Gasterosteus_aculeatus Locus ENSGACG00000019819
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus ENSGACG00000019819
Gasterosteus_aculeatus
ENSGACG00000019819
groupVII
SNORD22, SNORD31, SNORD31, SNORD31
2457..2583, 3253..3320, 4597..4659, 5840..5902
7622
ATAAAAATAAAACATACCTCCTATTCTCTATCATAACGTCAATAGCAAAAATAAACTTT
TCGCTTTTTTGTCTTGGTATGAATTTACAGTGTATTGTGATATAAAATAGATGAATTACG
AAGAAAATGTCGCTTTGCCGACACCATGTGGATGTAAACCAATATTTTTTCTTAACGGAA
ATGACGCAATAAAATAAACTGCTGTTTTTCTTCTGCGGATCAGCCGTAACTCCAAACAGT
GGCCTTGAGTTCATCAAAAAAATAACACATTTTGTCTTTGTTTCGTTTCGTTTTATGTTC
TTCCCCAATGCAAAGCCCGTGTAAAAGCCAGACGGAGGTTTCCCGGTAGAAGCTCCCCGG
GTGGGAGGAGCCTTTCCCGGGGAGATAAAAGGCGGCGGACCGCTAAGCTCGGTCACTTCC
TTCTGGCTCCTGGTCGAGGTAAGACTGAAAACACTGGGGCTTAATGATGCTTCGGCCTAA
CTTGCACATTCTAATAGATACCTGGAAAGTATTTGACTAACCGCGTCTTTACTCACTGGT
GTTCCTCATTAATTACAACACGTTTTGGTGTCTTCAAGCTGCTAGTGCGCAGGGCTTCAG
TGACTCAACGCGTTCACCACAATCTGGAACCATCCGGCACTAAAACGTGTTAGTTTTACC
GGAGGAGTTTCATGAGCATGAACGGCAACATGTTTAATTAGTATTGTTTTTAGTATTTAA
CGTCCAAACTCATTTTAACACACTTTGGTGCAAGCTACGTCCCCCGCAGGCTCGTTATGG
CTGCTAGCGGTGTCTCTCAATGATGAAAAATACAGACCTGTACTGAATGACTGTGACTGT
CACTTAATTATTCTGATGCGAGACACTGCTAACCAGCAACGTCGTTACACCGTAAGACCT
CTACATGGTCACGACCGACACATGGCGGCCGCCACGTGCTTTGGGAGCTAGCTTCCCAGC
TAGCGTCCCAGCATGCTAACGCTGTGTCTCCTTTGGTCAACAGATGGCAAACAAACCTCC
CAGAGACTGTTTTCCCAGGTGAGGTTTCACAAGACTGGTTTCTTTTTCATGATTTAGGTT
AACCGATGTGTTTTCCGCTGAACGTGCTACAGTGATGTGTTCTAGTTGAACTCTCTCACC
TATATTCTTTGAGGATGATAAATCAAATTCTGAGTAGCATCAACTAGTTTTCTCGAGTGC
TCTTGTGAAGTAATTTCAAAACTAATCATTTTTTTCTCAAATCCTCAGGCTTAACGACAA
TGTGCCTGAACTCTTTACATGGGGTAATTATAGAAATTATTTTTGCCCGTCCAGATCAAT
TGAAGCTTCAATGATTTTTTTGAATTCTCTCTTACTGAATCAGTCTTTGAAGAAAACACT
TTACCAGATTATGAGAAGCATGAAGAATCACGTATTGAAGGCTTATTCCAAATCCAATGG
ACCCCCTCTAAACCCGATCTCTTCCCTGCAGATGTTCATGGCTGATCAAATGTGCGGATC
CAGAATGAAAGACTACGGCAGGTGAGCTTAACTGACACTAGAATTAACTCCTTCACCAAG
GGACACAACTGATGATTCAAGAAGACAAGCATATACCTGATATCAGTGATGCCAAGTTGT
AATCTGATCAGTCCATGGAAACCGTGGATCTCGGGTGTAGGTCTCAGTTTATGGCTAACT
GGGATGTCTCTTCAGGTGGTCCTGCAATGTTCCCATAATGAACTCTTCCAATGAAGAACA
CAATGGTGAGTAAACCCTCGTTCATTCATTCACACACTGGTTTGGGGTTAAACATGATGA
GTATACTTATTGACAAGCATATGCCTGATTTCTGTGATGTCAGCCTTCTATCTGATTGCC
CTTATTTAAATAAATGGCTGTCATTTTTTATTAATGGGATTTATAGAACTGGATTTTCTT
TTTCCTGTAGGTTGGTGTCAACCAGTGTTTGAAAAAGGATGTCACCAAGAAGCAATCCTG
TAAGTCCAGATTGTGTTGACCGTGGATGCTTCCCATCACAACATGCCAGTTAAATGCTGC
TTCAATGATGATACTTCTAGCTCACTTTGATACTGTAGTGTTTTCTAAACCGGGTTAATC
AAACCACAATAAAAGTCATCCTAGGAAACTTTCTTTTGATGTGCAGTAAACTTATTTGTT
TCTCCTACAGATGATGGATGTTGTCTGGGAAACGGTGAGTTACACTTTTAGAGGAATGCC
TCCAATGGTGCTTTGTTTTGCTGAGAATGATGAAATATTTTGTCTCGTTCGTCTGAACTA
CTGTTGACAAACCAAATCACTGACATCAGTAAACATCAACCGACAATAGTGGAAGTCTTT
GTGCTCGGATCTGACAGTTGTCTGTTGCAGGTACTGACTTTGAAAGATGATGCCAGCTTC
TTAACCTTTGTCCAGGTGAGTGATCTAAAAGTCTTGAACCTCAGATTTAGTTAGTTTCCT
TTGTGATGACATCCGCACACGTCTTACGCCTCTGTTTAACGCCAGAACCTGTAAAGGTGG
ACCCACTGGTGTTGCCTTGGCAATAAGGGGAAGGAAAGTTGGTGTCGCCAACAGTCTGAA
TGGAAACTTTAAACCCGCATGTGACTAAATCCAGTTGTGACTGTGCTGCTAGTAGATATG
GGGATCTGAATGCATTGAACTGGACCTTCTGATGCTGCTTGATTAACTCTGTAGTGAAAG
TGACCAAACATTTCCTGTCTTTACTCTTTCTAGGATCGAGCTGCTGACAAGCAAAATATG
GATCATGGTACGTTTGGATCTCAACCACCAGTGAAAATACTATTGCTTGTGGTGTGATGA
CCTCGAGTGCCTTTACAGTCATCCTCCCCCTCCCGGTAACACACTCTCTGCCTACCCATC
AGACGCCCCGTTGGCCCGGTAAGACACTGAGAACCCTGAAACAAGCTTTCAGGTGTAAGG
TGATCTCCGGCTCCCTGAAGGGCTCTGATGGTGGATAGTTTGTTACTTGGATGTAATGAC
TGAAAAAGTTTGCTGACTACATTCCTTAACAAAAGTTCTCTGCACAAAGATAATTGAAAG
AGAATCATTTTTTTTATTTTCTTTTTCTAGATATCAATCTTTATGCTGAACTGAGTCAGA
ATTGCAGTGACTTGTAAGTTGTCTTGTGATTACTTGTTAATCTTGACTCGGCAAATAAAC
ATGTGTTGCTTTAACTTCATAGCCAGTGAGCGTAGTTTGTTAATATAAGGAAACTAATTT
CGTCACTATGCTCATTTTGATGTGATGAGTATTACCGCCCCAGTCTGAGAATTCATGACT
GATTGGTTACTCTGATCAAATTAGAAGTGTGACTTACTTGCACCACCTTCCATAGACTGT
ATTGTTTAAATTGTGTTTCTTGTTGCAGGAATGGTGATTGTTACTCTGCATAGTGGAGAC
ACAAACGAGTCTTTAAAAAGGATGTCACCAAGAAGCAATCCTGTAAGTCCAGATTGTGTT
GACAGTGGATGCTTCCCATCACAACATACCAGTTAATTTAAATGCAGTTTCAATGATGAT
ACTTCTAGCTCACTTTGATACAACGTGAAACGACATGAACTTCTGAGCGACTGCACTGTA
ATGTTTTCTAAACCCGGTTAAACAAACCACAATAAAAGTCCTCCTAGGAAACTTCCTTTT
GCTGTGTAGTAAACTTCTTTGTTTCTCCTACAGATGATGGATGTTTTCTGGGAAACGGTG
AGTTACACTTTTAGAGGAATGCCTCATGGCGCTTTGTTTTGTGGAGAATGATGAGATTTA
ATCTCGTTCGTCTGAACTACTGTTGACAATCCAAATCACTGACATCGATAAACGTCAACC
GACAATAGTGGAAGTCTCTTTGTTCTCTGATCTGACTGTCTTCTGTTGCAGGTGACTGAC
TTTGAAAGATGCCAGCTTCTTAACCTTTGTCCAGGTGAGTGATCTAAAGTCTTGCGCCTC
AGAATGAGTTCATTGAGCTGGACTTTCTGATGCTCCTTGATGAACTCTGTAGTGAAAGTG
ACCAAACATTCCCTGTCTTTACTCTTTAGGATCGAGCTGCCTGACGAGCAAAATATGGAT
CATGGTACGTTTGGATCTCAACCACCAGTGAAAATACTATTGCTTGTGGTGTGATGGACC
ACGGTGACACCAGTCATGCTCACCCTCCCGGTAACACACTATCTCCACCTACCCATCAGG
CGCCCTGTTGGCCCGGTAAGACACTGAGAACCCTGAAACAAGCTTTCAGGTGTAAGGTGA
TCTCCGGCTCCCCGAAGGGCTCTGATGGTGGATAGTTTGTTACTTGGACGGAATAACTGA
AAAAGTTTGCTGACCACAACAAGTACTACTTAGCAAAAGTTCTCTGCACAAAGGTTATTG
AAAGAGGATGATTGAGGATGATTTTTTTCTTTTCTTTCTAGAGGTCAACTTTTATGCTGA
ACTGAGTTAGTCGTCAGGATTGCAGTGACTTGTGAATCTTAACTCTGCAAATAAACATGT
GGCGTTTAACTTCATAGCCAGTGAGTAGTTTAATAAAAGGACACAAATTTCATCATAGTG
CTTCTTCTTGGACACCCAACTTTACACTCTGCTCCTTTTGATGTGATGATTATTACCGCC
CCAGTCTGATAATTCATGACTGATTGGTTACTCTGATCAAATTAGAAGTGTGACTTACTT
GCACCACCTTCCATAAACAAGATTGTTAAAATCTTTTTGTTGCAGGGTTGGTGATTGTTA
CTCTGCATAGTGGAGACACGAACAAGTCTCAATTGCTGCAGGTAAACGAGAACCTACAGA
AACATTGACTTGCTTCAAACACTGTTTGACAACAACCCAATTCATGAAAAACAAGTAAAG
ACTTTGTTTACACTACAATAAACAGTCATTCACCAAGGGGCAGAACTGATGATTCTAGAA
GACAAGCATATGCCTGATTTCTGTGATGTCAGCCTTCTATCTGATTGCTCGTAGTTAAAT
AAATGGCTGTCTTTTTTGTTAATGGAATTTATAGAACTGGATTTTCTTGTAGGTCGTGTC
AACCACTGTTTGAAAAAGGATATCACCAAGAAGCAGTCCAGATTGTGTTTAGTGGATGCT
TCCCATCACACCAGTTAATTTAAATGCTGTTCCAATGATACTTCTAGCTCACTTTGATAC
AACGCGAAATGACATGAACTTCTGAGCAACTGTAGTGTTAATAAAACCACAAGTCATCCT
AGGAAACGTTCTTTGGATGTGCAGTAAATGTGTTAGTTTCTCGTACAGATGATGGACTCC
TCACCATGATGGGTGTTGTCTGGGAAACGGTGAGTTATTCTTTTAGAGGAATGCCTCAAA
TGGCGCTTTGTTCTGCTGAGAATGATGAGATTTAATCTCGTTCGTCTGAACTACTGTTGA
CAATCCAAATCACTGACCTCAGTAAACATCAACTAACTTTAGTGGAAGTCTTTTTGTGCT
TGGATCTGACTGTAGTCTGTTGCAGGTGACTAAAAGATAACTGTCAAGCTGATGACCTTT
GTCCAGGTGAGTGATCTGAAGTCTTTCACCTCAGAATTAGCGAGTTTGCTAGTTTCCTTT
GATATCCGCACACGTCTTACGCCTCTGGTCAACGGCAGAACCTGTAAAGGTGGATGCACT
GGTGTTGCCTTGGCAATAAGGGGAAGGAAAGTTTGTGTCGCCAACAGTCTGAATGGCAAC
TTTATGCATGTGTCTGTGCTGCTAGTGAAATGTGGGGCTCTGAATGCATTGAACTAGGGA
GTGTAGAGTTTGAAAAAAAATGGAAACTAATTTCCTCATAGTGCTGCTTCTTGGACACCC
AATTCTACACTCTGCTCCTTTTGATGTGATGATTATTACCGCCCCAGTCTGAAAATTCAT
GACTGATTGGTTACTCTGATCAAATTAGATGTGTGACTTACTTGCACCACCTTCCATAGA
CTGGATTGTTTAAATCGTGTTTCTTGTTGCAGGGATGGTGATTGTTACTCTGCATAGTGG
AGATGGGAACAAGTCAATTGCTGCAGGTAAACAATAACCTCCAGAAACATTGACTTGCAA
CCCAATTCATGAAAAACAAGTAAAGACTTTGTTTACACTACAATAAACAGTCATTCACCA
AGGGGCAGAACTGATGATTCTAGAAGACAAGCATATGCCTGATTTCTGTGATGTCAGCCT
TCTATCTGATTGCCCGTAGTTAAATAAATGGCTGTCTTTTTTTTGTTAATGGGATTCATA
GAACTGGATTTTCTTCTTGTAGGTTAGTGTCAACCAGTGTTTGACGGGTGTCACCTAGAA
GCGATCATGCAAGTAAGGACGTTGTTTACACTAAAAAAAAACTCACATTCACGCCATGTT
ATCTGATCAGCCGTTAAATAGTAAGAGATGTAGGTCTCAGTTTATGGCTGACTGGGATAT
GTGTCTTCAGGTGGTCCTGCACTGTTGCCTTGCTGAACTCTTCCAATGGACACAATGGTG
GGTTAACAGTCACTCAGTGGTTTGGGGTTTTGTTTCATGTTCATGCATCTAATTACTAAA
ATGTTTCTTGTTTTTTTGCAGGTGTGGTCAGATCTTGGACTGTTGTTGGTCATGATGCTG
CTTGAAAAGTTTTTAAGTGAATATTTAATTTGTGTAGATTAAATATTTTGCAGAGGCTGC
TGTGTTTGACTTGTGTGGTGTCTGTGACGAATGATTTCTTGACTTTCATTTATCAAGCAC
GCGTATGTTCTTTCTATAGCTATTCAATGTATTCTAGAGATAGAATTTAGTTGGAGCTGT
TTTAATAAAAAAAATCTTGACTTGACAATTATAACTGTCATTGGGTAACCTCAATGCACA
TTTCAGACTTCCTAAATTCACTATAAGATTATAGTCAACTGATTAGAAGTAACAGTCCTT
AACTGTTGACCATTATTTGCAATCACTAACTTTGCTGCACTATTGGGAAGTGACAATTAG
ATTGTTAAAGCATTTAGGAATTTGGCACATAGTCTATTTCTGGTCTTGCTACATTATGAG
AAGCCTTTACATGCTAATTTGCTTTCTGTTGACCAGTTTTCAATACGATGTAATGACTCA
ACTGCTCCACTAAATTGTAGAGCAGGCAGTGAAAAGGTTATGCAGAATTGATCAGACCAC
TATGTGAACTTTGGAATAGGTATGGAAATGGAACAGTGTTAGGCATCATACTTGGTGTCA
ATTGCCTTTGTCGAAGTTACATTTCATAAATTCTGTTTTGGTCTGTCTTAATCAGGTGGA
AATAGCAAGTTTTGTACAAATCAGGTTTAATACAGAGCATTCATGTTTGTCTTGAACACA
TTTGTGCTCATTGAATCAAATATTCAGTTTAAACCTGAGTGGAGAACATCTGTGGAGTCC
TACATCCCAAAACCTCAATCCATGAATGCCTGGGTAAAAAGTGTTTAGGTACTTAGTGAG
GTTTGAGTCACTTTGCTGTGAGGCATCTTTTTTATAACTGACTCAGAAATCATGTCTTGA
ATTGAAGGCCCATTCTCTAAGACTGCTATTCGACTTCAATATCAAGTGGGCCAAATATGA
ACATCACTGGGTGTTTGTGGGCCACACCAATTTTGGTGAATAATTGCTATAAATTTGTAT
GTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1248..1282, 1471..1520, 1695..1744, 1930..1978, 2170..2193, 2370..2414, 2733..2766, 3388..3461, 3693..3716, 3891..3933, 4049..4083, 4421..4470, 4725..4780, 5268..5308, 5485..5525, 5972..6025, 6262..6311, 6430..6476, 6561..6622
1958..1978, 2170..2193, 2370..2414, 2733..2766, 3388..3461, 3693..3716, 3891..3933, 4049..4083, 4421..4441
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved