Gasterosteus_aculeatus Locus RPL4
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL4
Gasterosteus_aculeatus
RPL4
groupXIX
SNORD16, SNORD16
1475..1572, 1879..1978
5050
AAGTCGTCCTTAAGTCATCCTGCGCCGTAAAAATGGCGTAAAGAAATAGTCCCGTTTGA
AGTAACGTTAACTAACTTTAATACGGTTTTTTTAGGGAATTTGTTTGAAGATTCAATTGC
AATTACTTGATAAAACTGTAGAAATGTTTAATAGACATTTATACAAGGTAAGCAAAACAT
TCGTGAAAAATATATTTCGGCGGAAGTGATATCCGTCTATGCGGAGGCATAAACCCTAGA
GTGTGTTACACCGACTTCCTTTTTCACTGTGGCCGCCATACCGTGAGCAGTGTGGTTCCC
GGCGAGCCGAAAACTAATTTTCGAAAATGGTGAGAAGATACGCTCATATCGTTATGAATA
TGCTATATAATACTGATTTATATCTCGAGTTTCAATTGTCATATAAACGTTACATAGTTA
CCTGGATGAAGCTTGTATTCAGATCTATTGGAACAGGCAGTTGGAATGCGCCCGGCTGAC
GAGGCTAACACGAGGAGCCATTTTGGACGTATAGCGTCAGCTCAGTAATTCAGACCAGTT
CCACGTGTAGAGCAGTCGTAGCTAGCGCATGTGGTACAGGCCATGGGGCATCGAATGTTG
CATTTTTTCCCTCGTAAATACACGTTATGGTATTCTGGTGTGTTAGTGCTCGTATTTGCT
CCTTTGCCAGCGTGTTTGGCCAACGCAACGTTTTAGGCCTAAAGTTAGTTAGCTTCCGTC
ACGTTAACCTAGCCGAGCTAAGCTAACGGCTAACAGCTATAGTTTTTGACCCAATAGTAG
AAATGCCAATACAACGTCCCTGTTATCGTATATCAGGGATATACGCGGTTTATATCTGTC
ATACCGTTGGTTACCAGCATAGAGGCTCAAAGGAGATATGATGTTTTGAGCGGACAACGT
TAAGGGACGTTTACCGGGACAAAGCGAGTATGTCTTCGAGAATATTAGTCTCAAATCCAA
CATAGGCTTTATTAACCAGAAATCGATTGTTTGTTTTTATAGGCCTGTTCCCGACCCCTC
ATCTCGGTTTATTCCGAGAAAGGAGAATCTGCTGGCAAGAATGTCGTCCTGCCAGCCGTG
TTCAAGGCTCCGATTCGCCCTGATGTCGTGAACTTTGTCCACACCAACATGCGCAAGAAC
AGCCGGCAGCCGTATGCCGTCAGCGAACTGGCAGGTATACCTCCTGCAACAAGAATGAGC
CTCATAGTTGAATCAAAGTATTTTACAAGAGTGCATACGTTCATGCATTCGGATGTGTTG
GGTAATTTGTGTGATTTTTGTTTTACAGGGCACCAGACCAGTGCAGAGTCCTGGGGTACA
GGAAGAGCTGTAGCTCGTATCCCCCGTGTGAGAGGTGGTGGAACCCACCGCTCTGGCCAG
GGTGCTTTTGGAAATGTATCCTTGGGACCAAAATCCAAGCTTGAGGGTTTCTCTTGTAAA
GAAAATACTTGAATCCTCAAATCGGCCACAAGACTTGCAATGATGGTGTAATTTGCGACT
TACTCTGTGATCAGTGACAGATGCCTACTGTCATATGCTGGCACAGATGGCTGACGAACA
ATGAGTCTGAGCAAGTATTACTTGGTTAATTACTTGTTGTAATACAGTAGTTTTTATCAA
ACATCCTTGACTTTGGTGTAGATGTGTCGTGGAGGTCGCATGTTTGCCCCCACTAAAACC
TGGCGTCGCTGGCACCACAGAATCAACACAACCCAGAAGCGCTATGCCATCTGCTCTGCA
GTGGCGGCAACTGCCATTCCCGCACTTGTCATGTCCAAAGGTATGTGCTAAGAACCATTC
AGTTTATATACAGAAGTACAGAGTTTTTAAATGCATTTCTATAAAGAAATATTAATATTT
CTTTAGTTAACGCTTGTCTTGCCATGATGGTGTAATTTGCGTCTGAGTCGGTGATCAGTG
ACAGTGGCCTGCTGTCTTAAAGCTGTCACATGGTATTGATGTGTCTTCGAGTCTGAGCAA
GCTGTCGCAAGAAGGTAGTACGTCACGAAGTGTGAAACGTGTGTTTGAACCAATTCTCTT
GTCTGCTAGGACACCGCATTGAGGAAATCCCAGAGGTCCCATTGGTGGTTGAAGACAAGG
TTGAGGGCTACAAGAAAACCAAGGAGGCGGTTCTCCTGCTGAAGAAGCTGAAAGCCTGGA
ATGACATAAAGAAAGTAATCAAACCTTTCTTCTCTCTGCTTGACGCAGCACTCTAATGAC
AGGATTTAAAAAATAAATTTAAAAAAACTCCCTCTGGCACATTTGAACAAAATGGAGAAT
AAGATGGCTGCCCAATATGCTGAGCTAAGGATGACTGGGAAGATGCTAAGAATCTTTAAT
CTAATTTATGTGTATGTAACCGAAAGATCTTGGACTGAACTAGTTTTTTGTTTGTTTAGT
GGTATTAATGAACATTTCTGGCTCCGATAACTACTCAAGGATTCAAGAGCATGAAAAAAA
AAACCTTTAGTTGTGGTTTGTCATATAAGTAACAATGAGAAACTCTCCTCAGGTCTACGC
CTCTCAGCGCATGCGTGCTGGTAAGGGTAAGATGAGGAATCGCAGACGGATCCAACGCAG
AGGACCTTGTGTCATCTACAACCAAGACTCGGGTCTCACCAAAGCCTTCAGAAATATCCC
AGGTGTGTCATTAGTTCCCATTTTTAAAGAACTTACCATTATGGTTATGTAAAGGGTTAA
GCGTTTACCATTCGCACTATTAAGTACTTAACTACAATATGCTGTGGTTCCTGTAAACCT
GAATGCTATGGGGTAAAAAAGGAAGGGATGATTAAATGTTATAAATTGTCCTGCTGTAAA
GGCATCACATTGCAGAACGTCAACAAACTGAACCTCCTGAGGCTCGCTCCTGGTGGTCAC
GTTGGACGCTTCTGCATCTGGACTGAAAGTGCTTTCCGCAAGCTGGACGAGCTGTACGGC
ACCTGGCGTAAACCTTCTTCCCTGAAGGCCGGCTACAAGTGAGTATTTAACACAATCACT
CAAGTAGAAGTCAGTGAGCTTCAACTTCGTGCTCAGTGTTTTTGAATATCTGACATCTAA
AGAAGTTCAGAGTTAAAACGTCAAGACATTTCGCGTGATTATTTTCCTAATGTTGGATTT
GGAATGCCTCATTTATTTCAGCCTGCCAATGCACAAGATGACCAACACAGACCTGAGCAG
GATTCTCAAGAGTGAGGAGATCCAGAAGGCTCTTCGTACACCAATGTAAGCACTGTCACT
TTATTGAACGTTTCTTTTTACTTGTCAACTATGATGATGATACAACTTCGGTCCGTGTTT
CTGAATCCTGATTGTATAGAAGTTCTGAGAAACTCATAAAGTAATACATTTGTAGGTGCG
CAGAAGTTCAATTTTAAGACTTGTTTATTTTGTCATTCCAGCAAGAAGATCAACCGCAGA
GTGCTGAAGAAGAATCCTCTGAAGAACTTGAGGATAATGCTCAAACTGAACCCGTACGCC
AAGACTGCAAGACGTCGTGCCATCTTGATGCACGACCCCAAGGTAAGAACCCAAACATGT
AGACCTGAATCGTATGAATGTTACCAGCTGGCTTAAGCCTACAATAGAACTGCCAACAAG
GCAAAAATAATACTGATCCAAAGAATAAATCTGAGTAACAGCAGAGTGTTGGAAAGAAGG
CGACCCCTAGTGGCAAGTAGAGGTCATCCCAACAGTGACTTTGAAATCTTGGTTGTCTCC
ATAGATCAAGGCCAAGATGCTGAAATCCAAGAAGAAGCCTGCCAAGAAAGGAGCACCAAA
AAAAGTCAAGGCATAAATTGCTATACTTGCAGACGAGTTCAGTGATTTAATAAATCATCT
GTTGCAAATGTACGAGTCAGACCGTCATTCTAAATGAAGATTGAAATCTGTTACCGCTAA
AGAATGACAGACCTCAAAGAATATCGCGCACACGGGATTAGCAGTATTTTTCATGATTCA
ATTATAATCTTTTGAAAGACTAAATACAAAGATTTAACTGCATGTAGGTTTGTACGCTAG
AAATAGAACTATTGTGCTCAAAGCGTGCAAACCATTTTTCTGATGTTGGATGTGTTGAAC
TAAACGGGCCTCACAGCGCTGTGCAGTGGGTGAGTCACGGGCTGAACAATGGTACACTTA
CTCAGCTTGATTACAGCATTGAGTCAAAGATAATAACCAAGCTCTGAGCGGCTGCTGACG
GTAAGACAGTCTGGTGGAGCTCGTACGCAGAGGACGCCTGTAACAAAGTCTCGTCCAATA
AATCAGGTGGGTCAATTTCAATGTTCCAATGTAAAAGTGACTGGTGGCTATATGGATATC
TGATATATTGTAGGTAATGCGTACTTAACTGATATCGATTGGTAGATAAACCTTTTCTGA
ATACTAGTATTCCTGGATATGACTAACTGCCATCCTGACCTTGAAGGCATCGCAGTAGAA
CAAGAACCTCCTGAGGCGCCTTCGCAGAGTTGCTGTACGACACTTGGCGTAAACAGTCAC
CTGAAGGCTGACTACAAGGGAGTACTTAAGCCATCTCACATCAGTGAGCTTCTACTTTAG
TCTGTGTTTCTGAATATCTGATCAAGTTCTGAGTTAAAGCATCAAGACTTGTCATTTGAC
TATCTTCATAATGTTAAACGTCAGTTAAATTTGTAATGCCTTTTATTTCAGCGTGCCAAT
GCACGAGATGACCGACCTGAGGTGAGGAGATCAGAAGGCTCTTCATACACCAATGTAAGC
ACTAACTTTATTGTACATTTATTTTTACTTGTCAACCATGATGATGATACAACTTCGGTC
CGTGTTGCTGAATCCTGATTGTATAGAAGTTCTGAGCGACACAAAGTTAATAACTAATTC
GTAGTTGCGCAAGTTAAATTTTAAGAAGTTTATTTTGTCATTCCAGCAAGAAGAGCAACG
AGTGCTGATAATGTTCAAACTGAACATAAGGTAAGAACCAAAACGTGTAGCCCTACATTG
TAAACTGTTAGTTGCTGGCTGAAGGCTGCAAAATAACCAGAGAAAATAAATTGTCAATCA
CATCAGTGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1173, 1288..1394, 1641..1779, 2049..2173, 2512..2641, 2821..2977, 3141..3224, 3401..3521, 3724..3769, 3812..3848, 4020..4050
1002..1173, 1288..1394, 1641..1779, 2049..2173, 2512..2641, 2821..2977, 3141..3224, 3401..3521, 3724..3769, 3812..3848, 4020..4050
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved