Gasterosteus_aculeatus Locus DKC1
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus DKC1
Gasterosteus_aculeatus
DKC1
groupXV
SNORD83
3772..3847
5206
ATTTATATTGTTCATTTTTACCTGTATATCTTTTATCTTACGTTATTTGTTTTACTTTT
TTTTCATTGTACTTTCTTGACAAATAACATGACAATGAAAAATCCCTGTATGTGCAACAT
ACTTGCCAATAAACGGCTTCTGATTCTGATTAAATTAGCAAAAGGAGAAGAAAACTGCCT
CCGTTCCGGAAGGTGGCACTAAGCTTTGGTCACGTAGGTTTGTAGTCCGCCAGCAAAGAA
GAAGAAGGAGGAGAATAAAAGGAAGAGAGGGAACAGAAGAAGAGCCTCTCACGTTCTCGC
CCTCGAAGGAACATGGCGGATACGGAATGTGAGTACGACACATGCTCCTGCAACGCAAAG
CAGTGACTAACGTTCCTTAATGTGACTATCTAAACCATAAAGACGCGTGTCTTGTTAAAC
CGAGTTAATTGTAATCACTGCACATGTTTAAAATGTACAAAGATGGCTTCTTTAAACGGA
TCCGCAGTCAGTTTGTCTCTACGACGTGAGTCTGGATGACGTAAAAAGTATAGTTGTGCA
TTGTTTTACTGTCGGTCCCTTTTTATCGCTTTTGTAGTTGTGCGTGTTTCGTAGAACCCT
GCATTCTATGAAAGCAGAGGCCTGCTCATGGGCTCCGGCAGGCTGCACGTGTAGCGGCAC
ACATTCAACCAGAGATGGGTCCAGTTTGAGGCTTTACACCTCTAAAGCTGAATTTTCAGA
AGAGAAATCAAAGGTTCCTCTCGGTCAGCAGGACTTCACTGCTGGATTTGGCTAATCAAT
AAGTTTAATCTGTGTTCTGCATCGATCGTGACTGTGGATCCGCACAGGCGGCCTGTTAGC
CGAGGCAGCCCCGCAATGCTAACTACCACATGTGGTCGGAGGCCACGTGTCTGTGTCTTT
TCTTCTATTTATGTCAATTCAACTATATTATTGAACGATTAAGGACGCTGATGTAGTTTA
AACGCATGAAAATGGATAACTATACATTTTAGCTGGACTAAATTCATGTTATTGTTTCAG
CTTCAGTGAAGAAGAAAAAGATGAAGAAAGTCAGTGAAGAAGAAGTTGGGGTAAGTGGAG
ATGTATTTATATAAATATGTAACAAGATTCATGTGTATATACTCCTGGCGGGAAAATATT
AATTTAGCTTTAAGAGCAGTAAAGCTATTTGTTACTTCAAATGTAATTACTCGAAGGCTT
ATTTGCCGCTGCTTTCACTTGTTATCTGGATTGTTATGACGTGTGCACTTATAGCCGCAA
CATTTGTTTTGCTGTGAATACAGATGAGTTCTTTTGCTTTTAACAGGAGATTCAACAAAG
TGGCAATTTCCTCATCCAACCAGAGTCTAAGGTGGCGTCTCTGGATACGTCTCAGTGGCC
TCTGTTACTGAAAGTAAGCCCCCTGTAACCACTGCTATCCCGTTTTAGAATTAGTTGCAT
ATGGAGATTTATAACATTTATTGGAGCCCCCATTACAGGTATCATGCTCTTACATTATAA
ATAAATGAAGAGCCCTGTGAAGTGATGAAGAAGTTTATCCATTCGCTGAGTGGCCTGCTT
GTCGCAGTCTTGCACCCGCTCCCATAACAAGGACGGTGCTGTATCGTGTGGTTGTGGTAG
TGGTCTGGCGTTCTGCCGGCGACAATCCAGAACCACTCGGTGAGAACGACTCGACTGGAA
GGCCGCAAAGACGATTTAACGTTTCTGATCACATGGCTTTCTTTTATTCATAATGTATAG
ATGTGTAAAAACAGTTTGTAATGTGAACTAAATAACGTTTCCTCCAGAATTTTGACAAAC
TGAACATCCGGACGGCTCATTACACTCCACTACCTAATGGGAGTAACCCTCTGAAGAGGA
GCATCCAGGATTATGTCAGGTAATACTAAGCTCTAGCGTTAGTTCTAGGTTGTGCTATGC
TAGCAGTGTCAGTACTCATGCTCACCACCATGGCTTGTACCTGTCAGGACGGGCTTCATT
AACCTGGATAAACCAGCCAACCCATCGTCCCATGAGGTGGTTGCCTGGATACGGAGGATC
CTGCGAGTGGAGAAGACGGGTCACAGCGGGACTCTCGACCCAAAGGTCACCGGCTGTCTG
ATCGTCTGTGTGGACCGAGCCACCCGGTTGGTCAAGTCCCAGCAGAGTGCCGGTACGTAG
ATGTGACCACTTCCAGCTTTTCCTGTAATTGTTAATTGATCGATCCTGGCTGTCAGGCGT
GTGAGCACAGTAAAACCCAGCAGCCCCCCTCACTACTCTCTGTGTGTGTTGCAGGTAAGG
AGTATGTGGGGATTGTTCGGCTGCACAATGCGATAGAAAACGAGCACACCCTGGCCCGGG
TGAGTCTGCGCATGTGACTCCTTTTAGTCCAATTCTAATGGCCTTTTACTAAAATTTCAC
CTATATACTGTAGATTGGAATGTAGGCCTGATCTCCAGATCCAGTTTGTGGCGAACTGAA
GCATTTGTATGAATAGTTTTAAGATTTGGAAATTCTCCACTATGATGAATATAATTGCAT
CACGTAAACCATCTAATGGCTTCATATAATTCACAATGTCCCAGGGCCTCCCCGATTGGC
TCGCTGTAATGTGACTTATTGTCTGCAGGCGTTGGAGACGCTCACAGGCGCATTGTTCCA
GCGACCGCCGCTTATTGCTGCGGTCAAACGCCAGCTCAGGGTCCGCACAGTCTACGAGAG
CAAACTGATTGAATACGACCCCGAGAGGAGATTGGGTAAGATCAATTATCTGTCATTCAA
TTCCACCTCAAGTAGGCTCATTTTGTGTAACCAGAAATTTGCCTCTGCGCACGGCTTGTG
TTCCCGAAACCCTTGGAGCTAAACCCCAATACGGAGAAAAATGGAAGAAACCTTTTGTAG
CAGTAGAGGAGGATCCCTCTCCTGGGATGGAAGAGTGCAAAAGATGTTTATGCGTACAGA
ATCCAAGAGATTGGTTGAGGTGACGGGATGTAACATGGCTCTTACAGGTATCTTCTGGGT
GAGCTGTGAGGCGGGAACCTACATCCGGACTCTGTGTGTCCATCTGGGTCTGATGCTCGG
GGTTGGAGGTCAGATGCAGGAACTGAGGAGAGTCCGTTCTGGAGTACTAGGGGAGAAGGT
CAGCACTACCTCCTGTGATGTCTGATACAAAGTGTTGAGTACAGGCCTGCTGCTCGGTGC
TGGTCTGTTAATTCATCTTTGGAACAGAAAACCTGCAGCCGAGGCTCAGATTGCATCATG
TTTAGCGGTTCTGGAGTCTCACTGCTGCTGACATGATGATGATGATGATCATGCTTACTG
TGCTGACCTGGTCGTGACATGACTGTTCTCAGGACCACCTGGTGACTATGCACGACGTCC
TGGACGCTCAGTGGCAGTTTGATCACAACAAAGATGAGACGTATTTGAGGAGAGTCATCT
TCCCTCTGGAGAAGCTGCTGGTGTCCTTCAAGCGGTTGGTGATGAAGGACAGCGCTGTGA
GTCTCAATATAAATCAATACAACTATAATGGCAAAAAATGAAGATTAATTGAATGCTTCA
AAGCATTAACTTTTGTCACCTATCATTGTTTTTTGATCAGCCACTTTGACTTTGACGTTT
CCAGGTGAATGCAATCTGTTACGGCGCAAAGATTATGCTACCTGGTGTCCTCCGGTATGA
AGATGGCATTGAGATGAACCAGGACATTGTAGTCATAACGACCAAGGGAGAGGCCATTTG
CACAGGTGAGACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGTCTAGGTGAAGCCACATG
ATGAGCTCATAGATGCAGCAGCTCTCGGGCAGTGATGACCTGCTATCTATCACCCTTTTC
TGATGGCTCAATGTTTTGGCTCAATATGAATAAAAAACTTGACTTGACTTAACAAAGCTC
TCCTCCTCCAGCTGTTGCTCTGATGACCACAGCTGTGATCTCCACTTGTGACCATGGCAT
CGTGGCAAAGATCAAAAGGGTCATCATGGAGAGAGACACATATCCTCGGAAGTGGGGGCT
GGGTCCAAAGGTAGAACCTGTGAATACTTTGGTAATCAAAGTTTATTTACAATTATTCTC
CAGATTAACTGCTTGTTGTTGACAGGCAAGTCAGAAAAAGATGATGATTCAGAAAGGACT
GCTGGACAAACACGGGAAGCCCAACGGCAGCACACCCAATGACTGGAAGAGCCACTATGT
GGACTACAGGTAAGCATCACCTGGGGGGCGGGGCCAGTTGCAACGTGGAGCCTCACCTGT
TGTGCAGGCAGTTATCCCTTGTGTAGCTGATGTGCTCTGAGACTGGATTGCTGAGCTGCA
GCTCACCTGAGACGAGCAATATGGCTTTTATAATGTTGGGAAGCACTGCAGACTGATGTT
TAAAGCAAACTTTTTGTTTTGACAGCGTCTCTAAGGTGACTGCAGAGTCATGTGACACAC
CGGCCAAGGTCAGTCACGTGCTAATGGAAACCACTGCACAAAGTATAAATGCAGATAAAC
ACTTGACTTTTACCCGTAACTCATTCAGTGGGTTGCAGAACACGTCTCTACATAACTGTC
ACATGACAAAGCCTCATGTCCAGAGACTGATTTCATGACTCGCTGACCTTTGTGCCCACA
GAGGAAACGGGAGGCATCGGACAGCGACTGTGAAGCCATGACGACACCGAGCACACCATC
GATCGAAGTGAAGAAGAAGAAAAAGAAGAAAGAGAAGAGGGCAGAACTGGTGGAGCCTGA
GGAGACAGTAACTGAGGTAGAGGTGAGTGATGGCATTCAACACCGCTAAGGTTGGGTACC
AAGAACCCGTAGGTACACTGATGAAGTACCAACGAGCGGATGTCTGCAACTGCTCCCTCC
CAGAAAGTAGAGTTTGAATATAAAATCTGTGACGTCATTAAATTAAGACAAGGAGCGTTA
CTCTAATATAAATGCTTTTCAATAGATTTGACATATCTTTAGTTCCTGCACAATGAGCAC
ACATTAACTGATTGGTATTCCCCAAATTCCAATGAACTAAACTTCTGGCTCTTAAACACT
AATTATACTGTAAACGATTATTCAGTTTGAAGAGAAATTTCCATGGCAATAACCTTTTAT
ATTGGTATATAAAGTTTTTTTTTTTTTAATTGTATCTGTTTATCATTGCCAACGGAAAGT
AAACAGTTAAGATGAAAGGACTTTAAGGAGATTGCTGAGGCAATGAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 1306..1392, 1787..1878, 1967..2151, 2274..2338, 2608..2734, 2987..3117, 3332..3475, 3604..3724, 3911..4029, 4105..4206
1001..1069, 1306..1392, 1787..1878, 1967..2151, 2274..2338, 2608..2734, 2987..3117, 3332..3475, 3604..3724, 3911..4029, 4105..4206
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved