAGAGGCTGATGGCCC
GCGCTGAGCAGAAGGCAGCTGGAAAGGGAGACACCCCTACCAAGAGGCCTCCTGTCCTCC
GTGCAGGTGAGGTACACAAAGCAACGGAGAGTAGTGTTGGTGGCTGATATCTTTTTTTCT
TGGGAACAGCGTGACCAGTCTTATCTGTTGGCCTTAATGCAATGATGACATGAATTTCTT
CAACTGACAACCTGATGCTTTTGAGCTTTTTAACCCTGAGCATTGGCCAAAATATAAATG
TTTAGATGCAACATACATATTTTCCCGAGGGTTATATCTGGGTAGACTGTAATGTTCCTT
TCCCCTTTCTCTGCAGGTGTGAACACGGTCACTTCTCTGGTGGAGAGCAAGAAAGCCCAG
CTGGTCATCATTGCCCATGATGTGGATCCAATTGAGGTACGATTGTCATTCACTGAACTT
TAAAGAATAGATGTGGTCTCTAGCAATGATGTTTGAATTTCTTCACCTGAATCATCTGTG
TGGATCAACCTTTTTAAATCCTGAGCAGAGACCTCCACATTTTTCTACCCGCTCATTTAT
GGTGGAGCAGTTTTTGATCATGTTCTTGCATTACTTTAAGCGAATGTTAATTAAACTTTC
TCCTTTGGTTCCCTTTTTTCTGTAGCTTGTTGTCTTCCTGCCGGCTTTGTGCCGCAAGAT
GGGCGTCCCGTACTGCATCATCAAGGGAAAGGCTAGACTGGGAAGACTGGTGCACAGAAA
GACCTGCACTTCAGTGGCCATCACACAAACAAACCCGTAAGTAGGCCCATGAGATGTGCT
GCTTGAAAGTAACAGAATAAAAGATTTGGAAATTCTTGAGTCGTACAAAAGCCGACTGAC
TCCTGCAGAATTGGTATCTTCTATCTAAAAATGGCTTTGTTCTTTTCTAGTGAGGATAAA
GGTGCACTTGCAAAGCTTGTGGAAGCCATCAAGACGAACTACAATGACAGATACGAAGAG
GTGAGCCTACTACAACTGTGCATCTGGGTGTTTAACTCAATAGAGTTTAGCATTTCCTTT
TCTGTCATTTAATGACTGACAGCACTTAGTCTGGCTGGGCTCACCGCCCAATGTTAGAAG
TGTAACCTGTCAGGATACTTGGCCTTAATGCAATGATGACACTAATTTCTTTAACTGAAA
CCCTGATGCGTTTGAGCTTTTTAACCCTGAGCATTGGCCAAAATATGAGGGTTTTTTTCT
GGATAGACTTCTTTTCCTTTCTCACTTCTCTGCAGTCCTATTGAGGTTCACCACAAATGT
CCTCAAACTTAAATGTTATAAAAAAAATGCACAATTTTAACCTTTTTCAAATTTGTTTCA
GATCCGTCGTCACTGGGGAGGTGGTATCATGGGCCCGAAATCCACAGCCCGCATCAGTAA
GCTGGAGAAGGCAAAGGCCAAGGAACTGGCAACCAAGCTTGGTTAAAACGTTTGGAATAA
AAAATGTATGTCCTAAAATAGTCTTGTGTTGGGTTTTTTTTTTCCTTTCAATAAAAATGC
TTTTTGCAAGCCAATGTATTAGATTAATCTTCAGTAGGCGCGTCTTCATTGTTTAATACA
GATTTCAGTTATTCCTGAATGTAAGATTATAAATGTCCTAAAACTAAACGCTTTCCTTGG
TTGTGGGTGATGGGGACCACAGCAAAGGCTCCGAAACACTGGTAGGGTCACATGTAGAAA
ATACTTTTAAAGAATGTGCTGGTCTATAAAAATGTACTTGTATTGAACAGTGGTAAGCTT
TTGAAGGCATCCAGTCACTCAAGTTTATGCAACATTTATTTCCATAAGAACCTAAATACG
GTTTTAGGCACTTCTATGCTGAAAGATCATTAAATGGTTGACTAAAATACATTAAATAAC
CCGTAGCTTTCAATGTGTAACAGTCACTTTTAATAATTAAACCATCTTCTTGATGAACTT
TGCGTACCACATGTAGGAGGTTGCTGCACACAAGCCGTACCTTTGGAGAAAGGAAGACAA
ATTGAGTCAGTAAACTTAACAAAACGTGACTTATTTCCAAACACGTGCTCTCGTACCATG
TGACCATGTACTGCATGTGTTCGTTCCTCAGCGTCACTCTGGTTTGTCCACCTATTGGCC
CCCCTGGAGTCGTGCTCCCTGCAGGACACATGGAGGCTAATCAACATCTTTGTTAACACA
TTTTAGAATAATGTGCAAGACTGGAGGACTCACCAAAATCTGCATCGATGAAGATGGGCT
CGGCTCCGGCGGCGGCGCCCATGGCCTCCAGGTCCCGGTAGTGCCAGCGGTTCCTCTCCA
CGTCGTTGTTCGGCACGAAGGGTTTCCGGTTCTCAGTCAGCCGAACAACCCCCACCACCT
CCACCTCGCCTTCCACCTGAACGGAAGCGTTACATTACATTTTGTTTCTATAAGTGAAAT
GGGGCTGCAGGGAAATAAAAATGTAAGTGCGGCGGAGAAGCTTTGGGGCCAGTTTGTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 1317..1466, 1665..1805, 2056..2135, 2365..2495, 2630..2699, 3061..3199
1002..1125, 1317..1466, 1665..1805, 2056..2135, 2365..2495, 2630..2699, 3061..3162
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved