Gasterosteus_aculeatus Locus Poly:0:SNORD14
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:0:SNORD14
Gasterosteus_aculeatus
Poly:0:SNORD14
groupVII
SNORD14, SNORD14, SNORD14, SNORD14
1001..1093, 1309..1402, 1584..1677, 1829..1922
2922
TTCACATTTATTTGTCAATATCGCCTCATTACTTTAGGTGGAATGCAGGATTTAGTTTT
CCCCTCTGCAGTACATCGAGGCACCGCTTGGAGTGCTGCTCACCCGCGAGAAGCTCCACG
TCACGTGGTAACGGCTCCGCCTCCTGGCCGCTGGGTGGCGGTGACGCGCCGCCGGGCCGA
TCACGAGCCACCGGGACGCGATAAAAAGGAGCGGAAACTGCCGCTGGTTCATTTCAATCC
GAGGCAGCGGAGACGCGCGCGCGGCGAGTCTCCTCGAGGTAAATATATCTTCCATTTAGC
GCGTTTCCTCCGTAAATAAGACGCCTGAAGGGTTCCTCACAACGCGGAGGAGCTCTAGAA
CATGAGGTTCGACACCGACGAGGCGCCATTGTTCAGGATGGTCGAAGATTCAAAGCTCGT
GCAGCTCGCAGGCGTCGACACGTCGTACTTATCTGCACTATTAAAGCGGTTTATTGGAGG
CAAATCTGCTTCACAGGAAGAGCATTAAATAGTTAACGCGAGTTATTAATCAAAAGCCTT
CGTGGTGAACTCCTTTAAACGTGTATTGAGTCATATTGCAATTCTGCGTTGTGTTACTGT
TGGTTACTGAGCCCTTTATTAAAGTGTCCTTTTCATCAACATCAAAGGAAACTAAATAGA
TTTATAGTGAGCCAGTCAATGTTTCACTTCCGGAAGGTGACCACGTGGTTGATGGTAAAA
CATTGAACTTAATACTTCAGTGAGTCTTAATGAAGCCAACGTTATTTGTGCATTCGTCAC
TTTTCTACTCAATTAAACTGGTAAAACTAAAAATAAAGCAAATGTAGAAGTATAACAAAC
TTATAGCGTCGATACATTAAACTGACAGTGAAATCCTCGTTTTGCATTAGTACAGTGTAT
CGATTTTAAATGCTTTTGTTTATATTTATATCGCCGATACTGTACTGTGACTGCATACAT
GTAACATGTGTTCTGTGGTAGTATTACTGCATAATATTGCTTCGCTGTGATGACGTCATT
TCCTGCCATTCGTAGTTTCCACCAGAGGTCAACAGACCGGTGACGGTCCAAACCTTCCTT
GGATGTCTGAGCGAACCTGCAGCAAAGAGAACATTGTCTAATTGTTGAGATTCTGCTTCT
TTCGATCGTTGTGTAACTGTGAATGTGGTTGCAGCCGTGGCCATGAAGACCTTCAGGGCG
CCGTGAGGAGACCAGGAAGGATCCTCTGAACCAGGAGACCTGTGAGTTCTACTTTATGGT
CTATAAAGGTCATGCAACTCCAAAGAAACTATATCCTGAGTTAAGCGCTTCGCTGTGATG
AGGTCATTTCCTGCCATTCGTAGTTTCCACCAGAGGTCCAACAGACCAGTGACGGTCCAA
ACCTTCCTTGGATGTCTGAGCGAAGAGCAGAGCTCCTTTTTGAGGAGTTCCTAAAGTCCT
CATGTTCTAACCTGATGTCCTCCTCCAGGGTCGACGTCTCTCTGGACAAATGGAACCCCC
CTGTGATCAACCAGTGATGACGACCCGTCGGCGCCGTGGGGCAGGTGTGTGTTCCACGGC
TTGTGCCTCGTGTTTAGCTGTTAGTCGCTGTGATGAGGTCATTTCCTGCCATTCGTAGTT
TCCACCTGAGGTCCAACAGACCGGTGACGGTCCAAACCTTCCTTGGATGTCTGAGCGAAC
CTGCAGCAGGGATCACATGCTAGTCTGTCGTTAGCATTGATGCTAACATGTCCCGTTATG
TCTTCTCAGGGTGACCGTTCGACGCTGCGCCGATGCTGCTCGTCTGCTGGTACGTGAACC
TTTAACTCAAGTCTATGAATTAAAGCGCTTCGCTGTGATGAGGTCATTTCCTGCCATTCG
TAGTTTCCACCAGAGGTCCAACGGGCCGATGACGGTCCAAACCTTCCTTGGATGTCTGAG
CGAAGAGCAGAGCTCCTTTTGATGAGTCCTAAACATGCACGCGTTCTAACCTGATGTCCT
CTTTAGGGGCGACGTCTCTCTGGACAAATAACCTCCCCCGGGGCGACCAGTGATGACGAC
CCGTCGGCGCCGTGGAGCCGGTGTGTTCTACAGCTTGTGCCTCGTGTTTAGCTGCTGGGC
GCTGTGATGACGTCATTTCCTGCCATTCGTAGTTTCCACCGGTCCAACGGGCCGATGTCT
GTCGAAGCTTCAACTGATTCATAAATAAATAATAAAGACTGCAAAAGTTCAACATTTCCA
TTTTATTCTCCAGGCGTCTTCATTGTGTAACTTTTCTGGCTGTAGAAAAGTAACTTTAGG
ACCGAAGTTTACCTGCATGGGAGGAAAAGATTATTCAATTTGTCATATTAAATATGCCTG
AGAACTCAAATGTTTTAATTTGTATGTGCCATGCGATTTGTCTCTTTAATCTGATTACTG
GAGATTTGCAAGAGCTCTTGGTCCTTTAGGACAACATTCAGTATTTGACCAGCTGTGTGC
CGAATGATAAACCTGTTAAAATTTAAGGTGCTAATGATGGATGGAACGTTGAGTTTTTCC
ACACCAACCAAAAAAAATTCCTTGTTTGGCAATAAATGTTTCCTTTCAAATGTATTCCCA
TCGTAGACATTATATTCACAGTTTAGTGTAAACCTTCCATCGATCCATAAAGCTGATCAC
TTCATTCCAAGACTCGGTTATTTATATTGCAACAATTTCTATTAATGGTGCCTTTTTAGG
GTTGCATCTTTTCCTACTATAAAGCCTTCGCTTTTTACTCCCCGCTTTGACCCTGCTGGG
ACGCCGTCCTCCTCCGCTGCAGTCGGAGCCGTCAGAGCGGTGCTAGCCGTGCTAGCTGTA
TACCGGGGCTAGCCCAAACGATGGCGGGCGTGCAGCACCAGGTGAGTACGCCGAATTCAA
TGCCGCGCACCCGAACAGGTGCTTTAATCGCCCGAATTAGCAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved