Gasterosteus_aculeatus Locus ENSGACG00000020117
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus ENSGACG00000020117
Gasterosteus_aculeatus
ENSGACG00000020117
groupVII
SNORD14
3972..4064
6088
AATTTGCTTTTTACAGTTTATATATTGTATGTATTTTGTCTTTACATCAACCAATAAAT
GATGTTTTGCTCAAACACACTGGCGAGCTTTGTTTGAACATGGATGATTTTTTAGGGTGA
ACTGAATGCAATCTCGGTGAACGCAATAGTCTCTGATTCGCCCCTGCACTTTGTAAAAAG
ATCTGTTGCATTCCCTAGGATAGTCTGATCGCCTCTCCTTTTTTCTTCTACTTGGTAATA
CACTAATACAGTACTTGAATAATTCAGAAGGAACAGTTCAAGTTATTAAAATAAATTAAA
TCATTCCCAGAATCAGAAGCCTGGAATGAACAGACAGGATCGCATACTGCACACAACATT
GCTTTCCGATTTGGTGACGTTTGGGCCTACAGTTCACAAACCTGAAGAGGGGCAATGAGG
GGGACGAGCAAAGCCACAAGCAAATAATTGAAAGCAAAGATTGGAATTGGAGGTGGAAGG
AAGGCCAGTTCAGGTAAATCTGAGGGACCGATGGGGGGGGTTTGAGAGAAGAGGCCAATT
GAGATTTATTAGGAGTGAAGTGATAGTGTGCCATCATTTTTTGTGAGTGGCTAGAAGTGT
TCACACTGCAAATACTCTTCCTTTCAAATTAACATAATCTCAACAACCTATTCTGTTTAT
TCCCCCTAATAAATATGTACATTGCTCTGCACTTTGGGAAACTCATTATTTTGTCTACCT
ATAAACATACGTAGTTCGTATGGATATAACATATCAGATAACGTTTGCCTAACCACGTCC
ATCCCCAGGTAAAGCTGTAACGGGGCCATGAGGTCTTTCATTTTTATTATGGAATACAGA
TCATCAGATCATAAAACAGGAAGTATACTGGATCTTTCCCTACGTCATCAACTATACTAC
GCGTGATTGGTGGACCGGCAAAGACTCGACGTCTCATTGGCTGCTTAGTCGTAGATATAA
ATAACTCCCGACAACGGCATCTTGTACTTTTCCCTCCTCATACCGGCAAGGACCAGCAAG
CCTCGCTGCTGTCCATTTCAACAAATCCCCTTAAAACAAATTCGGCTCCACATTTCGGTA
AGTAAAGAATGCATGTTTTACAAAAACACCGCACCCTTTTTTCAACCCTTTGATGAGATG
AATGAAGTTGGCCTTCGCCTTTTGTTCACTCGTTCTCTTTCGGTAACGTTATTTACCGAC
ATAAATAATGTAACGTTACTTGTTTTTTGTAATTATTGATGCCGACTTGTAACAAAGAAG
GCTAATGTTGGACTGTTCTCTTATTCTGGGAAAGCCTGGAACGTTACTGACGCGCATTAG
CTAACGTTAGCTGCGTGGGAAGGGTGGGGGTTGGGATTTTGAGACCTTCGAGAATGTTCC
TCAACAAAGTGTCAAGCTAGACCGTATGAGCAGACTTCCGGTTTATTTTTTAGAGCAATG
TGTATTGCCATCCATTTACGATGTCCAGGCTCTTACAGGAGTATTGCCGTTATGTGATCA
AAGTAACTGTTTACAGTAATTTCATTTTCATTAACTTGATTTATTAAAGAGTTGCTATCT
GGTTGTCTGTGATGCCACATGGAGGTGTCCGCTTGCTTCGTGTCGTTTATTTACCGTTGA
TACTGCCGCAGTGGAGCCGGCGCGAGCCTCGCGCTTTTCCGGAAATGACGTAGTGACTGC
CGCCGTGTGGGGCCTGTGGTCGCGGCGCTCTTTAGTGTTATGTTACATGTTTGGAGATTT
TCGTTTTGGGGTAATTTTAGACCTTTTTTCCCCATCCAAATCAACTATATACAATATATC
CAACCATCATTTATTGAATGCTTTCAAATGCCAATGTGTGTCTACACATGCCTTATATCT
AGGGTCTCCATATTGGTTTTCAACAATTATTTGTGCGATGTTGTGTGCTAGCGAAGTCTC
CCTGAATCAATGTTATTGACAAATCAACTCTTCCATGTTTTTGTAGGAAACATGTCTAAG
GGACCAGCAGTAGGTATTGACCTTGGGACCACCTACTCCTGTGTTGGTGTGTTCCAGCAT
GGCAAAGTGGAAATCATTGCCAATGACCAGGGCAACCGGACCACACCCAGCTATGTGGCC
TTCACAGATTCAGAGAGGCTGATTGGCGATGCTGCCAAGAATCAGGTTGCCATGAACCCC
ACAAACACCGTTTTTGGTATGAAATGCACTTTTTGTTTGTTTGAGGGATATTGTAATTGT
CTGCCAAAATGCTGCCAGTTGATTGTTAACGTTGATACTCGTATGAAAGACTGACTGATT
AACTAACTTATAAGTGCTAAAGCACTCCCTTGACATTCATAGTTTCTATCGGATGCTGGT
GGCATACATACTACTTTTGGATTTTAATGGCTACTGTCAGATTTTTAAAAATCAATTTGA
ATGTATAAAATGGTTTTATTTTTATTTTTTTCAACAGATGCTAAACGATTGATTGGTCGC
AGGTTTGATGATGCCGTTGTGCAGTCAGATATGAAGCACTGGCCATTTAATGTCATCAAT
GACAACACTCGCCCCAAGGTCCAAGTAGAATACAAGGGCGAGTCAAAATCTTTCTACCCA
GAGGAAGTCTCATCTATGGTGTTGACAAAGATGAAGGAGATTGCTGAAGCCTACCTCGGA
AAAGTACGTATATTCCATAGCCCAGGAAATTGTTGTCTTTGATGGACGATGTGCTAATGT
TGTTTCCTTTAAAGACGGTCAACAATGCCGTGGTTACTGTGCCCGCTTACTTCAACGATT
CCCAGAGGCAGGCCACAAAGGATGCTGGGACAATTTCTGGCCTCAATGTCCTGCGTATAA
TCAATGAACCAACTGCTGCTGCTATTGCCTATGGACTGGACAAGAAGGTAGGAAACTTTG
CATAATTGTACTCGAATGATCAATATTGTAATGGAAAATGTTAAGGCAATCTCTAATGTA
TATGACTAAATTCAGGAAGATGTTCATGATTTGGTAGCATTGGGAATGTATTAACGCCAG
TGTTATTTCAGGTTGGCGCTGAAAGGAACGTCCTAATCTTTGACCTTGGTGGTGGCACCT
TTGATGTGTCCATCTTGACCATTGAAGATGGTATCTTTGAGGTAAAGTCCACTGCCGGAG
ATACACATCTTGGTGGGGAAGATTTTGACAACCGCATGGTCAACCACTTCATTGCTGAGT
TCAAGCGCAAATACAAGAAGGACATCAGCGACAACAAGAGAGCAGTCCGTCGGCTGCGCA
CAGCATGCGAGCGGGCAAAGCGCACCTTGTCTTCCAGCACTCAGGCCAGTATTGAAATTG
ACTCTTTGTATGAGGGAGTCGATTTCTACACCTCCATCACCAGGGCTCGTTTTGAGGAGC
TCAACGCCGACCTCTTCCGTGGCACCTTGGATCCCGTGGAAAAGTCACTCCGGGATGCCA
AGATGGACAAGGGGCAGATTCATGACATTGTGTTAGTCGGTGGCTCAACCCGTATCCCGA
AGATCCAGAAGCTTCTCCAGGATTTCTTCAATGGGAAGGAGCTTAACAAAAGCATTAATC
CAGATGAAGCTGTGGCTTATGGGGCTGGTAAGTCTTTAGGGAGATGGCAGAGCGCACAGA
TTTAAATTTACTTAGTTGTTTAAATTGTGAGCAATGCAGCAAAAGGAGATGGAAGTCATG
AACTATGGTGACCTATACAATAAATATACTTTATTTTAAACTTAAAATTGTTAAACCATT
CCTTGTTTTCATAGCTGTCCAAGCTGCCATCCTCTCTGGCGACAAGTCTGAAAATGTCCA
GGACCTGCTACTTCTAGATGTCACCCCTCTGTCCCTTGGTATTGAGACTGCTGGAGGTGT
CATGACTGTGCTGATCAAACGTAACACCACCATTCCCACAAAACAGACTCAGACCTTCAC
CACCTACTCTGACAACCAGCCTGGTGTGCTCATCCAAGTAAGCCAATCATTCAAGATACT
AGTCTCTAAATTTCGCAGTGATGATGTTTATTCCTGCCATTCGTAGTTTCCACCAGAGGT
TGCAAGACCGAAGAGGGCCCCGACCTTCCTTGGATGTCTGAGCGAAATAATTGTAGAACT
GTAGATGTCTTGTGCCCAAATGGTGTGCCAAACTCTGCATTATTTTCACAGGTCTACGAG
GGTGAGCGTGCTATGACGAGGGACAACAATCTGCTGGGCAAATTTGAGCTGACCGGCATC
CCTCCAGCGCCCCGTGGTGTTCCCCAGATTGAGGTGACTTTTGACATTGATGCTAATGGC
ATCATGAATGTTTCTGCTGTAGACAAGAGCACTGGCAAGGAGAACAAGATCACCATCACC
AATGACAAAGGTGAGCTTTTAGTTGAACTCTAAACATAATCTCAAATGTCCTCTGACAAA
ATAACCAACTATTATCTGCCTGCAGGTCGCCTGAGCAAGGAGGACATTGAACGCATGGTC
CAGGAAGCAGAGAAGTACAAGGCTGAAGATGACGTTCAACGTGACAAGGTGTCTTCTAAG
AATGCCCTGGAGTCTTATGCCTTCAACATGAAGTCCACTGTGGAAGATGAAAAGCTTGCT
GGCAAGATTAGTGACGATGACAAAACAAAGATTTTGGAAAAGTGCAAGGAGGTCATCAGC
TGGTTGGACAAAAACCAGGTAAATCGTCAATCTTTTAGTAGGACTTTTCTTTAGTGGAGC
TGTGATAAATGGCCAAAACGCCTAAATGGTTTTCTTTTACAGACTGCCGAGAGGGATGAG
TATGAGCATCAACAGAAGGAGCTGGAGAAGGTCTGTAACCCAATCATAACCAAGCTATAC
CAGAGTGCCGGTGGTATGCCAGAAGGCATGGCTGGTGGCTTCCCTGGTGCTGGTGGTGCT
GCACCAGGCAGCGGTGGATCTTCTGGACCAACAATCGAAGAGGTCGACTAAGAGTGGCTC
ACTTTAACCCGCTACTCCAGGATGTCTCCAAGAAAGTAACCCTCTTATAGCAGAAGTTCC
AACGAGCTATAGAGTGTATTAAAATGAATAAAAGCTGGGTTCAGGATCACACTTATTGCA
TGGTTTGCAACAACTTGTAGTTGGCGCTGTTGGTTCACATGTGTGGGAAATTGTTTTGTC
ACTGCCTTGACAATAAAAAAATAAATCTTAGCCCTCCTCTGGCCCCATTTTGTATCTTGT
TTAAAATTTCACCAGAGATGGATAACAAAGGCAATATGTTTTGTATAGGATGCTCTGCAT
TGAGAATCATAGCTGCTTGGTGGTTGTAAAAACTATTTACAAAAGCCTTTTTTTTTTTTT
TCCCTACCCAACATTTGTCCACCGATTTCCTGTTGTATTTGGACTAGTCTTGACAGCGTG
GCAGGACGAAATAACCAGCTGCAGGGTAGTTGTGGGCAGACTGGTCGACGAGGGAGGTAG
TCGTTGCTGCCAGTGTTAATTTCGTCGACGAAAAATGTTCGTTAACCTTTTTTCCATGAC
TAAGACGTGACGAAAACGGATCTTAAAAAATAAACTGACTAAATATATTCAAACTTTCTT
TTACGAGACAAATGTTGGTGGTTGATTAAGTCACAATACTCTTTTCCCCCTAAATCTGCA
TACACCTAACAGACATGGGCAAAGTACGGCGGATATTATCGTGTCATGATGACGTCATCC
ACGAACCCAGAACGCTCGCGCACATCGGTGCAGCGGTGGTTCTTGTGCACCGACTACATC
CACTCGAGCACGGTCGTCCTCCAATCAGAGGGTTGTGGGTTAGATCCCAGGCTCTGCTAA
CACGCATGTCGTTGTGTCCTTGGTCAAGACGCTTAACCCAACATTGCTCCTGTAGCCTGA
CTACTACTACTACTGACCACAGTGTGTGAATGTTCGTTACTGATGGGCAGGTGTCACTGT
ATGGTTCTCCTGTCATCAGTGTGTGAATGGGTGAATGATGTCATGTAGTGTTAAAGCGCT
TTGAGTGGTCGGAAGACTAGAAAAGCGCTGTACAAGTACAGACCATTTACCATTACCATT
TACATACCGCGACGACTATTTTACGCTTCGGCGAGTTTGAATGTGGGCTTCCTTAGTTTA
GCTCAGCTGTCTCGGATTAGCTGATTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 1966..2175, 2434..2642, 2714..2866, 3011..3566, 3734..3936, 4131..4329, 4405..4637, 4722..5088
1971..2175, 2434..2642, 2714..2866, 3011..3566, 3734..3936, 4131..4329, 4405..4637, 4722..4907
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved