Gasterosteus_aculeatus Locus Poly:9:SNORA18
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:9:SNORA18
Gasterosteus_aculeatus
Poly:9:SNORA18
scaffold_101
snoZ40, SNORA8, SNORA18, SNORA8, SNORA18
1001..1070, 1344..1481, 1738..1871, 2390..2527, 2853..2986
3986
TCTAAACGCGTGTCTCTGCAGGATGTCCGCATACAGCTGCCGGCTGTGCTGCGACCCGA
GGTGAGCATCACGTGCTTTCTTATAGGGGGGATTTTTCACATTTAGAATTAGCTACGTTA
TGTTGTAGATTGTTTTACGCTTTAATTCAATAAAGCTCTTCCTCAACGGGAGCAGCAGCT
TGTAACCAGAACTGCGTCGTGCGCCCGGTGAGAGCTCTGGTTCTGTCTGGTGGGCCGTGG
AGCTCACACAGTGCGCAGAGAGATTCGTTCCCTTGCAACCCACTGCTGTGCCCTCTGCAG
CAGTGTTACTTATGGGAATGGACAGCTGTTCGCTTACAAATAGTTATGTTCCCGAGTGCC
GGTGAATACACTGATTTATGAACGTGCAGTCAAGACTTTTCTGAGATCCTCTAATGGCAG
AAGGCTTCTTCTACCAGGTGATCTCTTCTAGGCTGCGGATGATAAACTCATCAATAAGAT
GCTAAAATGTAGCAGTTGGGCTAACTCAACTTTTGTGTGTTTGTTCACTGAGAGAATAAA
GTTTTATCACAAATCATGTCAACAATATGATTTTCAAATTTGCATTAAATGTTAAAGCAT
CTCTGCTTATGGCAAACTTATTTTAATTTAGGCGAATTATGCAAATATTTAGTTTGTTTC
CAGCTTTGAATAGTTCCAGAATTTCGCAATGCTACCTGACTGTAAATGAGGAACCAGGAT
TGTTTAAAAGGCCGTCCATTGTCTCTAATGGACTCAATGTTCTGCTGAACCACTCAAGTT
TTCCAGAGCAGATTGTTTTGAATGACACCTTCTGGATGGGGTTCAGATGTTCAATTATGA
CTTTTCGGATTAATTTATTCCATGTGGCTTTTAGCCTGTCAGTGTTTTGGGTTTCAAATG
AGTTTCTTCACTGGGGATTGAAGTTTGTCTGTTCTTCTCTCTCAGGGATTGTGGACCTGA
GGCCGGCTCGGTAAGTTGAATATTCTGCGAGACAACCTCTTTGTGTCATGATGATCGGCT
AAATGTTCAACTGCTCTGAAGTGTGATTGACATCTGCCTCTCTGAACCGCATGCTTGCGT
ACTGATGAGTATGTGGGTTCCTCTAGAACATGTGGTCACCTCCCTCCTCCTTTTTGCAGG
TTTCCTCCCCGCACTGGTCTTCTGACTGATTGCTGTCATGTAAGTTCTGAGGCTGTGCGT
TCTCACTTATTTCCATAAAGCCAACCTGCTTAGTGGGTGAGCGACCAACAGGATGGCAAA
CCAGACGCATTACGTGGTGTCTTCAACTGGCCACAATAAATAGTGACATTTCTAATGGCT
GCGAATTGACCAGAATACAACCAAAGCACTGTGTGGTATCTGCAGCCAGTTGGTTCCTCA
GCCGGTTTGTTCAAAAGTCAGTGCTAGAACAACTCAGCGTCTGGCATCGTTGGTCTCCAT
GCTGCCTGTGTGTGGAGTCCTGGTATGGTTGTTGAGACACTACTTAACTAGTCAATGTAT
CAACTTAAGTGACTCATTTTATTGTGTTGACTTTAAAAGTGTTGTCTTTGTAGAAATGCA
GCTTGTTGTGCCATTCAGTTGCACAACAAAGATGTCCTTGTGTGTGGCGGATTAAAACTT
GTCTAATGGACCATTGTTTTGTCTTGTCCCAGGTTCCTGCTGCATGAAGGCTTGCATCCA
TGTACCGTACCAGGTATTCAGGCACTCAGGTTGGTTGAAGCACTTGGCCGATGGTGGAGC
TGAGGTCTATCCCGACGGGCCTTTCACTGTAGGGCCATGTCGTTGGAAATACCTCACACA
GTAACTCTGTAGTATCGCTTTACCCACATGTTCACTGCCATGAGCATAGTGAGATATAAC
TGCAGAACACGAGTCTCTCCACAAACCCCTCAAAGTCCTGCAGTTTGTTTAGTTTACAAT
TGCCTGCACACGGCGGCGTTCTGCCCTGACGGGCGCATACAGACGTGCACGCAAGCCCAG
AGCTCATTGCAAAATGAAATGTTGGCCTCTGCTTTTGGTGATGAATAAGCCTTTTAATGA
TATAAGTTGAACTTAATTTAAATGATTTGGATACCAGCGCTTGTTCTAATGGTAGGGCAA
ACGCTCAGTTGGTTGTGTGCAAGATGTTAGCATTAACTTTTAGTAAAGGGGTATAAATGA
TTCAAAGATTAAGAGTTTGACCTGTTTTGGAAAATGTTTTCAAACTGAATTTTCTGTCTA
AAGGAGTCAGCTGAGGTGGTTTGGGCAGCTAACAAAGATTCCTGATGGGCGCGGCTCTCC
AGGCAGGACATGCTGAAGGGTTCACATCTCCCACTGTGATGGCAGACTGAGTCTCACAAG
CTTGTGTGGTAAGAATTTTTTTCGTTCTGTTTTACCTAGTTGATGACAAAAGCACTGTGT
GGTATCTGCAGCCAGTTGGTTCCTCAGCTGGTTTGTTCAAAAGTCAGTGCTAGAACAACT
CAGCGTCTGGCATCGTTGGTCTCCATGCTGCCGGTGTGTGGAGTCCTGGTATGGTTGTTG
AGACACTAAAGTCAGTTTTAATGCAGCATTTGTGTAATGCTCATCAGGCACTCCAAGGTG
TCTTTAGTGCAGTGAGCAACATTTTTAATGGTGTCGTGAGTAGTCAGTTACTGCTCAATA
CACCCACAGTAAGCACAGTAGTAGTAGTAGTGTTTGCTTTAAAGGAGCTTTCATGCACCT
CTAGTCATGTGTTCATGATTGAGTACTGAGAAAGCGATCATAGCGTTTCTCACACAAGCC
TTTCGTTCCTCTAGGTCTCTGCTGCTCCCTGCAGGTCTCCAGTAGGCGCTGACTAGAGGT
GAGTGAAGTAGTCTGGTGGTGGTGACCCGTGGAGCTGAGGTCTATCCCGACGGGCCTTTC
ACTGTAGGGCCGTGTCGTTGGAAATGCCTCACACCGTAACTCTGTAGTTTCGCTTTACCC
ACATGTTCACTGCCATGAGCATAGTGCGATATAACTGCAGAACACCGCGGCGTCTTGTGT
AGTTGACGGGCTACATTTCCTTGCAGGTCTAAAGTCTGGGAATATTGTCTGAGTTAAAGA
TGGGTGATTTGGCTGAAATTCCAAACTTTTTCCAGAATTGTGGAAGCTTCCTGGAGTCGT
GGCGTGAACAGTACCAGCAGCCTCTTGCAGTAAGTAGTAAAAGCTGTGTGCTTTAGTGGT
TGGTCATATACCAAGGCTCTCGGGACTCCCCATTCCTGATCTGCTGTGGAATTGACCAGA
AAACAAAGTCCATCCCACTGGGCTTCTCCAGCAGCCTGCTGAGATGACCTGCTGGGAACA
AAGTCTCCTGTGTTTGTGTGTGTGTGTGTATGTGTATGTGTACTGTGAACATGGTGTTTA
ACTCACTGATGACAACCTAAAAGCTGGACTGCATGTTTTCTATTTGCAGGTTGATGGTGA
CGTGACATCGAAGCTGCCACCACTTTGTTGCGTAGAGGTCATTTGAAGTCAGTCTATTAA
TAAATGCAAATTAAAGACTCAGAACTCTTGTCTCTGTTCTATATGAAATGTGTTATTTCC
CACGTATTAAATCACTCGAGAGCTTTCGGCACTGTCGTTAAGTGTTTTTCTTTCTTTTCT
TAAGCATCTGAAAAGTGGTGCCTTAAAGCCAACCAACGTTTCAAACGTGTTGGGTAAAGG
TCATGAGCAGCTGCTGTAGTGGCGCAGTGCCTCCTTTAGTGGGCAGTGTACCGATTCTTG
CAGGAGGACCACAGCATGTCTGCAATAAAGAGGACACATCGATGTAGCCTTTGCAGGCCA
ATAAAGTTTTTAAAGGTTATTTTTCAAACTAAAACATTAAGTTGACTCCGGTTTCTAGTT
GGTATCTGATGGGATTGTAAATACAACTGTTAATTTAGTTTAAAAAGAATGCCACCTCAA
GGCCAGAGCTGCAGTCATCAGTCTAATGGATCAACAAAATATCCCAACCCACTTGTTTTT
GTCCTCACAGGATGTGCTCTGCTTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved