Gasterosteus_aculeatus Locus RPL13
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus RPL13
Gasterosteus_aculeatus
RPL13
groupII
snoMBII-202
2858..2935
4931
AGAAATGAGTAAACATTCTCTCATCTTGCAGATGACCTTTATTACATCTTTCTGCGGAT
TGTGCCATGAGCTTTATCATTAAATCTTAATAACTTTGAATAAACTATGGCCCCGGCAGT
AGTGTGCCGCACAAAAGCAATTTGTCACCCCATGTCAGTGCTGTCCTCTTCTGATTCATG
CTCTTAATTAACATCCAAAGGAATGTTTTCTGCATCTGGTCATCAATCCAATCACATAAT
ACAAGTTTGTTCACTATATGTCATTGCTTCATGGATGGGTTTTGAGAAACTGGGTTATAG
ATATGTTAATCCTCCCCACTCCGACCTTCCAAAAACATGATACACATCATACATGTATTT
TTGAATATATTTTAGTAATTTAGTCCTTAAATAATATTTAAACAATAGAAATGACTAGTT
TTATTTATATTTAATATTTATCTCAGGTATCCCATCCCCCATGGAGTAATTTTCTTTGTA
TACTGGGTGGCACAAAGAGATCATTGGTAGTGTAATTGGAAGCCGTTAAACTGCCAGTAA
TCGAGACTACTGCTCATTGTGGGCGCGAGCACCACACCTTGTGGCCAGTGCAAAAACCTC
CTCCTGCAATTGGAAATGCAACTTTTGAACTCTAAATCATTAATGTACTATAAACACAAA
ATGGCGAAATCGTGAAATATTTCCATGGAACATTTAACTAAAAATACATAAGTTCATCAT
TGTGAATGCATAAAAAACATAATGTCAGAACGTCTTCAAGCAGGTGTGCACTGCATATTA
ATTAAGATACGTCATCAAAGGACGTCTAATAGAGGGGATATATAGATTTTCAGAGTATAG
ATTTCTATCAAAAGGATTTAATTGTATACTTCCTATTGTTAGATACGTCTTACTTTTGAG
CCGATGTTCTGAGGGGTTAATCCTCACTTATATACTCTTTGTTCACTTCTCTACGGTCAT
TGGCTGTTGGTCGGATATCCCACAATCCACCGCTTTGCGACTTCCTTTTTCCTTTCGGCC
ATTTTCCTCCCTACAAGGTACGATATTTTTTCTCCACATTTTCAAACTTAATCTCATCTA
ATCCTTGTTATTGTATAGGGATATATTCATTTCGATCACAACCTGAGACAGAGCGTGTTG
TGACCTTTGAAATAAGGTGATTATTGTCTTAAGATTTCCTTGGTAAATTACTGAAAAACA
TCCGTATAATTAGTGATCCCCGGTCGAGTAATGTTTGTGTGTGACTGTTAGCACACTGTT
CGAGGCCAAACTATGGCTCCATATTAAAATACGGTTCCATGAAATACAATTCAGCATACG
TAACGAATACCGAAGTGGCAAGTGCGAGAATGTTCCAGCACTCGCACACAGGAATTACGC
GAATGCTATCAAATCGTCCGCTAGCCTCGCTACCCTGCTAGCTTAGCATCGCATTTGTAG
CTTCGGGTCACCACGGTGCGCCGGCATGACATGACGCTCATGTCCGTGTGTAATGCTCTT
CTTGCAGGGTAGTAGGCAGCCATGGCCCCCAGCCGGAATGGAATGCTCCTGAACCCCCAC
TTCCACAAAGATTGGCAGAAAAGAGTGCGCACCTGGTTCAACCAGCCAGCCAGGAAGATC
CGCAGGTGAGAACTGTCCGCACGTCCCAGTAGAACAACAGATAAACTCACTGGTTAATGA
GAAAATAATGTCCGACTTGGTTGAACCAAATGTATTACGTTGCCAGTATTTTCTTTACGC
TGACATTATTAAATGGATAAGGACCGCGAACTATTGTAATGCCTCGTTTAGTTAAATAAC
GTGGCGCTTTCTGAAAGGCAGAAAGCTTATGCAACTGGTTCTAAAGCCATTTCTCTCAAG
TATCGAAGATATATTCAGTGTAACTGTTTTGATTGCTGATCCTGCTTGGATGTGACTGCA
TGATTTTGAGGGTGATATGTGAACACACGTTTATATTATGTGTTGTACATGCAGTCTTTA
CACATTAGTCAAACCACAGTCCCAACTATCCAACCAAAAGCAGCCGTTTTGTACTGCGTG
TTTGATGCGGATGTCTTTCTTTAGGCGAAAGGCTCGTCAGGTCAGGGCCCGTCTCGTTGC
TCCACGTCCAGCCGCTGGTCCATTGAGGCCTCAAGTCAGGTGTCCCACAATCCGGTACCA
CACTAAGGTCCGTGCCGGACGTGGCTTCACCCTGGAGGAACTTAAGGTAAGACCGTATAG
TTGTTGTTTGATCGTATTACATGCAGGGGTAAATAATCAGCAACGCCGCTCTTAACCATT
CATACTGGGAACTGTTTGATAACTATACATTCAAATCCAACACCAGAGGAAAGCAGTAAG
TTAACATCGTTGTGTATGCTGTTAGAAACCAGTTTGTATGTCTGCATGAACTAAACTCAT
AACATCTACCAGCAATTCCACTTAACGCATGTAGACCTGTTGATTGGAACAAACTCCATC
ACTCTGTGATGAATCATGCAGCTCACCCACCAGATAAACTCCGTAGCTGTTTCAAAAACA
AAAAGCTGCTCAAAGACTTGATATTCTTGCCAAACTACCTCCCATTCCTCCCCAGTATTC
AGCTGCTCTGGGAGAAAAATTAAATGACGTACTTAAAATGCTTGTTAAATGGTTGCACAA
ATAGACAGATATTTCTGTTAAGTAAAAGACTCTGGGATCAGAGTTCATTAAGTATTTAAT
CATTTTGGGTTGTAATATATTCATTGTGTGTTTATATACATATAGTTTGTCCTTGTCAAT
GCTGTTATTTGGTTAAAATGTGCAGTCAATGCACGGCTGTACGCTTGCAGTTGCACTATA
AGTTAGCATAACATACTCTTATTACAGCAGTCAGATGATGATAAAACTCCGGAATCTCTG
TATTTTCTTGATGAATACTTTGAACCCTTATATCTGATGACTGCTGTTTATTACTCAAAA
TGGAAAATAAAAACTGCAGTCTTCTCAAGTTTAACCCTTATGGTGCTGTGTTCACCCTAC
AGGCAGCAGGCATCCACAAAAAGACCGCTCGCACCATCGGCATTGCTGTCGACTCGCGCC
GCCGCAACCGCTCCACAGAATCTCTACGTGCCAACGTACAGCGTCTGAAGGAGTACCGCT
CCAAGCTCATCCTGTTCCCCAGGAAGGCTTCTGCTCCCAAGAAGGGAGACGGCACTGTAA
GTTACTGTTTCATATTGTTTAGAGGAACATGAAATTTAACTTCCATCCATTCTGAAAAGC
ATGTGGCACACTGCAGTGATTGTTGATGAGTTGTTTTATCTTTTGTGTGGCAGGAGTGAA
ATTTCAATAAGTAGAATTTTTAGCAGCCCGAGTGAAGGAGAGATGTTAATGTGCCTCACA
GTGTAATATTGATGCTTTTTCATTTCAATGAATTTTAACTGTCTTTTCAGGAGGAGGAAC
TCAAGATGGCCACTCAGCTTACTGGTCCAGTCATGCCCATCAAAACAGTACGTCTTTATT
CCTTTAAAGATTCCATCGACAACAAACACTTTGTTTTACATCAATGCAGTCAGATGATGA
CAAAACTCCGGAATCTCTGTATTTCTTTGATGAAACACTTGAACCCTTTTTTCTGATGAC
TGCTCTGAAAAATATAGTGGGAGGAGCTCAAAATATGTTTGGGTCTGTCAGCATTACGTT
GACTGGATTTTGTTTGATATAGGATTATTGTGCATAATGTGAAAAATCCCTCACGTGACG
TCTTTTTGTTCTCCCAGGTGTACAAGAAGGAGAAGGCTCGGGTTATCTCTGAGGACGAGA
AGAACTTCAAGGCTTTCGCCAGCCTGCGTATGGCCCGCGCTCATGCTCGTCTCTTCGGCA
TCCGCGCCAAGAGAGCCAAAGACGCTGCCGATCAGGACGTGGAAAAAAAGAAGTAAAAAT
GGTCTCTATGGAACTTTGCAAAATAAAGCGTTAAAAAGATCAATGTGTGTTGTGAATATG
AACTCCTTTTAGTTTTAAGTCAAAGATGCAAGATGTTGATTAAATGAAGCCGATCGGGTA
TTGAACTTTTAAAGGTGTAAACAGAACTGCGATGTAGATAATAAATGTGTTAAAATTGTT
TGGTTCATCTCAAACATCCAACACACCTGCTGCCAGACGTTAAACTAATGAATCCGTGGC
ATTTAGGTTCATCTCAGCCATTACCCCTCACTTCTGTGACAGGGGGCATCAAAAACAACT
CAGGACAAATGTTTAGGACATGTTTAGGAGCAAAGCTGGTGGCTTAAATCCTGAAATGAA
TATACCTCTACGGCGCGATCCGGTCTTGTTGCAGTGAGAATCACGGGTGTGAAGGACTAC
AGTGATGCCATAGTGACGTTTAAAACCGCGGTGAGGGAAGTTTTAAGTGATTGGTACAAA
AGATGAAAATACATTTTGTTCCTGCTCTCCGTACTTTAAAATTCACTGACTGACATGTTT
TGAACTGAAAGACTAATTTAAGTGGTTCATATCTGCAGCAGTAGGGGGCAATAGAGTCCC
AATGTACTGCATCAATGGAGTCATACAAGTAAACCACAGCAAGATTTATTGACTAAGAAA
ATTCTACGTTAATTTCTAAAATGTGAATTTTAGATGGCAACCCGATGTGTCTGTTCTTGG
CGCACTATTAAGCTGTGCATTGCTGGATCGATTTAGTGTCTTTTCAGGTATAGAAGGTAG
CATGTGAATAAAGTATTGATACGTATTACTTATACCAATTAAGAGGCATTTATTTTACGG
AACAAAGATAAGCTTTAGTTATACCGGATGTTATGTGCAGACGTGATGCAAAGCATCACC
ATGACAATGGAGAATCTGGACATTTTATAAAGTGCGCTCATGTTAAGCCTCTTATAGCAT
TCTGATCAATGACTAAGTTAACACATGCACAGAGAAACCATTCAAATTCAAATGTCCACT
TCCACAAATTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1507..1624, 2064..2205, 3002..3175, 3410..3466, 3737..3931
1521..1624, 2064..2205, 3002..3175, 3410..3466, 3737..3892
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved