Gasterosteus_aculeatus Locus RPL10L
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL10L
Gasterosteus_aculeatus
RPL10L
groupXII
SNORA70
1890..2021
5003
AGATGTAAAAGTTAGTGAGAACAGCATCACAAAACTCGCCGTGCTGAGTAATGTGTGAG
AGAACGTCGGAATCACAATTCCTCACATTCCAAGGAGCAACGTTTGTTCTGCATTGTAGA
TGATAATGACATGAGCTCCTCGTGCGTTTTAATGAGATAAGAAAGTAGGCCACAGAAAGC
CAGGGCCTGTAACTATGTATGATGCAATAGTGACATCTAGGGGCCATTTTATAGAGTGCT
TTAGCTCCCTCCACCACAGGGACCTCCACCCCAGGGACCTCCACCACAGGAACCTCCACC
CAGCTGTCAGACATCCTTCACTCATCCTGGTTTTCCCCCTTCTTCACCACAGTGTCTGGA
CTCCAGGGGGGATTCTGCCGAGCAGAACTCACGGCCCCTTGATTCTCCCGGTTTAGGGTG
GATTGTGCATTGTTTCATGTTACATGGTGTAATACATGTTAGTGAGTGAGTTCTTCTTCT
TCTTCTTCTTCTAATTCTACCCGCACTTGTTTGCTGTACTTAGTGATGATGAAGCCGAGG
CTTTCTATGGTCCTCATGGGCCGAAGCTCCACTCTGTCATCTGGTGGACAACAAATGTGC
AAGTGCACCTCCAAGTACTGGAGCTTGTTCTTTTCCACTTTATCCACACGGGGAGTGGAC
ACATGTTGACGGCACAGCTCAAGTTTAGTGGGGTTAGACGGCAACGACGGCGCGATAAAA
CTACACTTCCCAGCATGCAGCTGAAAACGTTAGATTTATGTTTAATACATTGTGCGGCCA
TGTTTTTTAATCAGGAGTGTTTTCATATGACCGAGGAGCTGCTGGAAGAGGAAATGACGC
GTTGAGCACCGCGCGCGTCCTTATAAGGAAGCGGAAGTGACGTCTACTTCCTTTCCTCCA
TTAGGTGAGTACGTGGTGACTGCGTGTTTTCTGCTCTCCGCTCCACACACGGATTTCTGT
TCTGCTTCACAAATGCCGTCCTCGATCTAACCCCTTGCCCCATCGTTTCATCCCTTAACA
GATCGCAACCATGGGCCGCCGACCAGCCCGCTGGTAAGTTTAGTCCGAACCGGCCCGGTT
CGCCCCGCGCGAGCAAAATGGCAGCTGCTCGGACCGCCGCCATGTGCGCCGCGCTGCCCG
CGACCCGCTGTCCGCGGACCCCGGCCGCTCGCACCGACCGACCGCGCGTCCGTTCGCTCT
CACGCCGACTCGCGTCTTCAATTGAGACGCCAACCGCAGCTTGACGAACGCGGCTTAGGC
TAAAGTAGTTTAGCATTGAGCTAACGTTAGCACACCAGGCTAACATGGCCGCTCCACTCA
CCAGGCGGCTGTAAACGGCTTACATGTATCTAGGACGCCTGTAGCTTTGACATATTAACA
TGTATGATGAACCTGTAAATAGTCTAATTCAGCTAAAAACTATTTAATTTAAATGTTCTG
TGATATCTGCGAGCTGCTGAGACGCTATAAAGTGTCTTTGTCCGTTGCGTCGTAGGGCTC
TGACGTCCATGAGCTTCCCTAGTTATCTTCTCAGCCCCGCGAGGCCTTCAGCTCATCGAT
CGAGTTGAAGTTTGAGTGAATCTGTGTTTGCTGTAAAGGCAGATCGTGTATTCTGTTTCT
AACCGGCTCACACCAACATTTAAACAACGATGGATGAAGTTGGACCACTAGTTATGTGCC
ATTGTCTCCACAGCTATCGTTACTGCAAGAACAAGCCCTACCCCAAGTCCCGCTTCTGCA
GGGGGGTCCCCGGTGAGCCTCTACTGTTGAAATACGACTCAATGCAAAAGCTTGTTTTAG
GAGTAAACTCACTGAATTTATGTGACATTTTCTGTTGGAAATTGAACTGCCGTTGGTTAC
ATTTTCTGCTAAGATCTGTAATTGCAAATCCTGCAGCTTATTAAGCCGACCAGTTGTGCT
CCGTGTGTTCCTGGTGTGCAAAGGCTGCAGACAGTGACTCAGTGGATGTGTATGTTCTCA
GCTGGGAAGTGCTGAGCGCTTTAAGGGACCGCTGAGACAAAATGTTGTCCATACCTGGGT
AACGGTGGACAAGCCACTGCTTCCCACTCACATGTGATCAGATTACATGTTGTACATCTA
TCACATTCAGTCTGATGGCATCATTTCCTGCCTGGTTTCCTTGTGTTTAGATCCTAAGAT
CAGGATCTTCGACCTGGGCAGGAAGAAGGCCAAGGTAGACGAGTTCCCCCTGTGTGGCCA
CATGGTGTCTGATGAGTACGAGCAGCTGTCTTCTGAAGGTGAGGAGCCCCGAGAGAAACC
CTTCCAGCACATGGGACAGAGGTGTCATTGAGGTGTTTATATCGTCCCATGCAGGTCAGG
TGGCTGAAACTCAATCACCTTACCGTTCAGATATAAATCTATAGGGTCACTGCTGTCATG
ATCAATTCAACACATCATTTCTTAGATGAGTTGCAGCCATAGTGCACCTCTCCAAAGACG
TCTGTCGGGTTTGATCCCTGTCCGTCATAGCAGCTGGATGATCACTGGAAATGTCAAAAG
GTGTTTGACCTCATGTATAAAGCTCCGTCCTGCAGTCAAGTGGCACCACATGTTGCCGCC
CAGTGGGCCTCTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAAGAATTACTACTA
GTGTTGAAAAGTAGCCTTGATTTAGAAAACTCGATGCAATCCAAAACCAGACCAAATCAA
AACCAAGGCACCAAAAAAATCAAACATCAGCAGGTTGTGGCCTCTTGTACTAAAGCACAG
GACAGTTGAGCGTGATCGGTCTACTGCAGGGGAATTAAAACCATTGCATTAAAGGGGCGA
GATATTCACCCCGATGAAAAAGACAAAGCAATATTCCCGTCTGCATGATCTTAAATGGTG
GTTTGCAGGTTTACGTGTGCATGTGTCCATGTTGGTGTGCATTTTACAAAGGGTACATTT
TTGTCAGTAAATGATAGATTTGCGATGTTTGTGTGTCCGTGGAGACGGCTCGGCTGTGGC
TGAAGATGGCACTTTCCTCGACTTATTTAAGTCTGACAGTGTTTCCCAAACTGGTGTCTT
AATGGTCTCTCTCCCCCCCCCACCCCCACACTATAGCTCTGGAGGCGGCTCGCATCTGTG
CCAACAAGTACATGGTGAAGACCTGCGGTAAGGATGGTTTCCACATCCGCATGCGTCTCC
ATCCCTTCCACGTGATCCGCATCAACAAAATGTTGTCCTGTGCTGGAGCTGATCGGTGAG
TGATGGACACACAGTCACAGGTAGCCGTCATAATAAATGATGTCATACGTGGGGATGTAG
AGTTACTTGTCCTGGCTGGTGGTACGGGAAGACGAAGCTGTATTAAGGAGAAGGTCCTAT
CTGCTCCTCAGGCTCCAGACTGGGATGCGTGGTGCGTTCGGTAAACCCCCTTGGCACGTG
GGCCGTGTCAACAATGGTCAAGTGATCATTGTCTGTACGCACCAAGGCCCAGAACAAGGA
GCACGTGGGTGGGAGCTCTGCGCAGAGCCCAAGTTCAAGTTCTCTGGACGGCAGAAGGTA
AAGTGACCTTTGCTGAGCTGCCGTGCTCCCCAGGGGAGCCGCCAGCGCTGCAGCTTATTA
AGCCGACTGGTCTCGCTGCTGTGCGGTTCTGGTGTGCAAAGGCTGCAGACAGTAACTCTG
TGGTTGTGTATGTCCTCAGCTGGGAGGTGCTGAGTGCGTTAAGGGACCGCTGAGACAGAT
GCACCGTAGTGTCCCTCTAAAGGGCCTCCATAAGCCCGCTGTCACCTGATCATGTCGTCT
CACTTTTCTCTTCCAGATCCACATTTCCAAGAAATACGGCTTCACCAAGTTTAATGCCAC
CGAATTTGATGAAATGATGGCTGAGAAGCGTCTGATCTCAGACGGCTGTGGGGTGAAGTA
CATCCCCAGCAGAGGCCCGCTGACCCGCTGGAAGGCCCTGCACGCCAAATAGAGCGCCTG
CAGCTTTCTGTGACCAGACTACCAATAAAAGTGGATTGGATTCCAAAACCGGTTGCTTTC
ATTTCACTGTTTCTAGATCGGGGACATTGTTTCACATCTGCTGTGCTCTCCCAGCAGTCA
TCTGATACCAAAATGTAGACTTGTGAGGATGCAGAACTAGTCATTCAGGTCCTACTGAGG
TCCGTATAGCATAAAAATGTCAACTTATGACTAGTTTACATTTCAACCATGAAAGAGCCA
AGCGCGGAGATGAAGCATCCAGCAGCATGTGGGGGGTTCAAAACCCACTGTTTGCATCTG
ACGTATTTAACTTACTTTAATGAAGAGTCTACACAAAGTGCTCAGTGGGAAAACTAGACG
CAAATACAGCTTTATGACCTGCATGTATTGATGTAATTAGATTACTAATTTCATTAATGC
ATTTAGAATGTCAGGTAAGCAAACTATGTACACCGTTTATATTCAATAAATCCGACATGT
GAGCGGCGAACAAAGCGCAGCCTCCATGTTGCCTTTGAAACACTTGCTGTGCATAACCAG
CAGTTCCTGGATCTCTGGACGAGGGGTCCCACGTTCTGCCCGTAGAACGTCAGTAAAAGA
GATCGGAATGTCTCGCAGTATCAGTTGTGTATTTGAATATTTTCCCTACTGGGATCCCGC
AGTACGATTTCATTAAATGGTTTTATAACGCTGAGTCAAACTAGATTTGCTTTAGAGGGA
TTTACAGTTTGTACACTCGCAACGTCCTCTGTTCTGAAACCATCTCCTCAGCACAGACCC
CCCCTCCCCCCCTCAAAACAAAGCCTTGAGAAGGAGGAACCTTTGGAGAGAAACTGGAGG
ATCCCTCTATCACTACATGTCATTCAGCTGATGCTTTTGACCAAGGAAACCATATACAAT
ATGGATCCAACCATAAGGAGGGGGTTAGAGGAGGTTGGAAAAGATCGAAAAGAGTTGTTT
GAGGTTAGAAAATAAAGATTCAATTCTGGATTTGTAGAAAGAGCTTTTGGCAGCAGAGAT
AGAAGCAGAAAAAGAGAGATTGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2257, 3096..3234, 3371..4003
2086..2257, 3096..3234, 3371..3542
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved