Gasterosteus_aculeatus Locus RPS5
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPS5
Gasterosteus_aculeatus
RPS5
groupX
SNORA3, SNORA3
1933..2065, 3394..3526
4869
TGTGGTTATGGACATTTTTCTAAAATCAAAAACTACTATTTTGAGTCCTACGATTTCTA
CAGTCTATGGTTGCCAATGAAAATCTGTCAAACGTGTTCAATTCCTCAATAAAAGACCAT
TTTAAACATTGTTTTTTGTCAGAATTTTTTGAAAGCCATTGTCTATTTGTATTTGTAAAC
TCTACCACCTCTTAATAATTGAACAAACTAGCACATGGATAACACGAATAAATAAACGGA
AGAGTAAAGCTTTAAGTGCCATAAAACATCAGTACAAAATTGTTGAAGATAATTAATTGG
TAAATATATTTCAAAACATCTGTATAGGTTTTTACCTTTTGGATTTTAAGGTTACTTAAA
ATACTTTACTTAATCCTCTTAAAACAAACTGATTCCTCCATCAAAACAATTGAAGTTGAG
ACTTGACTGTTTTTGTATTTTTCTAATTTAATTATGTTTTTGGTATATTTGAATTAATTC
CTTTATTGGTTACAAATTATATTTTCGTTGAAGTTGACCGTTTAAAATGTACATTAATAG
TATTTGACTGAGTTCCAAATGTCACGATGCAATGTAACTTGTAAAATAAGTTTTTGGGGC
TATTCATTTATGGGATACTTTTGGTATGCTTTACACAATACACAATTAATACCCTAGAAT
TTAACATATTTGTTAGAGTTTAAATCTCATCTATTTTGGCTTCTACTCTTAATTTTGTCA
TTAATAGGCGTTGAATTTATGTTGATTTATGTGAGAAATAAGAGTATAGCTAGCAAATTA
TCATTATTTGTACAGTGAACTCACCGAATTATAAGCAAAAAGTAGAAAATGTCCCAAGTA
GAATCGGCGTTTTTTTGTAGGTGTTCTACCGTTGCAGACTTCATACGTCAGAGGCATTCT
AAAACAAATGACTACAAGTCCCAGCATGCACAGCGCCCGGAAGAACCCAGCCATTTTCCG
GATATCTGCACGCGGCGCCTGGAAAAGGCCCTTTTCCGTCTCAGAGAAGTGTGGCACACA
ACGGCAGACACAAGTGAGTAAAAAATTCTGTTTTTACGGGCTTAATGTGTCCTGAAAAGG
AGTATTCTTAGATATTTAGAATCAATACGAACTCGCGTTGCCCGATAGACCGGAACAAAA
CGTCAAAGTCTGCCGTAATGTTGTTTTATTTCCACTATGCATTTGCCTACGAGCACCACG
GCGCGGAGTGTTAGCATGTGGCTAGCTCGCAAGTACATGTGGATGCGGCATGTTAATCAG
CGACCTCGATAGATCTCAAACCAGTTTCATTCCACCAAATCTAACACCTTTGGTACAAAT
TGTTTTGGTATCAATGTAGAAAACACCTCATTAATTATGAATGTCCATAGTAACGGTAAC
GCGGTAGCTTGTCAGATGAAGGCTAACGTTACGTTGTAGGAGCAGGCTTCAGCTCGGGCC
CTGCTAAGAGTCTTTCACCCGTGTTCTAGCATCCATTCACTCTTAATGGAGCTTCATGAT
CAATGAATATTGAGCTACTTTATTGTGTAATTAACCAATATGTAAGGTCATTTTGGTTTG
AAAACTGGCAGAGCCGTGCAATGTAACGCAAATTAGCTATTAATCGGTACGTTACGTTAG
GTATTGCGCATAATGCCATTGTCATATTTCCCTACGTTAAATTAGTTGAATCGTTTCACA
ACTGATCAAACTGGTGACAAAGTGATTTGCACACAGGACTGTGTTGATGTGCTGTGTGTC
CGTGGCTTGAATTGACCGCTTCTCGTGTCTCCTCAGTGACTGAGTGGGAGACCGCACCGG
CCGTGGCCGAGTCACCGGAGATCAAACTCTTCGGCAAGTGGAGCACCGACGATGTTCAGA
TTAACGACATCTCTCTGCAGGTATGAGGCAAGAGGCACTTACTAGAATCCTTTTAATAAC
TCTTAGTGCACTAAGCGAGGCTAGAGTCACGCCTGGATACGTCCCATTGTCCTGGTGTGC
TAGAGTGCTCGCAGAGTAAATGTCTTTGCTTATTCATTGGCTGTAGTCTTGTTGTGACCC
AGTCAACCACCGACTCAGACACATTAACCCGTCATACATGCAGGACATCCAACAGTGCCG
CGGTTAAATCTTCATAACCATGTTTACATCGCCCCATGTACACAACAGGATTACATCGCA
GTGAAAGAGAAGTACGCCAAGTACCTGCCACACTCTGGAGGGCGTTATGCGGCCAAACGT
TTCCGTAAGGCCCAGTGCCCCATTGTGGAGCGTCTCACCAACTCCATGATGATGCACGGC
CGCAACAACGGCAAGAAGCTGATGACCGTGCGCATCGTCAAGCACGCCTTCGAGATCATC
CACCTGCTGACCGGAGAGGTATCCACTGCTAACATTCCCCAAACGCTTCCACCTGTTAAG
TGTGTGCAGCACAATTCCACTATAAATCAGTGTATGCACTGAAGGAAAGGGGTGCCTGAT
TAACAGTCTCTCACTGACCATGTAAGTTTTTTTACAGAAGAGCTTCTTAGTTCGTATTTG
ATTAATTCGGTTGTCCAGTACATTCAATTTCTGTCCAATTAAGTCCAGACAGATATGACT
TTTTTTTCTCCAATAAGTGCTTAATAACTTGGTGCATGTGGGGAGACAACCGATTATTAA
TGAAAAGAATGCAAATTTGTTTTAGTTGTCAGACTGAACTTACTTAATGGAATCTATAAT
GGTTGTATCACAAAGTTAAAACAAGTTTGTCCCTGTTACTACCTAAATATTCTCTTAAAA
TTTCTAGTTTTTTTTTTATTTGTTGCTTTATTTGCTGAAATGACTGTTTTGTGCGTCAAG
CGAGGCTAGAGTCACGCTTGGACACGTCCCATTGTCTCGGTGTGCTAGAGTGCTCGTAGA
GAAAATATCTTTGCTTATTCATTGGCTGTAGTCTTGTTGTGACCCAGTCAATCACCAACT
CAGATACATCACACTACCAGCAGCCAGCTTTTTCTTCACCAAAGTTCTGGTGCCCATTTA
GTAAATTGTTGTTCAGAGGGACCCCAGAAATAAAGTAGAGCCCTGAGCACATTTACCCGT
AGTCAGTCAGGTTTCAGTTGCCGTTCTCTATCAGTCTTTATGTTGCCACGTGTTCATACG
GTTTTACATTTTGTTCCCAGAATCCCCTCCAGGTCCTGGTGAATGCCATCATCAACAGTG
GTCCCCGTGAGGACTCCACCCGTATTGGTCGTGCTGGTACCGTCAGGAGGCAGGCTGTGG
ATGTGTCACCCCTCCGCAGAGTCAACCAGGTAAACATTCATTTCATGTTAAAGGGTTTTG
GTCTGTATAGCCCGGAGTGTTTCATGCTTTCACGTGTCTTTTTTTTATTTTTCTCAACTT
GTGTAAGTGAAAGCTGCGATAGTTGTTTGCATTAAGCGAGGCTAGAGTCACGCTTGGACA
CATCCCATTGTCCTGGTGTGCTAGAGTGCTCGTAGAGTAAATGTCTTTGCTTATTCATTG
GCTGTAGTCTTGTTGTGACCCAGTCAACCACCAACTCAGACACATTACACTACTTGCAGC
CAGTGTTTGCTTCAGCCACTAATGTGTTGCTCCCTCGTCTTGTAGGCCATCTGGCTGCTG
TGCACAGGAGCAAGAGAAGCTGCATTCAGGAACATCAAGACCATCGCCGAATGCCTGGCT
GATGAGCTGATCAATGCTGCAAAGGTAACATCTTACCCACAGCCTTCGTTTACATTTGAG
TGTTGGGGCATATTAATGTATCGTGACATTCTTGTAATTTCAGGGTTCATCTAACTCTTA
TGCCATCAAGAAGAAGGACGAGTTGGAGAGAGTTGCCAAGTCCAACCGTTAAAATGTTTG
CTTTCTAACAAATAAATTTGAAGAAATATCTGTCCTTGTGCTTTTTAAAAACATGCCAGG
TAAATACACTTCTGAAGCCAGTATGTGAACACCTGAGCCTACATTAGAGGGAAAGAATTA
GTCATCTTTGAATTGTTTGCCTAGCTATTTAGTCTGAAACTTCAGGCAAAAGCATTGCAG
CTTTCTAGCAGTCGGATCATAGTGTCATGCGTGCATTACCCAATGAATAAACAAGAGTTG
TATGCTGTGTCAGTTTATGATCCCCTTCACCCCACCATGAACAACCTAGCAATGGAAGGT
CAAAAGTAAGTGAGCTTTCTGTTGACGAGGAGGCACAGCGAGGACAGGGACCCTCCCAGT
TTAGAGGCCTCGCTGCAGGCGGTAGGCAGGAGGGTGTAGTCCTGCAGCTTCTGGAAAGCC
TGCAAAGCGAAAGGAAATTATTGTCTGCTGGAAAAATGGGGCCATAGCAGCTGTATTAGA
TCGAGCTTAGCAAAATTAATGAATCACATCTGCCTTTTAGTTAAAGGTTCAGTACTATAT
GGATTTCATTTCAGAAGTAAAACCTGCACCAATTATTTTAATGTATGTTACATAATTGTG
AATTTGACCAAAGCAGATGTTAACGCAGTATTCAAAGAAAAAACTAAGCACATACTGCCA
CCTTCTCACATTTATAATCGTGGTTTGCACCACTGAAAACAGTAATGAAATCATTTGTGA
CAGCTGTCTGAAGGACAGTTTTTTCAGGGGTCCAATCGTGTCAATTTTCCATTGACCTAT
GGACTAACTAGTAATATTGTGGAACTAGCATCCAATGTTTCGAAATAAAATGATCAAAAG
ACTGAGTTACACCCTCAATACATTAGTTATTTGTCACTCCTCTGCTGTACTCACAGAGAC
GCTCTCTGGACATTCCTCTGCAGGCCGGTGCAGCAGGAAGTCCAGTTTAGACGGACCTTT
GATGTAGATGCAGTTTGCTGCCAAATCCTCTGGAACAGTGAGCACTTCATAGTGGTGATC
GGTCAGCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1032, 1776..1879, 2148..2357, 3140..3268, 3585..3683, 3763..3869
1032..1032, 1776..1879, 2148..2357, 3140..3268, 3585..3683, 3763..3828
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved