Gasterosteus_aculeatus Locus RPS11
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPS11
Gasterosteus_aculeatus
RPS11
groupXI
SNORD35, SNORD35
1195..1278, 1802..1885
3568
ATAAACAAGAGGCACTTGTTCGAGCGCGAGAGTATCGATGTTTACCGCACCACCGGCGA
CGCTGTCAAAGTCGATTTAATTACAAGAATATAGCTGGTACCTTGATCGCCTCCTCCGGG
GTGCGATGCCATCTTGGCTGTTTAGATCGCTCGATGTGCGCTTCCGCGTAATCATGTGAC
GAAAATTCTACTTTCGGTAACAATTTTTTTCCGATGGGCCGATGTGAAACGATGACGTCA
TAGAGGTGAGGCGCTTCATAAATGTATTCTATTCGGATTTCGAACTCATATTATTAATGA
AGAATTTAAAAACGTCTTTCACACAATGTATCTGTTATTCGTCCGTAAAATGAGTTAATC
ATAACAAAAAAAAGGTGTATGCATTTCTGAGCCTCGCCCACCTTATAAACGTCATTTCCT
GTGACTTTCGGTCTTCCGCCCGCCGCGCGCACCCACAGGCCTCTTTACGACTCGGCAGCA
AAGATGGCGGATGCACAAGTACGTTCGGGAAAACGGCGTGGTGAATTTCATTCGATATTT
TTTACATTTAAATTGGGGCTTTTAGAGGAAGTTATTAAGTATGTGCATTTACGCTGTCTT
CATACACAGTCACGAGCCGATTCCAACCCCAGAGATGGTTTCGTAGCTCGTATTTGCTGT
AGCGGTACTGCATACCCTCGTGTAACGTTAAACTAGCCGGGATGCTAACCTCTCTAGCCT
AGCTTGCTCATGCTTAACGTAAACTCTGAAAAGAACATTGCCTTGTTCTGCATACGTTAA
CAATGCACTTAAACTTATTATTCTCATTTCCCTCTTATTAATCAGTGGTGTTTCAGCTAC
TGGTGATTCTAGTCCAATCTAGTCTTAATTACAGGAAGTCAATGTTTGCGAGGCCGGGCG
GAGTTCAGTGGATGTGCCCTGCCAGTGCATGGACGCGTACATTGTAAAGTTACGGTGTTT
CCTGCATTCAGTGGTTTTTACCTTTTTTTTTATTTTATTTTTTCACAGACCGAAAGGGCT
TATCAGAAACAGCCCACCATCTTCCAGAACAAGAAGCGTGTTCTGGTCGGAGATGGTGCC
AAGGAGGCCAAGGAAAAGCTCCCCCGCTACCACAAAAGTGTGGGGCTGGGCTTCAAAACC
CCAAGAGAGGTACATCATTATTTATCACATTCTTAACCGGTAAGGTTTTGTTAGCTGCAA
ATGATTTCTTTCTCACGATGGTCTTCCAAGCCTTCAGGGTTCTGACGATAGTGCCTTTTG
GCAATGCTGATGCAGTCATAAGCCTTAAGGGACAAATTGGAGTGAGTAGAAATGCCTGTA
ACTAACATTATTAATTCTGTGTGCTCTCACCAGGCTATTGAAGGCACTTACATAGACAAG
AAATGCCCCTTCACTGGAAATGTCTCAATTCGTGGCCGTATCCTCTCTGGTGAGTTGAAC
ACTTCTCAGTAGGCTTTAACACTCGCCCACTGACGCTGGCTTGGGATGCTGCATATTATA
ACACCACACAAAGCTCCTTACACTCTAAGAACTGCAAAAGGAACACACTATTCAGATAAC
CGACAAGACATTGTCTACTTAAGATGTTGGCTTTGCACAAGACTTAAATGAAAATGGGTT
ACATTTGTTATATTGTCCACCATGATACTGTGTGTTTACGTCTCAATTTTAACTGTTGAG
CGCACGGCTAGCCATTTTTCTGACTACGAATGAAAATATCCCTGTGCAGGTGAAGCAACC
CAAGCCAGAACCAGTCTTTACATGGTAACTTACTACATTGAATTTCCTTCTTGTCACTGT
CCTACAAATGATGTTTTTCTCACGATGGTCTTCCAAGCCCTCTGGGTGCTGACGACAATG
CCTAACGGCAACACTGATGTATTGGCGTGACTATTCTATTCAACCCAAAGTGTTCACCGC
AATCGAGGGGAAGCGCTTTGACAGTTGTATTTAAATTCTGCATGTGATCTACAGGTGTGG
TGACCAAAATGAAGATGCAGAGGACCATCGTTATCAGACGCGACTACCTGCATTACATCC
GCAAGTACAACCGCTTTGAGAAGAGGCACAAGAACATCTCTGTCCACCTGTCCCCTTGCT
TCAGGTACAACACTGCTCACATGCTTTTAATAACTAAAGTCCCATAGAACGGTTCAATGG
TAGTTTCCAGATGTCTCAAGCCCTTAAAAAATGAGGTTTAATTACTTGCTGCAAATGATG
TTTTTCTCACGATGGTCTTCCTAGCTTAAGCTCTGACGATAGTGCCTTTGGCAAATACTG
ATGCGGCTTCGGTTTACAACATAAAACTGCTGACGATTTATTGGATTCACTTAAATATAC
ACAACCACCTGATGTATCTATTGTTTTCCTGCAGAGACGTCTCTGTTGGAGACAACGTCA
CTGTTGGGGAGTGCCGACCACTCAGCAAGACGGTGAGGTTCAACGTCCTCAAAGTGACAA
AGGCGGCTGGAGCCAAGAAGCAGTTCCAGAAGTTTTAGGTGTGACTGATCAGGAAGGCTG
CTGTTGGCCGACTTGTCCCACTGTCGAATAAAATAAAAAAATCTTGTTTAAATGTAGTTT
TTTTTTTTTCTTAAGCACCAATAACACGTGCACACATATCAGGGCCTATTGCACAAGTCC
AGGATAACTGAAACGGTGCTGCTTTTTTGGTTAATCCTTTCCACGTGTTGTGAACCAGGC
GGAGTTGGAGCTGTGTCAATCCAAGTGTACGTAGTTGGGAGAAGTGCGCCTTCATGCCTT
TCTTTACTAGACTACCGTAGTTATCAGATTTACTGATTGAGAAATTTACCCCAAAGACTA
GGCCTACTTTCCAACCCTTATTCACAATAAGCCGTCTAAATATCTACAATTAATCTTCAT
GCAGCACAAACATTGCTGGGGCGAAGATAAAATCCTAAAACGGTTTGCAGACTGGTAAGT
TTGCCAATGGTATGTAACGATTTTGGATAGTAGACAGTGTCCATTTTTACCTGAACGTTG
ATGCTGACAGTATCTTTCCACAGTAAGGATTTTCTGTTGACATTATCTCACTCATGGGAC
CTCTGAGTTTTTTTTTTAAATTCAGATGTGACAAATCTGCCGATGTCTGGTTATCTGGTC
ACAGTTCTAATGTAATGCTATTTTGTGATCTATAATTCATGTTCCCTGCAATCTGGCTTT
AATTCAACCTGCTGTCAAGCAACAAAGTCAACGCTAAATTCATCCAGGACAACTAATATC
CCGGCTTAATCCTGTATACTGGTTTCGTGGCCTGTGGGGTCTTCTCGCACCTGAGGCTCT
TTGCTATCATCCAAAAACACACCATGCATTTACAGAAGGCCGTGACTCATCCCGACCAGT
GATGGTCACCATGGAGTGCTTACACGTTGCACTTTCGTTAAATCCCATTGGGAGAGTTTG
GGGAGGTGGAGAGAAAGAAACCTGCGGGGTAGGGGTGCATTTTTTTAGGTGGGGAGTTTC
TATAAGATGTATGGGGGTGGATAGAAGATCTTTGGGGGAGGAAGAAAAGGTAATTTTCTT
CAACTGGAGGCAGACGTCCTCCACGATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1148, 1353..1428, 1974..2103, 2374..2568
1005..1148, 1353..1428, 1974..2103, 2374..2494
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved