Gasterosteus_aculeatus Locus ATAD2
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus ATAD2
Gasterosteus_aculeatus
ATAD2
groupXX
SNORA5
7724..7858
13846
ACGGGTCTGTTTTATGTTATTTGGTGAGGGCCTTTTGTGGGATCTGTTGATTCGTTTGA
TAAACTTTATAAAATAAGTGAAAAGATGCGCTGTCGCTATAGTTACATGCAAACATTAAT
GCCTTAATAATCAGGTGTCTTGAATAAGTCACATGTACATACTTAACAGTTACATGTCTA
TGATTTATGAACATTTACAAATTGTAAAATATAATCCAAAAGACAGTGATTAATGGGAAT
TTCAAACAAGCAGACATGCATCAGTTGTCCACAGTGTAAATGTGTTTTCTTTTGCAGGGA
CATGCTGATATGAAGCCGGATGAGGGAACCGAAGCTCATCACTCCCGAAGGACCCGAGGA
CAGCGAGTTAAAGAAGGAGTGTCTTTTGCTGATCTGGAGCTAAAGACCAGCTCCGTAGAG
GGATGCCTGAGGTAATCCAGGCTCTCGCCTTGATATTTTGAAATGTTTGATACTCTAAAC
CAGCCGCTCTTGTATCTTGTGTGTCGGTGTGAGTTGTTTCTGCAATCAGACGTGTTTTCT
CAGCAAACTTTGTATATAAAATCTGCTCAAGTTATGTTTGGTATTGTTGTTTTTTCTTGA
TTATGCAAAATGAGTTCAAACATTCTTTGAGCCAGAAGATTATTAATTGTCCCAAATATT
TCCTAAACTATTTTATAAAGATTAATTACCGATACCGCTCCAAATATATGCTTACAATAT
AGAATCTGATGAGGAATTCATTTTGAAATCTTTTATCTTCAGAAAGTCTTCCAGGCTGCA
AAGGGAGGGAAAGGTTTCCATGGCCAAGCAGCAAGCAGGTACCGTTTGCTGCACTGCATG
TCTTAACGTATTTACCAAACCACATACATTCAGTGTTCTGGAGGATCCATACTATTACTA
AACTGGCAATAACGGTTTCTGTTGCCCCAGATGTTTCAGATAAGGTGGAGGGCTCATCCA
CTCCCAAGAGGAGTTGCTTTGACCTACAGAGCCGAGAAGAGGACGAGGAAGAGGATCGTT
CAGTGCGACGTAGTTCCCGAATCACCCGATACAAACTGGATTCCCGCAACCAGTCCGTGC
TCTACGACCGCCTCATCACCAAGTGAGTTCAGCAACAATCCCTCAAGCTTTGTTTGGCTC
CGACCTTCCAGCTTCAGTTAAACATAAAGTGGTTCTTGTCTAACAAACAACTTGACATAC
ACAGCAGACAGTGGGTGTTGATTTGAGTGATTACATTAGAGATTAAGTGTTCGTTGTTTT
TTCTGATTGTCTCAGCACTGCTGAAGCTGTCCTCCAGAAGATGGACGACATGCAGAAGAT
GAGACGCAGACAGAGGAGCAGAGAGAGGGACAATGTAGAAGAGGTGAAACATAAATCATT
TTAAAACAGCAAACCTCATTTCAAGCTCTGTTTTATTGTGGAATCTTAGTTTTTATGTTG
ACAGTGGGTGGTATTGATAATTAATTATGCCTAATAAGCTTCTAAACGGAATCATTCAAC
ATTTGACCTGTTTCCTCTGAGCAGATCGGTATGTACACCAGGGGAAGAGTGACTAGGTCT
CTGAGGACAGATGTGGAGATTAAGGACACAGAGGAAGAGAATGAAGGTAAAACAAATTGG
GTTTAATAAGAGTAACTGTGGATGTTCTACACCTGACAGTTGCTACAGCCAATGCAAGGG
CATACGTCTCACATGAGTGACATATTGTTTAAATTGTTTGAAATTATAATGCTAACTATT
TTATTTAATTCACAGGAGGCGATGCGGAAGATCACAGCAAAGAGGGGGGTGAAGATGTAG
AAAAAGATGAGGAGGAAGTTGATGATGATGAGGAGGAAGAGGAGGAGGAGGATGACGACG
AGGAAGAAGAAAATCAGAGGCGTTATGACTTCCGGCAGCGAAAGACTGTGGTCCGCTATC
AGGCCCCACAGGACGGTACTGCATTGGTTCAACTCAATGTTTTTGGAAATTTTGATTTAA
TTTACCTAATTGAAAACCTGAGCGCGACCTTATGCGAGGATCCATGCAGGTTTGGCTGCT
CTATAAGATACACCAACGCAGAAATTGGATCAATCTTGAGTATTCTTAAAGCAGATTTGG
CCCCAGAGTAAATAGATGAATTACATTCAGTACTTTGTCATTTGTGAAAGCTGAACCTTT
GTTTGATTAATCCCATCCTATTAAATACTTTTTGTCATTGTTTCTTAGAGCCCAGAGAGC
CCAGGAAGCGCAGCATGTACTTCAAGGACCATTCTTCTCCTTCTAGACGCAGGTTTAGAT
TCAGCTCCACGGCCCCCCGGAGCCCCTACACCAGGAGGAGAACCAGCAGGTGAGTGTGAG
CTCACACTCCCTCCGTCATAAGCCTCACATACAAAACATCTGCCAACAATCTATTTTTTT
CAGTTTACACCTTTGGTTGTGATGTATACATTATAAATTTGATGAAAAACAGAACATTCA
AATTATCCCTGCATATAAAATCAATCCCTAAATTTGTCTTTTTTTTCCTCTCTCTGATTT
CTCTTCATGCCGTCCTCAGGAGTAGTTCTGAGAGGTAGGACCCTCACTTCTTGTTCATGT
TGGTGTGTGTAGTTAGTTTGTATTCTGTTTTTGTGGTTTGCTATTGTTAATTTGTAAACA
AAGACCCATTGTTTGATTGCTGACTTTATATTAGCCAGTATGTTCTGTAATTTAGTCGTT
TGAATAGTGTCTTCGTTTTCTACTGTTGAGTATTGTGCAGGTGGAGTTCTATTAGTCACG
GATGGTGCTGATGTCACTTATAGTTTTTGAATGAACGCAGCATAATCAAATATTCCCTTT
ATTTCCTAAATCAATGCATTATTACTGTGTATGTGTAAAGACTGCCACACTTACTGATGA
ATGGTGGTAGTGTTGTTAATGATCAACCGTTGCCTAAATTAGGTTGGGATTCCTTGTTGA
TAAGCTGATAATCATAATGACATTGATAGTGGGAGAGATAATGCTGCTTCTATTGCCTTC
GCAGAAGAAGACACGCCATCCACAGTAGTGACTCCACTTCTTCATCTTCCGACGATGAGA
AATTCCAGAGACGGAAAAGTAAGAACAGGAGCTTGTCAGTCAACAGGTGAGCGCAGCATC
AGCAGCTGTTGTACAGTAAGATCGTGTGGAGGACAGAAGGTTTGAAGCGGTGGTCACCAA
CCTTTTTAAAGCCCAGGCTTGACTTACAACATGGAGCTTTTTATCCCCCCTACTTGTAAT
AAAATGAGATCAAACAAATTAATGTGACCAAGAACACACTAAATGACCTAATATCAGTGC
ACCATGTTAACCACCCACAACATGAACAAGAAAAAACACATTTGCAATGAGCAGGCTGGA
GGAACTGCCAATATTAACGGTTGTATTTATCAACTAAAGTTACAACACAATACTTACATT
AGCTGCACTGACTGAGTGCAATTCAGCTGTGTCCCATCACAATGCCATCAGAAGTCATGT
GACTCCAGTCAGTGTGTATTGCAGCATTGTTTATGTTTTCCTTTTGTCCCTGCAGATGTC
TGCCTATGAACCTTGTGAAAGAAGATCTGCTGGGCATCCACAAGGACAGGATGAAGATTG
GAGCCAGCCTTGCTGATGTGGACCCGATGCACATCGACAAGACGGTACGTCTATAGGTGG
AGCGACGCATACACAGGGTTGACCGTGACTCTGTGTTGAATTGTTGGTAAACTTTGCATT
GATATACACTTTCATGGCACTTCAAGGTGAGGCATTAAAAACAACAGGCAGGAGATACTA
TATTTCAAATGTTTTAAATGTATTATTTCATTTGAATGGACATAGTCTATGTCAATTGTA
AGACGCCACTTTCTGAATGGTTATTAAGAAATCGAAGCCTGTACTCCTGCTAATACAATG
CTAATAATTGTAGAGTCAGTAGTATTCTGAGCAAACAATCTGAACATAACGCCTTTTGTC
ATCCAGGTGCGGTTTGAGAGCATTGGAGGTCTGAGTAGACACATCTCTGCGCTGAAGGAG
ATGGTGGTGTTTCCTCTCCTCTATCCAGAAGTCTTTGAGAGGTTCAAGATACAGCCTCCC
AGGTAAGTGTGTGCGTTTGTTGAGAAGATCACATGTGATAGTGGTCCAGCTTTACATTCA
TGTGACTTAATATCACATCTATTTATAGAAACGTAGTAGATCTATGAAGTTAAAGCCGTT
ACATACCTGACATACCAAGTTATATTTTTCTGGCAGACCTATAAAAAGAGTTTACAGTAC
ATTTGATTGTACTGGTTGCAAGAATTTCCATTATTGTTCTTTGACATACTTCCTCCTGTC
TTTAGGGGCTGTCTATTTTACGGTCCTCCAGGCACAGGGAAAACCCTCGTAGCCAGAGCG
CTGGCCAACGAGTGCAGTCAGGGAGAAAGAAAAGTGTCTTTCTTTATGAGGAAAGGAGCC
GACTGCCTCAGTAAATGGGTTGGAGAATCTGAGAGACAGCTGCGGTTGCTTTTTGACCAG
GTAAACAACCATCAACATACACACTCTGGGATGGATGGAGATCATCCGTTTTTGCCTGTT
TTCCCGTTAACTCACTAGATTTTGTCACATTAATTGGTGGATTAGGAAGTAAATCAGTTA
TGCAATCTGCAACTGATAGAACTCTTTGAATTGTTTCTAGGCGTACCAGATGCGACCGTC
CATCATCTTCTTTGATGAGATTGATGGTTTGGCTCCAGTCAGGTCGAGTCGCCAGGACCA
GATCCACAGGTGAGCAGCATCCCTCTTCCCTATGCTGTACAGCTCAGGTGTGGGGATTGT
ACTCTCACTAGATTAGTGAGTGTAGGATGTACACAAATCTTTCATCTTGTCATGTGGTGG
GTTTCTTTTTCCATTTAGTCACTTTAGTCACAAACAAAATGCATTTTACTCCGCACTGCT
TTATTTGTCACCACTAAATGGTTTTGACAAGTTGGAAAGCATATTCTCAAGTCTTTTCCT
GTCTTCGTAGTTCCATTGTGTCAACCCTGTTGGCCCTCATGGATGGATTAGATGGCAGAG
GGGAGGTTGTTGTGATCGGAGCTACAAACAGACTGGACTCCATCGACCCAGCACTGAGAA
GACCAGGGCGCTTCGACAGGGAGTTCCTCTTCGGCCTGCCGGACAGAGAGGTGAGTAAGA
TGTCCTGTAATGCTCGGCAGGGATTAAACAATGGAGAGAGAGAATGAACATGTCAATTGA
TTTTGGGCTGAAACAGTCGAAGCCTCTCGGCTTTGAGCTGCAGCCTCTGAAGTTGATCTT
ATGTTGTACGACAGGCGAGAAAGGACATTCTGAAGATCCACACCAGACTGTGGACTCCAC
CACCCGCCGACACTTTTCTGGAAGAATTGGCAGATAAATGTGTTGGTACGTTTTCATTAT
AATGGTCCAACAGCTGGAAAAATACACGTCCCTGGTAAAAATAACAATTGCATTCATTCT
AAATTTGAAAACACTATATAACTTCATATAACCATCAGAGAAATTCATATTTATCATTTT
AGTGCAACGTCTACTGAGCAAAGACACCACAGATTGTGCCCTGATTTTCTTCAATCTGTC
TTTTTGTTTGCCAGGTTACTGCGGCGCAGACATAAAGGCCGTTTGTTCGGAGGCTGCCCT
GTGTGCATTACGGCGTCGCTACCCACAGATCTACTTCTCATCCCAGAAGCTAGTGCTCGA
TGTCGACTCTATCGCCATCATAAGCAGAGACTTTATGTCGGCCATGTCCAAGATGGTGCC
TGCTGCACAGAGGTATAACCAGACTAACTATAAAATAAAAAAAACGTTTTAATAGTGTAA
CATTTTTTTTATATTCAGTCCCTGCTTTTCACATTTGGTTCTTAACTAATTATGACGCTA
ATTGTGATCCTCAGGGCAGTGGTGTCACCAGCCAAGGACCTGATACCTGCCATTCGTCCT
CTGCTGAGCGCCGCCCTACAGGACGTCATCCATACGGTCAGCCGACTGTTCCCACACGCT
GAGCAGTGCTTAAAGAGGAAGAGAGAACAAGGTGCATTGTTTTTCTCATTTACTATCGCA
TTTATTCCGTCCCTAGTCTGTTTCGTTTATTGGCAAATTAATTTCCCCGTTGTTTATAAT
CACAGATTGACCGTTGATCTCTAGGAGTTGCAGTAACTGATATATGGAGTGCTTATTTCC
AGATGTGGCCCGTGGTGTGTCTGAGGACGACCTGATGTTCAGTGAGGAGGAGGACTCAGA
AGTTTGCGCCACTGGAGAGGCCGCTCACTCCCACCTCAAAATACCTGCTGTCCAGGGACC
CCTCAGCCTCAACAGGTTTGTTTTTTGGAATGTCATGCAGGGGTTCATTTGTCCCTGCAT
TCTTTTAGACAATGTGTTTATTCAGAAATATTGTAGTGGCTTTAACACTATTCAATATGG
TATTAGGCCACCGAGGGGCGAAGAGGGGAACCTTTCAGACGCATGTTCAAGGCTACAAAA
ACATTCATGCAATGTCCAATGCAACTATTTTTGATACCTAGATTGCATGATTGTCAGCGA
TATTGACGATGCTCTGCTACATATGAAATCAAGCGCTTCCTGAACTGTCAGCCAACCACC
CGGTGCAGATCAAGGTGGGAGGTGTCGCGTGCGCACCCTGCAGCGGCAGCCTCAAAGAAA
GGTCTGTCTGCGGTGGACTCCGAAGTTAGTAGAAGAGTAGCGAGACAGACAACAGAACAG
GGAGCAGACCACACGGGTGGGAAAGGTAAATCAAATATCAGGAGCAGAAGGCGAAGAGCT
AGTCCCTTAAAAGGATCATCGTTTTTGGGATTAAAAGGAAGTGGTGTGGAGTGTAGTTTT
TTTTATTATAAAAAGACGTGTACACTAGCTGGAATGTAGCTCAACATGGAAATGAAAGCA
GTGCTCTGTTGATTTTAAATTTGGGTAGGCGGCCCCGGGGAAGACCCAGGACTATGTGGA
GAGATTATATCTCTGCACTGACCTGAGAACTTCCACAGATAAGGACAAGTCTGAGTCTGG
CAAAGACGTGTACATCCGCTAGAATGTAGCATAACAATGGAAGTGGTTTCCCATCCACAC
ACATCTGCTTTCCATCATTAAGCACTAACCTATATGCACTGTCACATCAATGTCCTCCCT
TGTGTTCAATCTCATAACTACCTGTGTGAATTCAGCCAGTGTTTCCCTCAAATATTTACA
CGCGCCTTTTCTACCTCCTCGCTGTCTGTGTGATCTCTCGGTGTGTAGGAGTGTGCTGAG
CCAGCCCACCTCGTACCGCCCCAGGCTGCTGTTAGAGGGCAGACTAGGCTCCGGTCAGAG
CTCCCACTTGGCTCCTGCTGTCCTCCACACTCTGGAGAAATTCACTGTGTACACGCTGGA
CATGGCCGTGCTGTTCGGAGCCAGCGCAACCGCACCGGAAGAGACTTGCGCTCAGGTAAA
AGAGACACCAGGACACAAAATAATACTGTTGTTATTAATGCATATATTTCGGCACTTTTT
GCAATAGGGACGTCTTCAAGTTGGGTTCTATACATTAAGGAGGCCCTTGATTCTTAAGAA
CTGCAGGTGACTAGAGGAAGGCCCGATATTATTAAATATAATATTATAAATATTTAACTT
TGTCATTCAAACTATCTTGACTATTATCTTATGACCAAAAGAGCCTGGAAGGCGTTCACA
TCAGGGTTCAGGGTTTAGGGAGGACTTTGGGATTGGGCCGATTTTGCAGCCATGTCAAAT
TCAGTGTGTTCATTTCCGTGGACCTCACTGGCCAAAATGGCTGCCACAGTGACTGTAGTT
CATGGGCCCCACCTCCCTGCATGGTGGACTGTGGGGATAGATATGTACTACAAACAAATA
TTTGAATGCAGAAGAAATGTTCTAGTTCTTTTTATTTTTTTAATATTTTAACATTTCTTA
AATTGAAATATTTTAGTGACTAAATGACAGATTAAATTGAGCAGAAACCTTTTCTGCTCA
GTCTCAAGTAGGGCCTCTGCCGCTGTAAAGTCTGTCAATCTCTAATCAGGGGTGCGAACG
TGTCACCTTTCGGCGAAATTCGCCGTTTTTGTTTCAAAATAGGTCATTTGTGTGATTCAT
GTAGATCTGCAATAAAAATATTTTTTGGGGGGGTCCGGTCCTCCAAGTAATCTGCGAACG
CTGTCATGAATATTTTTTTCAAGCTTGTTCGTTTGGCCAACTCGTGTCATCATGTCATCT
TCGGGTCTATAGCTGCCTAGACGCCGTAATAGACAGAAGTGACGTTGGTACGCTGCAAGA
ACGTCAGTCTTTCTAACGTAGGCTAACGTGCTAATGTCAGACAGTTGGCTGACAGACGCC
TCGCAAATCACATCAACCATTTTTGCTGGTTGCAATAACGGTGTTATTGAATAGTACAGT
GTCTATTTCTCTGGAACTTTTGAAAAATCTAAGCGAGAAAACGACAAAAAATGTACCTAC
CTTCACATTAAAAAATCCTAAAACAAATAATGGGAAATCAACGAAGAAATCAAAGGCTTA
CTCTGATATCAATGTAATGTTAGTGAATGAGGGGTGAGAAGCCCCCTCCCTCTTGCTAAT
ATTTATTCTGTTCGTCCAAAGCGAAATCTATTCTTGAGGTTCCAAACATTTCCAAAGCAA
TTTGTCTTTGAATGTGAGTAGTCGATCGAGTCATCTTATGTCCCGTCGTTTGAAGCAAAC
CTTTTAGCTCTGCCATTGGTCTCCCATTATTTATTTATAACGTCACTGGAATGGAAGTCC
ATTTTCCAGGCTCTTGCACGCCCCCTTCATTGAGGCAGAGGTTAGGTTTGCCTTCCATAT
GTGCTTTTTCACTTTGTCACCCCTGCTAATTTCCATCCAATACCTTTTTGATTTATGCAC
TTGGCCTTCATTATAACCGTGGTAAATTCACCCACAACATTATTGTGTCCATGTTCTGCA
GATCTTTGTTGAAGCAAAGCGGACCTCTCCCAGTATCCTGTACATCCCTCACATCAGCCA
ATGGTGGGAAACAGTGGGTCCGACCTTAAGAGCCACCTTCCTCAGCCTGCTCAGCTCCAT
CCCTCCCTTCGCTCCAATACTGCTTCTGGCTACATGCAACCTGCCGTATAACGAACTCAG
TATGGAGGTATGGAAGCGAGAAGGGATGCCCTGTTGACCCTTAGAGGTGATACGTGAGGG
CGCATCGTTTAATACGTTGTTGTCGTGTGACAATAATGTCGATAGGCCTCATTTTCTCTT
AGAGATGCATACAACACTCTGCTGTGAGTCCTCTCTCACCTTTTTCATTTGTCTTGTATC
AGGTGCAGGACTTGTTTCGGATGGAGTATGGCGAGGTTTTCCACGTCAAGGTCCCCACCA
GCAGAGAGAGAAGAAACTTCTTTGAGGATCTAATCCTCAATCAGGCTGCCAAGGCCCCTG
CCTCAAAAAAGAAAGCTGGTGAGAAATGTGCTTAAAGAAGAGCGATCTAAGATCGCTGTG
TGTGTGTGTGATCTATTCAGCATCTTCCGCGCAGGTGTTTTTTCTAAGCCAATTGTCACT
TACAAGCATAATTTTACGCCCTACGCTCTTTTCCGCGTGGTGATAGTGGATCCAATAGGA
ACAGTGGTTGAAACGGGCAGATCGGCCCAGCCGTGAGGCCTGCACATAAGCCCCTCCTAA
AGAAGTTTATCTTCACTCTTATCAAAGTAAAGGCGAGGCGAATGCCTACGAGTGGAAACC
GTTTTAAGAAATGCTTTAAAAATGTTCATTACAAAAGTGAAAATAAAGTAAAGGCAATTT
AGTTGAATATGGCCTGACACTGAAAGCATCATGAAATGAATGTTGAGTGTTTGCTGCTTA
AATTCACTTCTCATTCTGTATGCATCTATCAACGTTCCCCCTTCTGAAGTGCTCAATGCA
TTGGAGGTGCTTCCTGTCGCCGCTCCACCTCCCCCACGTCAGCTGACACCAGAAGAGACC
CGGAGACTGGAGGAGCAGGAAGAAGACACCCTCAGGGATCTCCGCCTCTTCCTGCGGGAT
GTCACCAACCGCCTGTCCCAGGACAAACGTTTCAAGGCCTTTACAAAGCCTGTGGATTTA
GAGGAGGTAGCTGTGTATTGTGTCATTGTATATTTCCGTATAAAGTTTCACTATCCAGTG
TTCCATTTTCCCCCTTTTCCCCACCAATGTACTCAGCGCGGCCTCGTTGTCATGTGTTTT
AGGTGCCAGATTACGCTGAGGTGATCAAGAAGCCAATGGACCTGTCAACCGTTCTTACTA
ATATCGACCTCCATAAGTACGGCACGGTCAAAGAGTTCCTCCAAGACGTGGATCTCATCT
GGCAGAATGCCCTTGAATACAACCCAGACAGGGACCCCTCAGGTACACGCATACTCGCCA
TCCTCACCGACGCATATGCAGCATAATACTCAAGTTATATCGTTTTAAACCGGTTTTCTT
CAGACCGTCAGATCCGCCACAAAGCCTGTGCCTTGAAGGACAGCGTCCACGCCATCATCA
GAGATGAACTGGATGAAGATTTTGAGAAGATATGTGTGGAGATGAAAGCGTCCCGCAGCA
CAAGAGGTAAATGCTGTGTGTGTTTGTGTTTGCAGTTATGTAGATAAAAGATAAATGCGA
TCAACTTAATTAACACGGTGCTTGTCTTAATATTACCTGCTGACTGACTCGGCTCAGTGA
CCAATATCTAATGGATGATTTTGAAGAAAACAACCCCATACTAAGTTTATGCGTTTTAAT
TTGATACAACTATATTTTGTTTACATAGATTCATCCACCGCTTGCATGAATTTGTCATCC
ATTTATCTTCAAGAATACCTTTTGTACAATTGCATCCACTAAAAACTGAACCCTGTCTTT
TTGTATTTTTTGAAATTACTTCAGATTGTTCCACGGCCCGGTTTGCTCCGTCCTTTTACC
ACGTCCTTCCCAAACCACCCAGACGTCCTGCTGAGGCGAACATCACGGCCATAAGTCCAC
AAAGAGAGCCAGCTGGACCCACAGCTGCAGTCACTTCCAACACAAGTGCCTCTGCTGTTA
CAACATCTAAAAACACAGGTAGTGTAACAAAATAAAATGATTAACTCCGATTTTTTTATG
TGAGAGTTATTTTAGTGTCTTTTGTTCCTCCAGCACAAAAGAAGAAAAGACGAAAGAGTC
GCTGGTCCGCTGGCTTGTATTCAAAGAAGAAGTCTCCCTGCTCTCCTCACATGTCCAGAG
ATGAAGCCCACTTAGGGTCGGATGACGAAGATGTGGACAACGAGGAGGAGGAGGAGGAGG
AGGTTGAGAAGGGAGGAGGAGCAGAGTTTGATGAAGGGACTAGAGGAGAGGAGGATCAGA
TGATGGTTGATGTAGAGTCAGGGCCTGCAGCGGCCCATGAAGGTCGCTCTGGGTCGGCTG
TGAAGGAACAGGACAGTCCGGAAGGACGAGAGGAGGGTCAAGCTGCTCGAGAGACGGATA
TCCAGAGTGAAGGGGTGAAGGCTGAAGAGAAGGAAAAAGAACTGGTGCATGAAGTTGTCA
TAGTTCGACCAGGACAGTCAGAGAACAAAGTGTTGATTAAGGCAGGAAACGAAATCGGTG
AAGACATTTCCCCTAACACTAAGAAGGACAGCCACACCAAGACAGAACAAGATGCCCGGC
AGCAATCAAAGCTGACGGAAACTGAGAAATGTCAAAGTGTAATACAGGAAGGAGACAACA
GAGTAGTTTGTGTAGAAGACGCAGAGCAGAACAGGCCTGCTGAACCAATGGAGGTGGAAG
CAACCGATACCGTAACCACAGACGCCTCTGCAGCTACTAGAGGAGACGAAGGTACAGGTC
TGATACTAACAACATCTTGCTTACACCTAAAGTTGGCTCTTTAACTTACATGCCTGCAAA
CATGTCGCTTTTCGGCTAAATCCGCCACTTTGAAATCAAACTAGGTCATCCATCGTGGTT
GTGCGGCAGACTGTCATTTATTACAATGGTTTAACACTTGTGTTTTCTGTGTCTTAGAGA
AGAGTGTGAGGCGCGTAACCCGGGCTCTAAAGAGCGCTGTGCAGCACCAGGTGATCAATG
TGGACAAAGCGCTGCAAATCTTGCACCAGGAAACTCCTCCTCTGGTAGTGGACAGAGACA
AATTAAAGGTGTGTGGCTTATTCTTTTGACTCTTTGTTGGTTGTGTGATGGTTTTTACTC
TTTCATCTTTATCTAATTCATAAAAGCTTTTTACAAACGGGCAGAGAGACTAGGCTACTT
TAAGTAATCCTTTAGCTAGCAAAGAGAAAGTAAATCTAGATCAATCCTCTTTGTCTTTGC
TTTCTTCCTCATTTCTGCAGGAGCTGCTGGACAGAGTAGTGATCAAGACTGAAGGGTACG
AGGTCTACAAGCTGGAGAAACTCTATGCGCTGCTCTGCCAGAGCATCTATAGACACAGAC
GAGACTACGAAAAAACTACACTAATACAGGTTTGTGTTGGAGTGTACTGATGTGCAGATG
TAGCTACTAGTATGTTTTTTTTATTGGAGATATTTGGACTTGTCATGGCAAGAGGCACCA
TTGTGTACCTCACTAATTACTCCAGTAAATGTGCCATTGTTATTCAGTATTAATCAAATT
CCTATTTCATATTAAGTTGAAGTTTACTTTTGCCTAACCTACTTTACTGTTTCTAATCTG
TTGTACTTTCCTACTCTTCTCATTTGCTTTAGGAGTTGAAACAAGAGATTGAAGACTTCT
GTTGACTTTTCTACTGGAACAATTGTTTTATATAAGCATGCTCAGCATCCACAGCTATGT
AAATATACATTGTTTCTATTTTCATAGAAATCTACCAGCACATATATTTGTGCATTAACT
ACATATATGTATTAAGTCTTTTGTTTCTATTTAATTAAATGGTTTTCCTCTGAATGGTGT
GACGTCTTATGTGCTCATCACATCAATTTTGCTGCTACTTTTAGCATTCCCTGATTCACT
TGCCCCCTGCAGTGCGTAGGGCACTTAAAGTGCCATGGTTTCATCCTGGCATAATCACTT
TAATTATATTGTTTTTTACACATGGATCACTCGTTTAAGCAGCCGGTGTAATAAACTGGT
AGTCCGGTATTTGCCGTGTACAAGGAGCGTCTAACTGCATACTATAGAGTAAGTTGCATT
ATTAGAAGTGTAGGATCCATCGTTTTTTAAATCCCCCATTTAGAGACTACGGTGTATATA
TACGCTCTGCATCATTTTTGATGCAAATTTGTACCCAACTTGCAATAAGTAGGACTTTTT
CCACATTTAGTTGCAAACTAATTCAAATCGACTCCCCCCGCCCCCCATTTGATCAACACC
GCATAGCAAGTTGCAAAATACATTTTTTATTGTGACACAAACAATAACGACAACAAATTG
ACATGTTTTGGATTGTAAATCGACTCCCTTTTGGAAACCCAAAAGTCTTCTGGGGTGTTT
TACAACCTAAAGATGGAAATGTTTTAGTTCAGTCTGTGAACAGCCACTTCAAATCCTGCC
ATAGATTCTCAGTTGTTCCGGGCTTTAACTGGGCCATTTTAAAACATTTAACATGCTCTA
ATCTAATTATATCCCTATACAGATAGATATTATCTATATCCATGATGATGAATTTGTTGA
AACGAACGACTGAGAAGGCAGAACTGCCTCATAAAACGGGATGAAGCGTGCGCAGGTTAC
ACGCTTATGTCGGGTTTGTCCTCAAGTGGCTCCTTATTGTGCCCCGTGGGGTCACGTCGG
GACACCTCGGCAGACAGCCGGCTCGGGAAACCAACGAGGCGTACGGTCCGTTGAAAACAA
CGTCAACCGCCGCGTTTCTTTTTCCCGGGCGACGCATTGCTCTTTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1101, 1275..1362, 1521..1605, 1755..1805, 1869..1934, 2208..2328, 3004..3105, 3535..3643, 3966..4081, 4325..4499, 4660..4748, 4990..5149, 5294..5384, 5594..5771, 5894..6030, 6182..6314, 7248..7434, 8941..9126, 9302..9437, 9889..10085, 10202..10361, 10443..10565, 10884..11057, 11133..11258, 11565..11810, 11997..12127, 12320..12448, 12692..12846
1001..1101, 1275..1362, 1521..1605, 1755..1805, 1869..1934, 2208..2328, 3004..3105, 3535..3643, 3966..4081, 4325..4499, 4660..4748, 4990..5149, 5294..5384, 5594..5771, 5894..6030, 6182..6314, 7248..7434, 8941..9126, 9302..9437, 9889..10085, 10202..10361, 10443..10565, 10884..11057, 11133..11258, 11565..11810, 11997..12127, 12320..12448, 12692..12721
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved