Gasterosteus_aculeatus Locus EIF3S9
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus EIF3S9
Gasterosteus_aculeatus
EIF3S9
groupIX
SNORD60
5574..5657
8106
TCCAGAACCGAGCGTTCCTGCAGGCGGCAACATCACCGGAGGAGGGAGGGGGGTCAGAA
TTCCTTTTTCTCAAAGTTTGGTGAAAGTACAGTCGGTGGAGGTTAACTCCACCTGGAGCT
TTTCGTAGCCGTCCTCCGTTGCAGCCATCAGGCCGGTGAGTCTGAGGGCGAAGGAGAGGA
CACCGGGGTCCACAGCCGTGTTCAGAACCACGGTGGAGATGAACTCAAGCAGACACGGGC
AGGCCTCCAGCAGGGATCCCCCTTCAGGGGGGGGAGAGAATGTGATGAGTGACACAGATC
CAACAGCCATCTATCTGCAAAAAGCAGCTTCAGCTCTTATAGTTATAAATATTACTGATG
AAAGTTCACCTGACATTAACCAACATTAAAGCACCTAAAGGCAGCAACTTCAGAGCTTCA
CAGACTGAAGGAGACGCGGACAGCGAGTGTTTCTTTGGTACTAACCGGCCTCGGTGAGCC
CCGTGAACCAGTCCAACAGCTTCTCCAGGCTGGTGTCGTCGGGCAGAGACCTCCCCGAGG
CCGCCAGCACCGCGCACACGCCGGGCAGCAGCGACGCACAGTCCGCGTCCATAGCGAGGA
CACGCTTGGTGTCACGGTGACGCGTTCACGGCAAGTAACTTGTCTGGAAGTACCGCCCGG
GGGGTGTTTGGGGTAGCGGGGAGCGGAAGGGGACCGAGTAACGGGGATAACTAAACTTAG
GAGGTTTTTTTCCATGTAGTTTAGCTAAACGTCCGTCACGCGGGAAACCGTTTCAGATCT
CTGGCTTCCAGTTTAAAAAATAAATAAAGACACCTGCGCTTTTTTACTGATCTGTAAACA
CACGGAGAGAGAATTAACGTGACGGTGGCCCAGTGCAAAATCGTTCCATGTGGTTTACAA
CTCTACTGTTCCACCTCGCAGCGAGGCCTTCCGCGTCGAACTGGTTCCGGTGTCACGTTT
CCGTCGAATCGTCCATTTTCACAAAATCGCACATGGTGCCACACCGGTTGAGGACCGTCA
GCCTCTTTATTTTTGGGATTCTTGCTCCGTAGTAGCGAGCAACCCGTCTCGTGGTACCTG
ATAAATGCAAGATACGGTGGATATGGTGGACGATCCCGATTACGACGAGGAGGAGCCCTC
CTTCAGCGACCCGGAGGACTTCGAGGACGACATCGAGGATGAGGGTGAGCGGCAGCAGGA
AACAGCCCGGCTTTCTGGCCCTTTGCTAACCGCTAGCTACGAGCCGTGCTAGCTCTATTA
CATGTCGTACGAACGCTACAAAGCTAGTTAAGTTAATTACGTTGTCACCGTGTCTGCCGA
ATTCTAATGTTTAATCCGTGGAAATGTATTAGCGGGTATACGGCGGATAACGTTAACGTT
ACATCCTCATTTTCCTTTTCAAACGACCCTCGGGTTTAATTTCCCGGCTATTAAAGCCTC
ACCCAGACTGTGGCCTTGTCGCTGTCACATTATCACTTCAAACAGGGGCATCGGCGGCTA
ATAAAAAGCATTTTTACAATAACTGTCTGAATTAATATGTAAGACCACGGTCGTCACTGG
GAAGCCGTTGGTCTGTGTTTGGCTTGAAGCAGCTGGTGAACGACGCTAGCTTTCACCCCG
GATGAACCTTCATGCTAGCGCCGGGTGGAGGGCAGATGGGCGCACAACGCCGCTCATGTC
TGCGCAGAAGAACGTGAACAAATGACACATCAGCAAATCGAGTAGTTTGCTGAAATCAAG
GCATATTCCCGGTTGAAGTATAACATGTTCAATTTCCGTTCTTGGAGGTGTTGGTTCCAT
TATATTATGTTCGTGGTTTTGTTGAATGGCTTTTCGATATAATGCCCACCGCATTTATAT
TAAATAGTGAACGCTAAACATTAGAAACGATTCACGGCACTAAAACCCCCTAAATTAACA
ATACAGTACAATACATCTCTAAACTATTATATTCATTAGTCTATGACAGGTGCACCTGTT
TAATTGACAGCACGGTACAGAGCACTTTTTGCATAAAGTGCATCATTTTGGTTTTATTTT
CATAGTGAACCATCTTTCATCTGCTGTAGAAATGTTTTACTCTTGTGCATCCTGTTGACC
AGGTGGTTGAGGCTGATATTATACTTTTAAAACATATTTTTTATTTGCATGTATTTTCTA
ATTTACCTTCCCATTCTACAGCCTAAAGCATAAAAGGGCTGATAATCATTTGAACGATCT
GAGAAAATTAAGACGACAGTTTCGTCGCGTTTTGGTTTGAGAGCGGCGCGTGTTGGAAAT
GGTTTAACACCTCCAGATCAGATAAGCGACTAACGTTAGTGTGCCCTCCCCAATCTTCCC
CCACCCCCTTTTTTTCCCTCCCCCTGCGATTCAGAACTCCTCGATGACATCCTGAGGGAG
AAGCCCCAGGAGGCTGACGGCATAGACTCGGTGGTGGTGGTGGACAATGTCCCTCAGGTG
GGGCCGGAGCGTCTGGAGAAACTCAAGAACGTCATACACAAGATTTTCTCCAAGTTTGGC
AAGATCAACACCGAGTTCTACCCAGAGGCTGACGGCCTGACCAAAGGGTACGGGATCTGC
TCCATACGCTGCGTTACTCGCTTAGTTGTGGGACGTAACCGGTTAAACAAACCCACGTCT
CCTGCAGGTACATCTTCTTGGAGTATGGCGGCCCCAGCCAGGCCCTGGAGGCGGTAAAGA
ACGCGGATGGATACAAACTTGACAAACAGCATACGTTTCGGGTGAACCTCTTCACCGACT
TTGACAAGTAAGGGTTCAGTGTCGGATAAGAGACGCACCAAATGGGCCGACGGATACATG
CAACGTGCATTCATTCTGTTTTCTTATTCCGCCAGGTACATGAACATCAGTGATGAGTGG
GAAACTCCAGAGAAGCAGCCGTTTAAAGACTTTGTGAGTATTTTCTTTTTTTAAATAATA
AATATTTACGATTCAGAAGTAGTTTATTACGTGGCTTTTTGCTTTTCTTAAATTGAGCAG
AAATAGGAGTTTTTGCACTGGTATAATCCTTTGTCTGTTTAGGGAAATATGCGCCATTGG
ATTGAGGACACGGACTGTCGTGACCAGTACAGTGTGATCTACGAAGCTGGAGAGAGGACC
GCCATATATGACAACGATGCTAAGGAGCCAATCGTATCAGAGGAGAGAGCCGTAAGTAGT
GTTAATAGTGTTTGTAATGAATTGAATATCCCATTCTTGGACAACTTGCACACTAATAAC
GTTTTTTTTATTATATATACTTATGCAGCGCTGGACGGAGACGTACGTGCGCTGGTCTCC
TAAAGGCACCTACCTGGCCACCTTCCACCAACGGGGCATTGCATTGTGGGGCGGTGAGAA
GTTCAAGCAGATTCAGAGGTTCAGCCATCAAGGCGTGTCCCTCATTGACTTCTCACCATG
TGAGAGGTAATCATTATTGCTCTTAAGCACCAGTAATTGACACTATTTTAGGATTAGGCT
TTGGGTGCCGATGTGAACTAATATGCTTTTTCAGTAAATTAGGCATTTCCCAATCAAGTT
TTTTTTGCCCAAATCTAAAGAACAGAGGGTACTTCCCTTTATTCCAAAACTGGAATTCGT
GGTTCCAAACTATTATGCTCATGAGTGTTGTGCTGCCTTCCAGGTACGTGGTGACCTTCA
GTCCACTGATGGACACAAAGGAGGACCCACAGGCCATTATCATCTGGGACATTCTGACCG
GACACAAGAAGAGAGGTTTCCACTGCGAGAGCTCTGCACACTGGCCCATATTCAAGTCAG
TGATCCCCTCTTATTGTGACTTTAACATCAGTTTTGCCTGCTGTGATTTGAATTTATTTT
AATGGAGGATATTGGTTCCCAGGTGGAGCCACGATGGAAAGTTCTTTGCTAGGATGACTT
TGGACACGCTGAGCATCTATGAGGCACCAGTAAGTACTAAGAAAACAACATTTCGTTGTA
TTTGTTTAGAGGGCAGCTCACCCTTTTCACCACTTTTATTCTCTCCTTTTTAGTCAATGG
GTCTGCTTGACAAGAAGAGTCTCAAGATTTCCGGGATCAAGTAATGAAGATGATGCTTTT
ATTATTATTTTTCTTGTAATTGGGTGCTTAAAATTGTGACATATAAACAATAATCTGTGC
CTTTTGTTAATCTACAGAGACTTCTCATGGTCCCCCGGTGACAACATCATAGCATTCTGG
GTACCCGAGGACAAAGACATCCCCGCCAGAGTGACTCTGATGCAGATGCCTACCCGACAG
GAGATCCGCGTCCGAAACCTCTTCAATGTGGTCGACTGCAAACTGCACTGGCAGAGAAAT
GGAGACTACCTGTGTGTAAAAGTGGACCGGACTCCCAAAGGAACACAGGTAAAGAGGAAG
AGGCAAATACAGCTCAGACCTGACGAAGAAATAGAAGAAAATGCTCACTTTCAACCTCTT
TTTAAAAAAAATTTAGGGCGTCGTCACCAACTTTGAAATCTTCCGCATGAGAGAGAAGCA
GGTTCCTGTCGATGTGGTGGAGATGAAGGGTAAGAACTATTTCTTTAAAGGTAACCTTTT
TACATTCTTTCCCAAAAGAAATGCCAACCCTGATGCGTTTGTGCGTCTTGTCTCTGCAGA
AGGCATCATTGCGTTCGCATGGGAACCCAACGGCAGCAAGTTCGCTGTCCTCCACGGAGA
GTCTCCCCGAATCAACGTCTCCTTCTACCACGTCAAAAACAACGGCAAGATAGAGCTCAC
AAGTGAGTGGATCAGACTGATGTCCAAACTTTCTTACCGGCTCTCGGTTCCGTGGACCAG
CGCGCAGGCTGAACCTCCACTAACGGGCAAACCTCTTTTCCTCCAGAGACGTTTGACAAG
CAGCAGGCCAACAGCATCTTCTGGAGCCCCCAGGGACAGTTTTTGGTGCTGGCTGGACTC
AGGAGGTCAGTTAAATATGTGTGTGTGCGCTGTGTCTTTAGTGACCGCAACAAGGAGCCA
CTGATGACAAAACAATTACTTTTCTGACACCTCGTATGAGAGCTAAGCTCCTATGATTCT
AACTCCGATCTGAGGCTCACGCTATCGTATATCTGTTCGTTTTGACGGCGGCGGCGCGTG
CGGTTCTGTAATCGGCTGTTCTCCTGTGCGTGTTCAGTATGAATGGAGCTCTGGCCTTCG
TGGACACGTCGGACTGCACCTTGATGAACATAGCGGAACACTACATGGCCTCTGATGTGG
AGTGGGACCCGACCGGCCGCTACCTCGTCACCTCCGTCTCCTGGTGGAGCCACAAGGTGC
GTTCCGCAAAGCGGCGCCACACTGCTGGCAGAGCGATTCCCACTTGTCTGGGCCAACATT
GTAACAAAGCACTAACCTTGCATTAACATTCCTCCACTTTTTTTTTGTTTGTGGGTTAAA
GGTGGACAATGCATACTGGCTGTGGACGTTCCAGGGCCGTCTGCTCCAGAAGAACAACAA
GGACCGCTTCTGTCAGCTGCTCTGGAGACCCAGACCTCCTACCCTGCTCAACATAGAAGA
TATCAAGGTACCATTACGTCTTAATTATAGACCATATGCACACTGGGGCTGTGAAGCCAG
TGATGACAAACAAACTTTTCTGACACCTCGTATGAGAGCTGCACTGCGGCTCCTGATTCT
AACGCTGATCTGAGGCTCACTCCTACAACCTCCCGTGTGTTGGTGCAACGCCGCCGCTCT
GTTGTTTTGGGGCTGTGGAGCCGTCCTTTTCACAGTAAATATCCATCTTCCTCCTGCAGA
CGATCAAGAAGGATCTCAAGAAGTACTCCAAGATCTTTGAGCAGAAGGATCGTCTGAGCC
AGTCGAAGGCTTCTAAGGTTTGTGGCGTCCATTTCTCTAACAGGCTGTTCACTGTCCACA
CAAGCTGAACCTTTCTATGTCGTAGTTTGGCGCGATGTCAAGAACCATAAAGTTGTGGTT
CCTCCATCTCTGTCCCTCATGAATAGATCTAAATGCATACTTACAGCTTCCCTACCAGAG
ACCAACAATGATACTGAATGCTTTGTGTGTGTGAGTAGGAGCTGGTGGACAAGCGCAGGT
CCATGATGGATGATTACCGTAGCTACAGGGAGACTGCACAGCAGACCTATCTGGAACAGA
AGAGCTTGCGCCTCGAGCTCAGAGGAGGTGAGATATTTATCCTGTTTCTCCCCCCCCCCC
CCACCGCCCCATAGTATTTGTTTTGAGTATATCACTGACGTGTGTGTGTGTGTGTGTCAT
CCAGGAGTGGACTCTGATGAGCTGGACAGCAATGTGGAAGACTGGGAGGAGGAGACCATT
GAGTTTTTTATCAACGAAGAAATCATTCCCCTTGGAGATCTGTAGTCCCTTCGCAGGTAA
CAAGTGTGTCCAACACGACCCAGTGAAATGAAGAATGTGTTCACCTGGTTTGAATCCCGT
AAAAGAAACTTGTCAACAATTAGAGATATTTTCATTCTTATAGGCCTACAGTTTTTTAGA
TAAATTCTTCTAAAATGTTGGTCAACATTTGTTCATTAATTTCATTTTTTCATTTATAGT
TGGTGAATTCGCTGTATTTATTTTTTTCCCCTCCGTTTCGGTTCCTGTAGTTAACAAAGT
TTATTCTTTCACTCTTTCTCTCAGTCAATCCGTTTTTGTGTGGAAGGAGGAGAGAGGAAC
TGCGTCATTGATTGGAGGACGACAACCACGCTGTGAATTTTAGGGTTCAAGAACCTTAAT
ATTCATATTTAGCGACATCATCAGAGCACGCCTTGTGGATCAGCAGCCACATCCAGAGAC
AAGAGAGGATACTTTGTATTTAATATTTTCTCTTTGTCTCAGAGCATCATTTTTTTTATT
TTTTTTGTGGAACTTGGTATTTAGTAATACTGCCTCCTTTTTTTTTATATTCACCAACCG
GAGTAACTCGCTCACTAATCTCAGCCCCGCCTCTTATCGGACCTTCTTTTTTCCAGGGGT
CTGTGTTCTGAACTAGCCTCACTGTGCGAGTGTGTTATCACAGGTTAGCACAGGGTGCCA
TGCCAGCGGGGGGGGGCGGGGATGTGACTAAACGAGGGGCCTTTGTTAGAGATGTGCTGA
TGTGGCGCTATAGTGGCCTGTATCCTCCTCCTTTCAGATTAGCCTTTCACACAGGGAGTG
CGTGCGCAGTGGGAATGACTTTAAATAAACCTTCAAACACAATGCTACCTGACTGTGTCT
CTGTGTTTGGTTCCTTTTTATTGGAGAGAGTATCTTCGGTTCCTTCGGTCCCTTCAGTGA
CACACAAACACGTTTTGATAAGTTTGAAATTGTGTCAACCCAAAAAAATGCAGTGCTTTA
CTGATCAATTTCCTTTTGGATTGACGTTTGTACGAAACAATTTTAATTTGATAGAAATTA
TAAGGAACTGATTTATTAGCTGTACCGTTCCGAGGACCCATGATCTAGTGAGGATTCAAT
GCATCTGACACATTGACAGGAGGGTAAACATCTTAAGACTTATTGCATCTCTTAACCACA
TTTATCTTCATAAGCAGTGAAATGTTTGTATGTAAACATGTCAGTAGCGTAATGAGTAAC
TAACCACGATACAGTGAGGGTGTCTCGCTCCTCGCATCACAAGTTTCTCTTTGTCCTTCT
GTCATCGAGCAGTCCTCATGCATTCATCGAGCCGTCCCCACAGCAAATCACCGGTGGTTC
AAATCTGCTTGTGTGAAAGTAAGATCACGCAGTGCGATTTCATTTGCGTGGAATAAATAA
CCTGCAAAGACTTGTTGGGAAGTTTTCCAGCGGCTCACTTTGACCTACGTCCATAATTAC
AGTGCCGTCGTGGGTTTTATATCCCACATTTTGCCTCTCAGTTTTCAGCACAAACCGGTT
CTGCGGCACAGAGAACAGTCTGTTCTTTATGTGTCCGGCACCGTTCAGCTTCATCAGTGG
ATCCTTCGTTGCGATGAGCCAGTGTCGCTGCGCTCTTTGTGTTGACTCTTTATGCGGCAG
AGATCTTTTACGGAACGCGCCGGTCGACCAGCATCTGTACAGACGATGTGTTTAAAACGT
CACACGCCATCTGAGCCGTGACCAAGTAGAAATGCTGTGGGCCAAAAGATACTTATTACA
AGTAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1183, 2374..2566, 2647..2766, 2855..2912, 3042..3170, 3268..3425, 3643..3774, 3862..3928, 4013..4059, 4157..4367, 4456..4549, 4619..4741, 4846..4924, 5137..5275, 5401..5526, 5759..5836, 6038..6146, 6244..6355, 6624..7106
1084..1183, 2374..2566, 2647..2766, 2855..2912, 3042..3170, 3268..3425, 3643..3774, 3862..3928, 4013..4059, 4157..4367, 4456..4549, 4619..4741, 4846..4924, 5137..5275, 5401..5526, 5759..5836, 6038..6146, 6244..6341
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved