Gasterosteus_aculeatus Locus RPL27A
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL27A
Gasterosteus_aculeatus
RPL27A
groupXIX
SNORA3
1468..1599
3809
ACTTCTGTTACAATACAAAATCCTGCCTCACACTTACACTTAAATATCTTCTCTTTCTC
TTAATTAGGAAGAATACAAAAAGATGTACTGTACTTCCATGTACTTTATAGGCAACTCAC
ACCTATATTACATGTATTTATTATAAATATTTTATTTTTTATATTTTTCAAATAATCTAT
AATAACACTGCGTATAGGAGTTTTTTTGTCTTCCATCGCTAGGCGTCGCTGTGGGTTAAT
TTGCACTTGTCCTCTCGCCAGGAGCCAAATCTCGCACAAAACCGCGTGGTTTACGAATCC
CGTCCCTCTTTCAACTAGCCTCCAAGATGGTAGGTGCCGTCATGTATCCGCCTGCTCTGA
AATGCATCTAAATCTATGCCCATCCTTGTTGATTCTTACAGCAAACTATCATCCGGTGGC
AATTTATCATTTAGCCGGCACCTGCGGTTAATTACTGGGTTGTTTTGCCCGTGATATTAA
CATTATAGGATATTGTGAGCAAATAACCATTGATCTGGGCGCTCGTCGGCCTGCATCACC
CAGCCAGCATACTCTCTCTATAATTACACGTCGTACCCGCGTACTTAAAACTGCTGTACT
CTGAAAAAATGTTACAGCTTTAGTCAGGGTTTAACATGCAGAAAGTGCCCGAGAAAACAT
TGTAAACAGTACGTTGTGGTAGTTAACAGTCGGCCGGTTAACGCCGTTAGCATTATCGTT
CTGTGACTATAGGCAGCATACTTCGCTTACGAAGGGACCATGGTTTTGATAATTTCCGTA
TTAGGTAATCAACGTAACAGTATGCCGATGCCTGCTTCAGTGTGTTATTGGCTGTTACCG
GTTTAAAGTTGACGACAAAGGCTGAAGTAAAATGAAAGTAACGTAAGACGTGATTAGCCT
CCGTTTAACGTGCTAGCTAACTTGGCCCCACGAGCAACGATCGAAGCACGATTGTTGACG
CTCTGTACTTCTTCTAATCGATACCAAATATTTCCCTTACAGCCCACCAAGAAGACCAAG
ACTAGGAAGCTCCGAGGGCACGTCAGCCACGGACATGGTCGCATTGGTAAGTGATTACAT
GGCCTGTATTTTAAAGGTGATCTCCATAGCTTCCGTTTGTCTCACTGTGGGCGCGACACA
TGGTTAAACTCCAATTTATCCAACTTCCACAGGCAAGCACAGAAAGCATCCTGGAGGTCG
TGGTAATGCTGGTGGTATGCATCACCACAGAATCAACTTCGACAAATAGTAAGTGCTGCA
TGAACTGATGTTCTGCTTATTGTGATGGAGACACTATCTGTGTGCATAATGAGCCCGTAA
ATTGTTGGACTGTATACACTTTAACCAGAAAACTATCAGTAAGATAGAGAAAATGGTTCG
CCTGACAGGTTTCTGATGCGTTACACAGTGATGTTAATTTTCTGTTTTCCTTTTGCCTCA
TGTTGCGTATCTGTTCAGTAGTTTTGCTATAGAGACTAGAGTCTCACCTTGACATAACTC
ATTGGCTTGGTGTGCTAGAGTACTCTTAGATTGAAGACTGCTCCTATTCACCGACTGGCC
CTTTTTCGTAGGGCAGTCACCCACATGGTCAGTTACAAACTGCTTGATATCACTGACTGC
ATGTTGCCACCACTGCTAAGTCAAGTCTTAACCTTTCCCAACACTGCTTTAAGCTCATTT
TTGTCTTTCCTCCTTGTGACTTTTCAGCCATCCTGGGTACTTCGGCAAGGTGGGTATGAG
ACATTACCATCTGAAGAGGAGTGCCACCCACTGCCCCACCATCAACCTGGACAAGCTGTG
GACACTGGTGTCCGAGCAGACCAGGATCAACCACAGCAAGAAGCCCGACGGACCTGCACC
CATCATCGATGCTGTGCACGCCGTAAGTACTGGCCGTTGTCACCGACTAGTAGTTTTGTC
TCCAGCCCCATCTCTAAACGGAGGGAGTTGAGGCCCGTTTCAGAGTCCTCAACGTCAGAT
CCATAAGCTGATGTGCGAACCGTATCCAATGTATTAGCTTAAATGTTGATTATTATTTAT
TATTTTTTTTAAGACAAAGTATCTGCATACAAAATTGTATCTTGTGATATAAACGGCTGT
AGGAAAAAACTGGTATTTGAGACATGCTTGAAAGATAATTGTTTTAAACTAAGCTTTGGA
GTTGAACACGCTTAAATAAAAACAAATTCACTGGTCCTTTTTTTTTTTTGGATCAACATA
TCTATAACCTCCCTCTGTATGGCCTAAACTGTTGTCATCTGATATAAGCCAGAACTCTTA
TTTGATCCACAAAGGAATGATTGTCAAAGTAAATTTAACCATGCATAAACCTTGAGCTTG
GATAGTGACAAATCTAGTTTCGTATATTATCGTTGGTATGTTTCTTTCCGCACGTAATGT
GTTGCTAGAGTCCAAACTTGGCAGTAAAAATGCCAACAGTAGATTTAATATCTCACTGAT
TCAGAAATTCCTAACTACTTTGTATATAGTGTCTTGCATACATGTTCATTAAGTGGGATT
GATTTGCTGCTGTGGATAATGTGGGATAATAGTGATGGATCCATAAAATGCTGGGCTTGT
TGGGTAAACGTTCTATGGTTATCGGGCTAATTGTTTATTTTGTTATTTGCAGGGCTACTA
CAAAGTCCTGGGCAAAGGCAAGCTGCCCAAACAGCCTGTGATCGTCAAGGCAAAGTTCTT
CAGCAGACGGGCTGAGGAGAAGATCAAGGCAGTGGGAGGAGCCTGTGTGCTGATGGCATA
ATGTTCCTGTCAGTGTGTTTTTGCAAAAATAAACTGTATAAATGGAACTACATAATTGTC
ATGTCTAACTTAAATACTTAAAAATATGGTGGTTGGGATTTGTGCTGCGTTTGAAGCTTG
AGCTTAAAACAAAGTCAGTTATGTGTTGCATGTTAAACTACGTGCAAGTTGACCATATTT
TCAAATTGTCGTGTGCCCCAAATGTATTACTTATTCTGCAGTGCTAGACTCAACCCGCTG
TGGTTGACCGTAAAAGCCTTTTAACGATAAATGTAGCAGAGAGCAAAATCTTCTACTGCT
TGTATGTTAGTCTTACTAACTGGAATTATTGAAGTATTTGCAGTTACAACTTTCAGAAAT
TTCTGATGTACAGGATAATTATCGAACTTTTGTACAAAAAAAGAGAATACTTTTACTGTA
CAGAGTAGTCATAAAGGTCTTGAACACACATACTTCATTGTCCAGAATCTTTCCAGATTA
CTTGTTTAATACCGTAAATCTCTGCATATACGTGCACTAAAATTCAAGTGTCTGCGGAGT
TGACCGCAGTCTTTAGTCTCCCGTCTCCCGGGACAATGGGTGTCTTGAGTACAGAAAGAA
ATATCAAAAAGCTGTACTATACATTAATTCATACAACATAATTATTCAAGTGCGGCATTG
ATACTACGTGAAGATTAGGTCATTTTAATTTAAAAGAAATGTTTTTACATAATTACATTG
TACATGTATAAGAATTTCTGATTTTTTTCAAATGTATCTAATTGTTAACATTTTAAATAT
GTGCATTTTAAAGTGAGACTGATCACACAATGTGGAGTCCCTTTTGTTTATCCGACTGAA
TGCGACGGACGAGTCGCAGCTGCTGTGACGCAGTCGGTCGATGAATGATGACGCCGGCTC
TGGAGGACACGGATACCATATCTATGACGGATACAATCTGCACAGAGCTGATGACAGGTT
AGCATTCCGGTCGAGTTGCGGGGCGGGGTTTACAGTCCTGTCACTTGAAGGCACCACGCG
CTTCATGAGTATTGTGACAAGCAGCGAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1065, 1172..1247, 1707..1881, 2632..2809
1002..1065, 1172..1247, 1707..1881, 2632..2757
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved