Gasterosteus_aculeatus Locus RPS3
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPS3
Gasterosteus_aculeatus
RPS3
groupI
SNORD15, SNORD15, SNORD15, SNORD15
1841..1986, 2570..2719, 5031..5179, 6043..6191
7341
TGTGTGTGTGTGTGTGTGCGTGTGTGTGACACTGTTTACATTTCATCATGCACTTTACC
AGTAATTTCTTCTCTTCTTCAATTGGCCCATTAGGCTTCTTTGTGCACATTCACGGTCTC
ACTCCTCAGTTGCTCAACCACGCTTTACTCTATGACAACGTAATATGTAGTCATCAAGAG
TAATAATTATTATGGCATTCTGTAAGACTTTAAAATTGCATTGATCAAAGTACAGTATAT
GCACTGCATATGAATGACAATCTTTTACACGCCACTCTCCAGTTTGGTACATACAAACGT
TTCAGGAAGGAAGGAGGACTTAAAAAAAAAAAAACTTAAAACTATTGGTTTTATTTTTCA
ATGTTATCACATGTATCACAGATCCCACTATATGATCAATGCTATTTCACATTGTCCCCC
TTTTGGTATATTAATTTAATTTTACATGCAACACTTGGTTCCTATTATGTGCCTCCCTGC
TGCACAAGCAACTTCAATAGGTGTTCATGCAGATAGCCTTCTCATAACACTAATTAGCTT
ACTAACATGACTACCTCCAAAAGTTAATCTTACACGATGGAAAGTTCGTTTCTTTGACAG
ATACTCATCTCATCAATATGTATTTTCATTTGGCTCCAATGCTTCAGTTTGTTTGCTAAT
TTGCTAGTTAAAAGAATACATCCACAAATAACAACAGATTTCACCATTCCAGCTGCAATT
ATGAAGAAAGCAGAAACTCATGCACTCAACGCAGCAAAATCACTATAAATATATAAATAA
TATATTAAATACGAATGTAAAACTATTCAAAATGTGTTCAACTTTCTTAGACATACTGGC
TAAATGAATCATTTCCCGCGGGTATCAAAGATAGAATCAATTTGCTTGCTTCGTATTTAG
AACTACAAATCCCAGCGGCTTCTTGAACAGACCATCACCGGAAGTTCGTCATGTTTGTAT
AAAGCCATTTCCGTATCCGCTGGTGGTCCTTTCCTGTCTACGGCCTTTCGGAAGATGGCG
GTGCAAATCTCGAAGAAGAGGAAGGTTAGCGCTAAATAATCTCCGTTTTACCCACACAGA
CAGGCGGTTTGTACATAAATGGGGTGACCTTGGCTAGGATATGAACGTTTAGTGTTCATC
CCGGTGTCGGTCGAACTTGTGAGCCTCCGGTCCTGATAGGATTAATCCAGATTGTCCCCC
GCGTCCTCATTGGGCGAGCTAGCATGGCTCCCTATCGCCTCGGCCGGCTGCGAGTTTCAA
GCAGATACCCACCGAGTCGAGCCCCTTCCTCTGTTAAAACTCCGTCGGGTTGTGTTGAAA
ACATGTTTATTAGACCTCCAACCCCGCGAATATCTCCACGTCTCCTCTTAAGCGGAATGG
GTTCATAATGTGGAGCAGGCAGCTAGTGAGAGAACGTTAGTTTCCGAGTCAATTTAAATC
GGCCCTCTAGATTAAGCGCTATACAGTTTGGATGAAAATACGAAATACAGTTTGACGACA
CTAAATGCGGAGGGACATCTGACAGGACATCGTAAATGAGTTAACTTTGAATCCCTGTTA
GCGACTGACGGCAGTTTTGTACGTGACCGTAACAAGACTTCTGAACATCCCTAAACATCT
GATGTGGTTCTATTTAATGGAACTTGCATGTAGAAAACTGCTAATATTATCCGGTTACAG
GGATGCTGTCGCAGATACTTAATGCGGTTATAATATTGATCGAATAGGTTTCTCATCCAC
AACACTGTAAAGAACTGACATTATTGTCTTGAACAGCTTCTGTATTCAAATAGTGAGAAT
ACAACGATTTAGGTCACAAGCGTAACTCTTAAATTCCCTCCCTTCAGTGATGATACGATG
ACGAGACGGAATAAGGCTCCAGTTCTGTGGGTTACTGGTTCAGGTCCACGTCCTGTGGTT
CGGCTCCAGTTCCTCAGACCAGGAAGTCTTCTTCTCATGAAGACACAGAGGCATTTGTCT
GAGAAGGGTCGAACTAGAAACTGCGTATTGAGTTGCACGTCAAAACACCTCCTGTTCTAA
TAGTTCATAGTTTAATTCAATATATACATGTAGAATATAGTTAGGATATCAATGATATAT
TTATAGTAATTACTAATATTAAATTATCTGCTTTGAGTTATAAACTATAAACATGTCTGA
GGTTGAGTCCTGTTTACATGTCTTTTGATTCCTCGTCTGGGGACACATTCTCTGCATTAA
GTCCCGTGTTTCCCCTCCGTTGGACAGTAGGTGAGTTGACCCTGTCTTCTTCCCGTAGTT
CGTCGCAGACGGTGTCTTTAAGGCAGAGCTGAACGAGTTCCTGACACGCGAGCTTGCTGA
GGATGGCTACTCCGGTGTGGAGGTGCGTGTGACCCCGACCAGGACTGAGATCATCATCCT
GGCTACAAGGTGAGTGCCTGGCCTTGAATGTTGATCATACATGAGTTTTAAAAATAATAA
ATAAGTGTGTCATCAACCATTGCAACATTTAATGCCACTAAGTATCTGGTATAGAGTTCA
CTGTACCAGCTTTCATCTGTTGTACGTAGCCGTGCGTTTGGCCATTGTCCCTTCAGTGAT
GATACGATGACGAGTCGGAACGGGGCTCAGACTGCTTCTGAGGGTTCTGGTCCAGATTCA
CGTTCTGTGGTTCCGCTCCAGTCCCTCAGAGCAGGGAGTCCCTTTTTGGTTGAAGACATT
GAGGCATTTGTCTGAGAAGGGTTGAAGCAGCACAAACGCAATGTCCCCTGCTGAATGAAA
CGTGGTGGTAGACTTAATGAAGAGAACCTGCATTTTAAACTACAGATAACGCTCAAGTAT
GACCAACGTTCAAAATGTAACCTTTACTTGCACTCAGGGAATTTAGATTGCTTCATTGTC
TGAATAATACACACCTAATATACTCCACCTTGACTATTAACCCATCTACTGTTCCCCCTT
TTCACACAATAGGCACTGAAGCTCGACTTTGCTTTTAATATTTGCTGCAGTGCATGTTTT
TTTTCGTCTGAATTTAATCTAATCCTTAAATTTCCTATTCTAAGGACCCAGAATGTTCTT
GGTGAGAAGGGCCGCCGGATCAGAGAGCTGACCGCTGTGGTCCAGAAGAGGTTTGGCTTC
CCCGAGGGCAGTGTTGAGGTAAGGAACATGCAACAAGTAAAGCACTGAAGTGTTTTCCCC
ATGATTTACAACCTTGCCAGCTAACATGTAGGACTAAAGGTTTTAACTATTCTGGATTTA
TTGGTGTAATAGTTTTAATGTATTAAGATGTGTGCAGATTATTTGTAGAACACAGTGATG
CATGTCCCAAGCATAAACCTCTTAATGGCCTTCCTTCAGTGATGATACAATGATTGGGGG
AAAAACAGGAATCTAGTTCTGTGAGTTACCGGTTCAGGTCCACGTTCTCAATTTCCTCAG
ATCAGGAAGTCCTGTTCTCATGAAGACGGGCAATTGTCTGAGCGGTTGAAAGAGCTATTA
ACCTCTCCATAGTAGCAGTAATCTTATGTGCATGTTAAGTCTCAAGCATGTGGATGTTCA
ACATTCATGTCATCAAGAAAGAAAACACTGGTACTCACCAATGGCCCTTTTTAAGCTCAC
CTGCAATGCTGCGTTTTCAGGATGTTTAACGTTCTGACCCTTTTCCCCTCTTCTTAGCTG
TATGCTGAGAAGGTTGCCACCCGTGGGCTGTGTGCCATTGCTCAGGCAGAGTCTCTCCGC
TACAAGCTGCTGGGAGGCCTGGCTGTGCGTAGGTAAGAAGCGTTGCATAATACCTGTAAC
TTTGTGTTTACCCTACCGTTGTATCAGGAGGACGCAGTTCTGTCCCAACACATGCGCTAA
TATGTCTGCCGCACACATGTGGCGCTTGAACCAGCCAACGGAGCACCACTGGACAGACTA
GATTTGGTGGATCTGTTTATGTTGAAGGTGTATGTTAGGGCTGCAACGAAGGATTTTTGA
TAATGGATGACTGATGGAAAAAAGCTTTAATGTCCAACCCTTTATTCTAAAAGAGAACTG
CAAATTCACATTGCAAACGTACTTCAGGACGTCCACAAACGGGTTGCCCCTTGAACATAA
TTTGTAAAAAATAAACTACAAATCAGAAAATTTAACAGGATTTATTTTAACCTCAGGACT
TCTCTACACTGAACTCAAAATGCACCCCCATGTTCACGTGACGCTTATTCATTAAATGAT
TACCATCATTGTAGTGAGAGTTAAGTAAATGTATACACATCTAAATACAGCTAAAAAATA
ACAAAGTGCTATGAGGTTACTTTAAAATGGCATCAAGTACAACACACACAAATATCACAC
TTCTGCCTGAGTCATGTGACTCACCATAGCGCTCTTTCCCGAGTCAGCTTGGCTTTTTGC
ACCACACATCTCTGCAACTCATTGAGTGACGTAATAATCACACAATACAACGAACCAATG
AAATTTGTTGCCAACACTTTTAATAATCTATTTCATCATTTGTGGTTTCAGCCGTAGTAA
CCTTTAGAAAGATTTACAATATTTCTTATTGCTGCATCAGGTCTCTTTAACATATCAAAT
GTTACTAGTCAGTGACTATAATCGGTTGCTTTGGCTTTTCTGGAAAGTTAATGAAGGTTT
TTTTTTTATATATATATATATAAAAAGCGCAATGATGCAACTTATGTATAACATTGTTTT
TTCTTGTACCAATATGTACCCATAAAATAGGGCTCACGTTTACAACTTAGTAAAGAATTG
TAATGTCAGAAAGCAAAAAACTAAACTTTAGTCAAAGTTAAATCCATTTGAGCAACAAAT
GATTAAATAAAACTGGCTCAACATGGAAAAGGTGTGACTTGTGAATTACACCTCCGCCGC
CCAAATAATGGTATGAGAGCGGTCTTGACCTAGAAGCAGACATTTACTGAACCAAAGCAG
CTTCATGTGGCCACATCGGAGTGTAGGCCTGTGGTTATTTAATTCTCTTCAAAGACCTTC
CAGTGGGGCTGCTGTCGGGGGAAAGTCCATTTAGGTTCTCTGTCTTGGTCCCTTCAGTGA
TGATACGATGACGAGTCGGAACGGGGCTCAGACTGCTTCTGAGGGTTCTGGTCCAGATTC
ACGTTCTGTGGTTCTGCTCTAGTCCCTCAGAGCAGGGAGTCCCTTTTGATTGAAGACATT
GAGGCATTTGTCTGAGAAGGGTTGAAGCGGCACAAACGCAATGTCCCCGCTGAATGAAAC
GTGGTGGTAAAGGGATTTGAGTATTGATGATGCGGAGTTGTACTCAGACTGGTGCTTCAT
GACCACCTGCTTTTACAGGATGAGCTTGAAAGAAGCAGTCTGTACATGCAGTGACATCAC
TGTTGACTCTTCTCAGGGCGTGCTATGGTGTTCTGAGGTTCATCATGGAGAGCGGCGCTA
AGGGCTGCGAGGTCGTGGTGTCCGGCAAGCTGAGGGGTCAGAGGGCCAAGTCCATGAAGT
TTGTGGACGGCCTGATGATCCACAGCGGAGACCCAGTCAACTACTACGTCGACACAGCCG
TCCGCCACGTCCTGCTGAGACAAGGTGAGTACTGCTCCACCAGGGCCACAGGACACCCCC
CCCCCCCCTGCGACTTTGTTTGTTTGGTGCTTCTACGTTGGCTGTGTTTGTGCCCTAACA
TGTTTGTTCTGTGCTCCTACTTAGGTGTGCTCGGCATCAAGGTTAAAATCATGCTGCCAT
GGGACCCCAGCGGTAAGATTGGCCCCAAGAAGCCCCTGCCCGACCACGTCAGCATTGTGG
AGCCCAAGGAGGAGCAGCTGCCCACCACCCCCACATCTGAGCAGAAGGGGGCCAAGCCAG
AGGCTCCCCCCATGCCCCAAGGAACACCTGTACCCACTGCGTAAGGGTAAGAGATGATCC
CGTAAGCAGCATGCTCTGCTCATGGTGCTATAAATCTCACTGAGCAGTGTTTTCATTGTT
AGTAAATAAAATGTGAACCATCAGAACTATAATAAGAAAGACCTAGTCGTACCGAGCCAT
TACTGAGGTCTATCGGAACAACGCGCAACGCAACTTTAAGTCCCTTCAGTGATGAGACGA
TGACGAGTCGGAACGGGGCTCAGACTGCTTCTGAGGGTTCTGGTCCAGATTCACGTTCTG
TGGTTCCGCTCCAGTCCCTCAGAGCAGGGAGTCCCTTTTGATTGAAGACATTGAGGCATT
TGTCTGAGAAGGCTTGAAGCAGCGCAAATGTTGACTTTGGAGTGTCAAATATTCTTTTGA
ATTCTGACTTTTTTTTGTCTTGCAGGTTTTAAAGTGTGCCACCAGATGGAAGCAAGACCC
TCAGACATTTGTGTACAAAAACAATAAATTCTGGAAAATACACTTGCCATGTTGTGGTCT
CTTTGTTACAGAATTAAAAAGCACGCTGAAGTTTCATTAAACTGATTTTGCATAGTCGAA
TTAGCATTTTACTCTGAAACTACACAATTGATTTAAATCAGCAAATTACCTTTATTTACC
CACACGGTAGCTTTTAAGCTATTTAATCTGTAGAACGTTTCCTTTTTTCCTGAAGTTATT
GACTGTTTTAATTGGTCTCATTTGGTTTTCTCGCTCTAACCAGAGCACTTGTATGACCTG
CTCTTGTTGCATTACACTAGCAACCTTTTACATGACCGTTTGGATCAGAACGCAGAACTC
TCAATACAAAAAAATTGGTGCTTTCTGAGCCATATGTGCTTATTTACATAATGTCTGACA
TCAATGAATCAACAGTACAGTAAAAGGAAGAAAAACACGTTGGGCGTTAGGAGTAAATAC
ATTTAGTTTGTCCAGGTTTGTTTCTGCGTTCCCATGAATTTATCCGCGTGATGTAAGCCC
TTAAAGTGGTCACTTTTCTATTCGGAGTGACTCCTCTTCGCGGCGCTAAGGCATCAGGTC
CGGCTTAGGCCACGCCCCCCGCCCGCACCTGTTCACCAGTAAAACCAAACCCTGCTACCT
CGTGGACGGTTCACGATGAGTCTACCGGACTGCAAATCATCGGCGAAGCCGTCTTTACCC
GCAGACCCAGTAAGAAAAACAAGACTTGAACATTTGTTGGCGCAGTAAGGGCTGTTTAGA
GAGCCAACAGGTGGATGTTAGCACCGAGGGGCACATTGTACACCGGGCTCTTTCCTCTTT
GGCAATATGTAAGTAGATGTGAAGAGGCGGGTTCAACAGGAAGCGAGAGGAAACTTCCGA
TTTATTCAAGCAAGACCGAAGTAAGAGATTGTCTCACAATGGAGGATCTTTAACACGCAG
CTACCACCCAGGGAGCTTCTCGTCTCGATATTTGACATTACAATTAAACAAAAGTACTGG
TCTAAACAGGACATCAGCTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 2278..2408, 3044..3137, 3657..3751, 5356..5543, 5664..5865, 6265..6341
1014..1043, 2278..2408, 3044..3137, 3657..3751, 5356..5543, 5664..5860
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved