Gasterosteus_aculeatus Locus Poly:4:SNORD18
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:4:SNORD18
Gasterosteus_aculeatus
Poly:4:SNORD18
groupXIX
SNORD18, SNORD18, SNORD18, SNORD18
1001..1066, 1245..1312, 2647..2713, 3575..3642
4642
AAGCGTGCAAACCATTTTTCTGATGTTGGATGTGTTGAACTAAACGGGCCTCACAGCGC
TGTGCAGTGGGTGAGTCACGGGCTGAACAATGGTACACTTACTCAGCTTGATTACAGCAT
TGAGTCAAAGATAATAACCAAGCTCTGAGCGGCTGCTGACGGTAAGACAGTCTGGTGGAG
CTCGTACGCAGAGGACGCCTGTAACAAAGTCTCGTCCAATAAATCAGGTGGGTCAATTTC
AATGTTCCAATGTAAAAGTGACTGGTGGCTATATGGATATCTGATATATTGTAGGTAATG
CGTACTTAACTGATATCGATTGGTAGATAAACCTTTTCTGAATACTAGTATTCCTGGATA
TGACTAACTGCCATCCTGACCTTGAAGGCATCGCAGTAGAACAAGAACCTCCTGAGGCGC
CTTCGCAGAGTTGCTGTACGACACTTGGCGTAAACAGTCACCTGAAGGCTGACTACAAGG
GAGTACTTAAGCCATCTCACATCAGTGAGCTTCTACTTTAGTCTGTGTTTCTGAATATCT
GATCAAGTTCTGAGTTAAAGCATCAAGACTTGTCATTTGACTATCTTCATAATGTTAAAC
GTCAGTTAAATTTGTAATGCCTTTTATTTCAGCGTGCCAATGCACGAGATGACCGACCTG
AGGTGAGGAGATCAGAAGGCTCTTCATACACCAATGTAAGCACTAACTTTATTGTACATT
TATTTTTACTTGTCAACCATGATGATGATACAACTTCGGTCCGTGTTGCTGAATCCTGAT
TGTATAGAAGTTCTGAGCGACACAAAGTTAATAACTAATTCGTAGTTGCGCAAGTTAAAT
TTTAAGAAGTTTATTTTGTCATTCCAGCAAGAAGAGCAACGAGTGCTGATAATGTTCAAA
CTGAACATAAGGTAAGAACCAAAACGTGTAGCCCTACATTGTAAACTGTTAGTTGCTGGC
TGAAGGCTGCAAAATAACCAGAGAAAATAAATTGTCAATCACATCAGTGATGAGCTTCCA
CTTCATGGTCTGTTTTTGCATCTGATACGTAAAGACGTTCTGAGTCAAAAAAATCAAGAC
TTGTCAATAGACTATTTTCATGATGTTCAACGTGAGTTCAATTTGTAATGCCTTTATTTC
AGCCTGCCAATGCACAAGATGGCCAACCGACCTGAGTGAGGAGATCAGGAGGCCCTTTGT
GCACCAATGTAAGCACTGTCACCTTATTAAACATTTATTACTTGTCAACTATGATGATGA
TACAACTTCAGGTCCGTGTTTCTGAATCCTGATTGTATAGAAGTTCTGAACAACGCATAA
AGTAACTCTTGTAGGTGCGCAAAAGTTCACAATTTACAGATTTTTTTTTAATTCCAGCAA
GCGCAACCAGTGCTGAAGAATCCTCTGAAGAAATTCATAATGCTCAAACTGAACATTTAC
ACTGACTCAAGGTAAGAACCAAAATCTGTAGACCTACAATGTAAATGGTGCTACTAGAGT
TAGAACATCAAGACTTGTCACTTGACTTTTCATAATGTTCGAGTTAAATTTGTAATGCCT
CATTTATTTCAGCCTGCAAATGCTCAAGATGACCAACGGACCTGAGCAGGATTCCAAAGG
GATCCAGAAGGCTCTTGGTGCACTAATGTAAGCACTGTCACCTTATTGTACATTTATTTT
TACTTGTCAACTATGATGATGATACAACTTCGGTCCGTGTTGCTGAATCCTGATTGTATA
GAAGTTCTGAGCGACACACAGTTAATAACTAATTCGTATTTGCGCTGAAATTTCATAATT
TTGAAACCTTTTTTGTCATTACAGCAAGAGGAACTTGAGGATAATCTTCAAACTGAACGT
GAGGTAAGAATCAAAACGTGTAGCCCTACATTGTAAACTGTTAGTTGCTTGCTGAAGGCT
GCAAAATAACCAGAGAAAATAAAATGTTGCCCATCAGTGATGAGCTTCCACTTCATGATC
GTTTGATGAAGCATCAGAATACTGGTCCATTGACTGTTTGACACAATGAATTCTATTTGT
AATGCCATATTTATTTCAGTGGCTGTACAAGATGAGCAGGATTCTAAAGCGTGAGATCAG
AAGGCTCTTGGTGCACTAATGTAAGCACTGTCACTTTATTGAACATTTATTTTTACTTGT
CAACTATGATGATGATACAACTTCGGTCCGTGTTGCTGAATCCTGATTGTATAGAAGTTC
TGAGCGACACAGTTAATAACTAATTCATAGTTGCACAGAGGTTAAATTTTAAGCAGTTTA
TTTTTTCATTCCAGCAAGAAGAGCAACGAGTGCTGAACTTGAGGATAATGTTCAAACTGA
ACAGAAGGTAAGAACCTACATTGTAAATAGTGTTACTGGCTGTAATACTACTGGTGAAAA
GGAAATCTTGCACATTAGTGATTCCACTTCCTGGTCTGTTTTTGAATATCTGATAATGTT
CTGAGTTAAAGCATCAAGACTTGTCATTTGACTATTTTATAATGTTCAACATGAGTTAAA
TTTGTAATGCCTCGATTTCATCCTGCCAATGCACAAGATGATCAACAGACCTGGGTGAGG
AGATCAGGAGGCTCTTCGTACACCAATGTAAGCGCTGTCACTTTATTGAACATTTATTTT
TACTTGTCAACTATGATGATGATACAACTTCGGTCCGTGTTTCTGAATCCTGATTGTATA
GAAGTTCTGAACAACGCATAAAGTAACTCTTGTAGGTGCGCAAAAGTTCACAATTTTAAG
ACTTTATTTTGTCATTCCAGCAAGCGCAACCAGTGCTGAAGAATCCTGAAGAAATTCATA
ATGCTCAAACTGAACATTTACACTGACTCAAGGTAAGAACCAAAATATGTAGACCTACAT
TGTAAATGGTGCTACTAGAGTTAGAACATCAAGACTTGTCACTTGACTGTTTTCATAATG
TTCGAGTTAAATTTGTAATGCCTCATTTATTTCAGCCTGCAAATGCTCAAGATGACCAAC
GGACCTGAGCAGGATTCCAAAGGGATCCAGAAGGCTCTTGGTGCACTAATGTAAGCACTG
TAACTTTATTGTACATTTATTTTTACTTGTCAACTATGATGATGATACAACTTCGGTCCG
TGTTGCTGAATCCTGATTGTATAGAAGTTCTGAGCGACACAAAGTTAATAACAAATTCGT
ATTTGCGCAAGTTAAATTTTAAGAAGTTTATTTTTTCATTCCAGCAAGAAGAGCAACGAG
TGCTGAACTTGAGGATAATGTTTAAACTGAACAGAAGGTAAGAACCTACATTGTAAATAG
TGTTACTGGCTGTAATACTACTGGTGAAAAGGAAATCTTGCACATTAGTGATTCCACTTC
CTGGTCTGTTTTTGAATATCTGATAATGTTCTGAGTTAAAGCATCAAGACTTGTCATTTG
ACTATTTTCACAATGTTCCACATGAGTTCAATTTGTAATGACTCTATTTCAGCCTGCCAA
TGCACAAGATGATCAACAGACCTGAGTGAGGATATCAGGAGGCTTTTTGTGCACCAATGT
AAGCGCTGTCACTTTATTGTAAATTTGTTACTTGTCAACTATGATGATGATACAACTTCA
GGTCCGTGTTTCTGAATCCTGATTGTATAGAAGTTCTGAGAAACGTTAATAACTAATTTG
TAGTTATGTGGAAGTTCAATTTTAAGGGTTTTTCATTATCATTACAGCAAGATGAAAAGT
GCTAATAAAGCATCGTGTCATACCGTCCAAAGAATGACCTCATGGTAAGGAACAACCATC
AAGCTTAAATTGTTTAATTATCACATTGTATCATGTTTCTCAAATGATGCTGGTTCTCTC
CATAGATAAGACCAAGATGCTGGAGCCTCTGGAGAAGGAAGCACCTGCAGAGCCTTGGAC
ATGTATTATATGTACATGGATTGTGATTTAATAAATTTCTCAAATGTATGAGTCATTCAT
GTAAATGGCAAGTTTCAGACTCAAGAATATTTATTTCACATGATCTATGCTAAAGAAATA
CAAGGCAAAGAGGAAGATCAAGCACACCGGTTGAGCAGCATTAGTGATTAAATTATTTGA
TCCCTAGAAAAAGATGGCTTTTCAGGCAGAGCTGCAATGTGGCCCCGAGACTTAAATACA
GAAGCTCACTTGGCATGTAGCTGTGTACAGAAAAAACAACTGAAGTGATCAGTATAAACA
TATATATTTTTACCAATCCATCATCCCTCACATTGCCGTGCTGTGGGTGGGGGTCACAGG
CTGATTGAGGCCAATGGTACTGCACAACCAGCCAGCAAAGTCCACCTGCTCTGCTTCAGA
CAGCTTGATGAACGCATGCACCTGGGGAACAAGGTGTACCGGTGTTACAAGGAACCATCT
GGGAATGAAGATGCTGCAGAGTAGGAAGTCTCACCGTCAAATGTTTCAGGTCCGCTCGCT
CTGCAGGATTCTTAATCAAGCTGCAAAGAAAACCGACTTTAGTGCGTGTTTCAACCAGCA
GGTGGCCGATGACTTTGAATTGCTTTGTTCTAAATACCATTTGTTCACAAAGTCTTGAAA
TTCAGCGCTGAATATCCCGGGCAGCTTTGGTGGAGGCTGGAAATGTAAGTCCAGTCAGCA
CTGAAGGAGGTCCGAGAGGAATC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved