Gasterosteus_aculeatus Locus KRI1
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus KRI1
Gasterosteus_aculeatus
KRI1
groupXI
snoZ30
5768..5867
7891
ATCTATTATAATGCACAAATAATAAACATTTCCAACTACATTACTCTTTTTTTAACCAT
TGGTCTCCTCAGTACTCAAACTAAGTCCCAGTGATTGCATACTTGCACAACTACTAGCTT
ATCTGTTTTTGCATGTCTGCGTCAGGTCTCAAACTGATACTGATACACCTATTGTTCGTT
TCATGTTGCTGCATAAACGACGTCAAAGCCCTGCACTATAGATAACAGCATCACCCAAGC
GGTGCTACTCTATGAAACCTAGATTTTATTTGCTATATAAGGCACCTGTTTCGGTGGAAT
GTTCTTCTCTAAAACTAAACAGCATTCTATAACAAAAAAATGCTTCAGTTCGGATAAGTT
GCCAGATATTTAGTTACGTTATCTGCAACTTCTAAAATTATGTTGACACAAATCGGTCAT
AGTAATCGTCTCTGTGGTGGAGTGGCAATAAAGTGATTCTGTGTTGCACATTGGAGAGAG
GTATGGGATGGACTACTGTGTTTTTTGAATCACAATCATGTTTTGTACCTTACTTGTTCT
TCATCCTATGTCACACATCAGTGCCCAAATCATTAACTGACAGATACTGTTCGTCCTCAA
CTACTCTGATGGCACATGATGTTGAAGACACATTGTCCTAGTAAACAGTGGTGAGGTGAG
AGCGTTCCAATCAATGTTTCCACAAGTCGTCTCACTTTATTCAACTAGTTTACCATATGC
GGGATGTAAGACCATCAAAAATGTGTGGCAAATTGGCTGTTATTTGAAAAAAAATGAAAT
AATTCTATGTTTCTAAAATATCTGGAGTTTGTGTGAGTGCATGTCTAGTAATGTTGTACC
ATATGTGAATTGTTATGTTTATATTAATCCACGAATGCCTATTTGTGTAACAACAATATA
TAGTATTCTTTCCTTGTTTTTTAAAAAGAACATGTAATACATGTAAGAAAGGTCAAATGA
AATCAAACACTACATAACAAATAGAATAATTGGACTTTTCTAAGTGCAAGAGCCTAAACC
AAATCTATAAAGTAGAAAAGAAACATATTAATGTAACAAATAAAACTATTTTCGAAATGA
ATTCGAAAAATTGTAATCTTACAGCACGAGTGGTCGACAGCTATTGGATTGAGGATTGTC
AGCATCAGCGCGCCCCCTGCAGGACACTGTGTGAAATGTGTGACGTTGTGCACCGGAAAC
CACGTGGTTCAGCTTTCCACACGCGCAGGCAGCAGCAATGAATCCGCTTTACTAGCGTGT
AGTTTGTAATTGTATCATAAACCCACCACCTTCTTCGAAACCATGTCGGAGTTTAAAATC
AACACCAAGTTCGCGCATAAATATGATTCATATCGGCAGAAAGAAGAGCTCCAGAGACGT
AAGTGTGTGACCGAGGACGGCTAAACTACGTGCTAACGACCCAGCGTGGGGGTTAAAAGG
AGTAGCGGGAGCTAACTGGCTTTAAGCTCCGCGACACGTTGTTATTACTGTGTATTTAAC
TCATATCTGGTTCTCCTTGTATTTGCCGCGCAGTGAAGGATCGATACGGCGACCAAAGTG
GAGAGAGCGAGTCTTCCGAGTCCAGCTCCGAGGACAGTGAAGTGGTTAGCATCGCTGCTT
CTTCCCCCCCGGCTAACGAGAGCAAGCGGCTCGCCAAATGTTGTATATACATATGTCGTC
TAACCGACCGGCTGCCGTGTTGTGTCACAGGAAGTGGACCCCGGAGTCGAGAGGGACTTT
TACAGAACACTGTCACTGCTTAAGAAGAAAGACCCCAAGATCTACCAGGCGGATGCAAAG
TTCTACTCGGAGGGTGAGAGCCGCGTGCTGTTGCCGTTGGTGTTGCCTTCACGGTCCCTG
GGACATCTGTTAGTGTCTTTAAAGAACTGTCCGTAAACCTGACCTATACGTCTTCCAGTT
GCATCGAGCGGTGATGAACAGCCTTCAACCTCCAAGAAGGCAGTGAAGCCCATGTTTCTC
AGGGACTACGAACGTAAAGTCATCCTGGAGAAGGAGGGGTGAGTGGGCAGCGATCACATT
ACATTACATTTAGCGGACGCTTTTATCCAAAGCGACGTACAATAAGTGCATTCAACCATA
GGGTACAATCACGGTTTATTACAGTTTATTGACGGGCTCATTCAGCAATTACACACCTAG
TGTTAGAACTAGGACGCTTTAGATTTGTCACAACTGATAACTTAATTGAAAGTAAATGAA
TCGCTGACTGTCCAGTATGGCGCACGGTTTGGTCACATTTGGTCCAAATTGAAACAATAA
AATGTTTTTCTGATTTATACAATGTCTGTTTTTTAAATAAGCACATGCTTGTTGCCTAAT
ATACTTGTGAGTGTTTACTTTGAACAGAAATACTGATAAATCATCATATCTAATTGGTAG
ATATGAGGTCACTATTGTCATGCATGTGTAATACATTATTTTACCACTAATGATTTACTT
ATAAGCATAAAGCCGCCTTGCTATTCTCCAAATTGGTTATCTTTTTTTTATATAGTGTAA
AAATTGCTGATCTTTTTATTTCATCTTCACAGCAAATTTGAGGATGAGGACGACAGTGAC
GATGAGGAGGAGGCCGCATGGAGAATGGAGGTAGACGCAGCGGATAATTGATGTTAGATC
TGGAATGCGGAGAGACGGGTGTTTTTATTAATCATTGTTTTATTCCAAAGAGAGCCGCCT
CTCCGAGCTACATTCAGGAGCAGCGGGAGCTGAAAAACAGGTACGTCTCAGACGTCAGAT
GTGTAGTAGTCTGGCTGTATAACCATATCACTTTTAACATAAACCTAAACCCTTCCCCAG
CTTCCGTAAATTCATCCAGGACAGCGACGATGACAGCGATGCCGGGAAGAAATCAGAGTT
TCTCACCAGGAGGATGAAAACGCAGGCGGAGAAGGTCCGAAGCTCTTACTTCCCAATCGC
AGGAACGGAGAGGAAAGAGTCACACAACAGGATCAAACTTTCTCTGACCCCGTGTCTGTC
TGTAGGACAACGAGGAGGCCGACTATATGGAGTGGCTGAAGGGCCAGGCGGACCTGGAGG
GCCCGGAGGAGGTGAAGGACATGGTGAGTGAGCGTGTGAAAGCACAGCGGGGAGAGTGTA
GGAACTTGGGTGTTTCTCAGTTATGAGACTGTGTGTGCGTTGGGACAGAAATACTTAAGG
GACTACTGGAACGACCCGAAGTTGGACGAGAAGGAGCGTTTCCTGAGGGACTACGTCCTC
AACAAGGGCTACATCGACGAGGACGACGCTGACAGCAAACGGTACGTTGCCGCCCGCGTG
CACCTCGACTCTGTTTTCCCCGGTGAGGGAGGCCTAACCAGCAAAAACTCTCCCGATGGC
TGAAGGATCCCGACCTACGACGAGGTGGTCCAGGACGACGTGGAGGACTCCGAGGAGGAG
GGGGAGACTTTCTTGGAGCGGCAGGAGGACTTTGAGAGGAGCTACAACTTCCGCTTCGAG
GAGCCCGACGCTCAGAAGATCAAGACGTATCCCCGCAGCATTGCCACGTCCGTGCGCTCC
AAAGACGACAGCAGGAAGCGCAAAAGGGACGAAGTGAAAGAAAGGAAGGAAAAGGTTAGA
TTCATGGTTATGAATATAAATATTTCATCTAAAATCTAACCAGGCCCTTCAACATGGTAA
TACACTTCTCTCGCTCCGCCTCGAAGTACGAAAAGCCTTCGCTGATGAGATAATACCAAC
GTCTCTCCCTGCTTCTCCTCCGCTTCCCTTCCCCAACAACCGTTTCAGGAGAAAGAGCAG
AAGCGGGAGCAGCTGAAGCAGCTCAAGAACCTGAAGCGAAACGAGATCGTGGAGAAGCTG
AAGAGGCTCAAGGAGCTGACGGGCAACGAGGAGCTCGCCTTCAGCCAGGCCGACCTGGAG
GGGGAGTTTGATCCACAGCAACACGACCAGCTAATGCAGGTGGGTGCAGAAACACACACA
CACACACACACGTTGTGCCACAAACGTTGTTTCTTGTGCGCTCACTCAACCGACCAATAG
CCGAAGGCCTCACAGGGATCGTCCAATCATAAGCTCAGCAATTGTAACTGTTCAGCTTTG
GATTAATACGCACGTTGAAGCTGTGTGTCTGCAGCTGTATTTGAGGAGTTTTGAGGGGGT
TCTTTTGTTTCAAAACTGAAATGGCAAAATAATAAGCAGTTTGGTTGAACACAATTCTCT
GCTTTCACGAGGCGACCACGCTCACCCAGGTGTGCTGCGTCTGGCTGATTGGGCTTGTCC
TCGGTGGGGTGGGGGTGGGGTTGTAGCTTCCTCTTCATTTAGTGGTTTCCAGGCGAAGGA
GGTGCATGTGTCCCGTGTAAACTCCTCTGCAACTTTTGTCCTTTCTTCGTTTGAATCCAG
AAATTCTTCGGGAATGACTACTACAAAGGAGAAGAAGGCGAGAAGCCTCACTTTGATGAT
GAAGACGAAGATGAGGGTAAGCCTGCGGTGTATTCTGTATGTTGCCTGATGCTGGAACTG
GCGTGTTTTATTTGAGTGCATCGAGGCCTCCACGTCGCACTTTGACTCCTCCCTGAGCTC
TGAAAGGAATCCTGCTGAGAAACAAAATGTTTATTGCACTAACGCATCACAGAAGATTCA
ACTCGTGTGTGTGTGTGTCTCAGAGTCGTGGAACTGGGACAGGTGGACGGGCGAAGCTCA
AGAGGAGCACTGCAGTGAGAATGATGCCTCTGGGCCCCACTGCGAGGATCAGAACTTCAT
TGTGAGTACGCTCCGCTTTATGACCTCAGGGTGAGAGGTCGAGGTCAGTCACCTGTGAGA
GGGTTTCTTTTTCTGGGAAGAAAAGTTCACCTAAAGCCCCCCCCCCCCCCCCCCCCTTTG
AAACAGATGGATGCAGACTACGACCCCAACCAGCAGCCGGCCTCCAAGAGAAAGAAGCAA
AAGGAACGAAAGAAGTTGAAGAAGGAGGATTTGCCACTAATGGGCAAAAAGAGCAAAAAG
TCTCACTTTGCAGAAGTCCTCACCCAAAAGAAGCCCGTGTTTGACCCGCGTAGGTGTCAC
TCAGGCTCCTCCTGATAAAAGCAACGGGGTCCTCCAACGGACGTTTGTGTAACCGCAGGT
GTTTTTTTGTTTCAGAGGAGAAAAGCTTTGAGCAGTACCTGGACGAGTACTACAAGCTGG
ACTACGAGGACATCATCGACGACCTCCCGTGCCGCTTCCGCTACAGGCAGGTGCTCGCCA
ACGACTTCGGCCTGAGCACCGACGAGGTGAGCGCGGCGCCGCCTGCGCCTGCCGAGTGAT
TGGCTGTTGGTCGAGCTCTCGGCGCTCACACGTTCCACGTACGATGGTGCCGCTGGCAGA
GCGATAGACGATTGATATGTGGGTAGTTGCTGGATAGTTTCAGCATTTCATGAGGCAGGT
AAGATCTCAGATTCTGCTTATGGCTGCTTGAAGATGGGAATTCACCAACCATGTTTTAGT
GTTGAGAGGGAATGCGGTTGTCTCTGACCGCTCATGACTGTCTTTTGGGGATTAGGAGTA
TAAACTTCCCGAGGAGCAGGACGGCGCTGCTGAGGTTGGTTTTAACCAGTTGGAAAAATA
TATCCACTATCCTCCTGCAGCCTCATACGCTCATCAGATCAACGTGCTCGAAGGTCCTGC
TTGGGCGTAGATACTGCTGCCGAGTCATAATTGGACAAACTGCTTTGTGTGGGCGGGCTC
TAGAGAATAGAAGATTTATTAAAGATAAACTTGGCCTAACGATGGATGTTGCTGTTGGTT
GGGAGCGCTGCAGTGATGAGCCTTAAGTGACTGATCTGGTATTGCTTTTTCCTTTCTTGG
GGAGAGCTCTGACCAGGGAATGATCTCGACTTAATCTTCTCTCTGAGCAGACCACCCAGC
GGCTAAAAGGAAACTTTATGACCCAGATGAACTCTACAGGACTCCAAGCATGTGTAGCAG
CAGTTTGAGTAATTCAATGCTCTGGTTCTTTCCTCAGATTTTAACTGCCAACGATAAGGA
GCTGAACCAGTGGTGCACTCTGAAGAAGACCTGCATGTTCAGGTACCGGCTCCGGCCCGA
AGGTCAACGTGGCCTTTCTGCTCTGTCGGGTCCTTTTCCAACACTAAGAGGCCTTTGTCT
TCCCAGGTCCGACAGAGCAGAGTCGTGTGACTTGAGGAACTATCAGATAATGGCGCAGAA
TGTGAAGAGGAAGCAGGCGATCCTGCGCTCTGTGTATTCTGAGTGAGTATAATGCAGTCA
GCTCCTCCCCCCTCATGATCCACCATTAGTGGAGTAATGCAGAGCGTTTTTTCATCTTGC
TTTAATCTACAGGGAAGACAAACCGCTGGAAGATAAGACCAAGCCGGGGAAGCAGCGACG
CGATCATCCAAAGGACACAGAGAAGCAGGACCGAGCTGCAGGGTACATGGTGGACTCTGC
AGAGGAGACGCCAGGCCAAGCTCTCGGAGAGGAAGCGGAAGAGCTTCTGATTCCCAAGAA
AATGAAACTCCAGGAGGAAGCCCAGACAGCGGTCTCCGCCGTGGAGAAAGCGGACAAAGC
TGCAGAGGTGAGAAACCGGACTGAAAGGCCCAAATGGTCCACGAAGAAGCAAACGCACCC
CGTTGGACGCCTCAGATCGGGAACCAGCAGGGTGAAGATTGGCGGCTGCGAGTTCAGTAA
GCAGAGACTGAAGGCCTACGGTCTGAACCCCAAGAGACTGTTCTTCAGACAGCTCGGCAG
GCAGAAACGAAAAGAACCGAAGAAGCTGGAGGAGAAAAAACAGGCGTGAGCCACCATCTT
AGTTAACTGTACAATCATAGATGTCTGAGAATATAACACATTGTCGAATTATAAATTCCC
TTTTTGTTTAAATTAGAGCCTCTTTTTTTTTTTTTTTTTAAGGTTTCAATCATTTTCTGT
TATACCCAGTGTACGCTTTAACTACACAATAATAAAGATTATTACAATTAAACGTTTTAT
CTTGCTACATTCATATTGTGTTTACATTTCACTCACTTTGATAACAGATGTTAGTAGTGA
AAATTGTTTTCTCAACTTTCCAAATGTAATGTTGACTCACATTAACGCTCTGGCTGTCTT
AATCCTTTCACAGCTGTTTAAAGCAGATGTGTTATTAAGCCGTTCATGTGGGTGAAAGCA
AACTGGAACCACACTTTAGTATAATGCAGAGGTTCTGTCCTCTGCTGTCTGTTCCATTCG
ATTTCCTATGGAAAACACGCTGGCATGATCAACACGTCAGCTTAAAAGTTGTACCTTTGC
CCTGAACCTGTAAGTTCTGAGTGCTACCTGGAAGAGCTGCTTCATGAACCAGAATCTGTG
TGAAGCTTCCAGATTGGAAGCAAAACGTCATAAAAGGGTAGTGCACCTTAACTGATGAGA
CCCAATTCCCACTGGGGGGGCTAGCCTGCTACATTTAGCATTATGTTAACAAAAACGAAT
GCGTTTTACAATGTGGAAATATTTTTCACTTCACGCCAAATCTCATTGAAGGGTTGGATG
TAATTAATCATCCGTGATACTGACTTTGGCAACAAGCGACATGCAGCGTGGCGCTTTTCT
TCTTGTACGGCAGCGGGCGCTATGACGGTCCGCCAATGACCACAGAAGAAGAGGCGGTGG
CAGCAGAAGAAGAAGAGGCGCGCTCACGGGGAGGATTTGAATCATCGCACTGAAGAGCTG
TAGGTTCGTTTTCTGTCTGACTTTAACGTAATAACCGTATTAACGTCATCTTTGCCTCAC
GGACAATGTGCTCACTTTTTACTTTTTACAGTCGATGCTGTTGTGTGCAATTCGTTTAAT
GAGTCTGCAGCATTTTATCGTAGTTAAGCTAACTTTAGCTGCGTAGCTAACGATCCTGTT
GTAAACAAGGCAAACAAGTAATCACTGTTATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 1311..1377, 1533..1600, 1710..1812, 1918..2017, 2552..2589, 2688..2739, 2820..2913, 3005..3082, 3168..3280, 3365..3593, 3768..3938, 4380..4455, 4643..4740, 4866..5028, 5109..5245, 5977..6041, 6126..6221, 6312..6891
1001..1051, 1311..1377, 1533..1600, 1710..1812, 1918..2017, 2552..2589, 2688..2739, 2820..2913, 3005..3082, 3168..3280, 3365..3593, 3768..3938, 4380..4455, 4643..4740, 4866..5028, 5109..5245, 5977..6041, 6126..6221, 6312..6339
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved