Gasterosteus_aculeatus Locus Poly:10:snoR38
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:10:snoR38
Gasterosteus_aculeatus
Poly:10:snoR38
scaffold_151
snoR38, SNORD49, snoR38
1001..1074, 1307..1376, 1554..1623
2623
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCATCACG
CCGGAGTCCGGTCCTTTTTCTCTTGGCGTGGAAGTGTAAGCAGGTCCTCCTCCAGCGCTC
CGAACATGCAGCGGTCAGCCGGCACGAGGCCTCTCCGCCCGGCCGCGGACGAGCCGCCGT
GAACAGGTAACGTCACGCTAGATGAACTAAAGTAGACGTAGTAATTTAACGGGGCGAGGC
GCCTTCGTGGGAGTGGTGCTAGCTGCTAGCTAAGCTAACGCGTGGCGGAAGGCCGTATGG
CATGATCCGTATCCACTAAAGGTTTATTCCATTTGCAATGTGTAGAACCAGTAAACCGCA
TCGTCGGATCCACATGGAAGAGCATTTTAACGCGTTGACTTTGTTGCAGGACTCGTTGGT
CACTGTGGAATGAGGCTCCTCGTCCAGCCCACGTGGTCACGGCAAGACACGATGAAAGGT
AACGCCGACTGTGCGTTATTATTATTCTATCCTTTGCTCTGCAGCACACGTGATGATCTT
GTTATCCCTGTCTGAAATAACGCGTGCTGACATAAATTAAATCTGATGCCTGCTGATACC
TGACGCGTGCGCGTGGTCTCGCGCGCTGCGGACCGAACGTCACATTTAATGGAATGTCTC
GTCACGTGACAGGAGTGGATTTCAGCCTGGTGTAGTGGAAGACCGGAGCGGATCGTCCAG
ATTGACCCCCCCCCCTCCTCCAGCCAGCCCTACCCGGGGGGAGGGCGGCTTGAGGCCCTG
TGAGAAGGTGTGTACCGCCCGGGCCTCCCGTGAGCTCCTGCCTGGTGTTCGGTGATGATA
ACCTAGGAAGTGCCGTCCGATGCGATAACTGACGATGGAATGAACTGTTACCTGAGGAAC
ACCGTCACGCAGTTCGCTCGTGGTGGTGGTGGTGTTGTGCGCCGGTTACTGACTCGGATG
TACTCTTCTCACCCCCAGGGTTTCTGTCTGCAACGCGTGCGGATGTTCAAGACGACACGG
GGGAACCGAGAAGTTTCAACAGGTAAATGTGAAGCGGTGGAAGCGTGATGGTTGTAAAGC
CAGTGATGAAACAAGTTATCCCTGTCTGAAATTAAGTGATGATTTAAGGTAACCTGAGGC
TCTCGAACAAAGAAGCTGTGTGTTTGATGTCCATCGTTAAATGTTAATCTCACTTTTTAT
TCTAATTTGCAGATCAGATCAACGAGGTTGTGTCGACCAGTTTGGATGAATCCAGAACTC
TGCTGCCACGTATTGATGATTCATGGAGTAGACTGATCTGAAACGTGTTTAAATAAAGTG
CTTAAAACATTGGACTGTTTCAAATATTCTATTGAACTGGTTAAATGTTTAGAATGCAAA
CTAAATGTTCAGTTTAGACCACGTATTGTATGAACTATTAGCTTTTTAAAATTCGAGGTG
GGTAAACTGAATTGTGATTGTACAGACCTCGTAACTGAAGGCTGACTACTAGTTTAAAGT
CATGGTTTTAAAAGGCTTGCGGGTGATGCAGAGCAGTTCACCTCCAGAACAGGTGGAGTA
GCTCGTTTTTGTCGCATAAAACCTAGTGACGTCTGTGTGGAAGTCGTTGGATTTATCATA
GACTTTATTGCCCCCTGCGTCGCCGCTGATGCTTTTCATCGGACACATTTGTCCCGTATT
TACCTCCACAACTTTGTTCCCCTCGACCGGCGTTAGTGGAGATCTCCCTCCGTGAATCAG
AGGCCATCCGTGCGTCCTCATAGTTCGCCAATGACTGCTTGTAGAAGCAGTCATATTTAC
GCATTTCTTCCCACAAAAGCTCTTCAATCTAATTTGTTCTCTCAAACATTAGTTTTAATA
ATTGCAGTATTGTGCTATGGAAACTGAAATGTGAGACTCCGTAAAGGACTTAGACCAATC
GCAGCCTTGCACCTCCTCAGAATGACTTCCACGAGGGGGTCTTGTGTCTGCGTCGCTCTG
AAAACGCAGAAGTGTAAACTAGGCTTTAAGGCTGAATCCATGTGTGTTTACATGGATCCT
GTCTGGTTGCCCCACAAGGCACTGATGGGAGGGTCGTAGACCAATGATTCACACTACAGC
ATTTATGTTCAATATGAAATGTGACCATTTATTTCTGATTAGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved