Gasterosteus_aculeatus Locus Poly:7:SNORD75
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:7:SNORD75
Gasterosteus_aculeatus
Poly:7:SNORD75
groupVIII
SNORD75, snosnR60_Z15, snosnR60_Z15, snosnR60_Z15
1001..1062, 1713..1796, 1946..2029, 2183..2265
3265
GTTTGAGCTGTGACGCTTCTTTAAGACAAGCTGCTTCTCTGTCCATTATTGTGGTCAAG
TTTTCCTTTTTAACGGAAATCTTAAAACTCAGGCCTCGCCCACGTGACTCTAGTTATCAA
ACTAACATTAACATTCGCAAATCCTCCGTCTCTTTAAACGAGAATAACCTTGCCGGAGCT
TTTCCCCCGTGACTGAATGATGAGAAAACATGTTGGTAGGGACATCTGATTTACTGTGAC
GAATACCAACTTTCTTCTCCTGACTTCACGGGACAAGGCCCGAAGCCGGTTGGGCTCCAC
GTTAGCTGCGCTGCTAGCGAGCGTTTAGCTGCTGCGTGGCCCGACCGATGCAGATGTGTT
TTCCTCAGTTCGGCTTCATTCATCTTTAACTAATAACGTGCCTTTTTTTTCAGGTTGAAA
AAGATGTGCCTCGACGTTAGTGGGGAACCACGCTGCATACCGAGCGGGTGAGTCTCAATA
GTTTGTCCGTCTGTATTTAGAATAGTGGACAGATGTCATTTCTGGCATTCAGCCCTGAAA
CTTTTAGATTAAGCTATACACGTTTCTGATTTTCCCATAACGGAAATCTTGCACTCTAGC
ACGAGTCACGTGGTGGAGGCCTGCTATCAAACTCCCATTAGCTAACCTCGCTCTTTAACC
GAGCCGAACCTTGCTGGAGCTCTTCCGTGACTGAATTAGGAGAACTTGTTGGATGTCTGA
TTTAAATGTGACGAATGCAAACTTAATTCTCCTGACTTAATGGGACGAGGCCCGAGGCCG
GTTCGGCTCCTCGTTAGCTGTGCGGCTAGCGAGCGTTTAGCTGCCGCGCCGAATTGATGC
CGATGTAATTTCATCAGTTTGTTGCCTCGTTAATTTAACTGTATAACGTGCTTTTTTTTT
TTCCAGGTTGAAAAAGATGTGCCCCAACTTTAGTGGTGAACCACGTATCATACAAAGCTG
GTGAGTTTCCCCCCCACCATCCCTGAAAGATAGTTTGTTCAAGTCTGTGATGCATTTAGA
GTAGTGGACAGATGTGATTTCTGACAAATTCAACTCTGAGACTTAAATTGAGCTATAAAA
GTTTCTCTGTGACCAGCGTGGTGCTGAACTGTTTGTTTCAACAGGTGTCTCGGAAGTTGA
GAGTCGTGCAGGAAGCAACAGTGGGAGCAATTGCAAAAAAGGTACGGATTACTTTAATAT
CTAGACGGACTTTTGCTTCTCTGACATTTGGAGAAGCGTCAGTCTGCCTTTATCCTGCAG
TGTGCTTGTGATGCCATTTATTTGCTACTCTCGACAACATGGATGACGATACTTTCAACC
CACCAGTTGACTTATCTGAGGCACCAAGCTTGTTGCCTTCAGGTTAACTATTATTATTTT
GTTTGCTCATCACTTGTGTTTCTGCAGGTGTGCCTACATTTTGTTCACGGATCAGTGATG
GGTCCTTATAGCAGGTAAGGAACTTTCTTTACTTTCTTTTTTTTAAACAAACTGTAAATG
ATGATACTTGGGAATCTCTCTGAAAAAAGTGAAAGACTAACTTTTTTTACTGATACAGAA
CAGACTAAAATGCTTACATAAGAGAATATGGGAGTGTTTACTCATCCTTAGTTTTAACTT
GCAGGTGCCCCCCCCCTCGACTTGCCTTGGGATGCCTTTCCTCGGTTCACGGTGAGTGGC
TTTGTACTTGATTGAATGTTTGATTACAAACGTCTGATACAATGATGAGCGCATAGTTCA
ACAGATTAACAATGACGATCATGCGTTTTTGTCTTTCGCTCCTATCTGATGTGTTGGCCT
CAACCACCGGTGAGAACCTGTTGTTCTAAACACTGTTTAAAAAAAAAAAATCGATATTCT
TTTTCAGAAATGTCTGATGGGAACACATTGCCGTCCTCCAAATTGAGGTGAGTGCAGGTC
CTCATCTGGGATCAACAGCCTGGTGCTTGATACAATGATGAGCGCATAGTTCAACAGATT
AACAATGACGATCATGCGTTTTTGTCTTTCGCTCCTATCTGATGTGTCAGCCTCTGCCAC
CAGTGAGAACACCAGTTTTAAATGACGTTTTTAAAATATTCATGTTCTTAATTTTCAGTA
ACTTCAATGCCAGGAGCTCACCACTGCTATCAGAATTGAGGTGAGTGAATTTCCTCGCCG
GTGATGAACAAACCGTGTGGTGCTTGATACCATGATGAGAGCATAGTTCAACAGATTAAC
AATGACGATTATGCGTTTTGTCTTTCGCTCCTAGCTGATGTGTCAGAGTTGTCATTTAGT
CCTGTGTGATAAATACAAGAGATGCTCACAAGTCTTCTCCTCCAGCCAGAAATGTGAAAC
CCTCCCGCCAGAAGATCTTTCAAGACTTTGGTAAGATCATCTAATGGTTCAGTTTTCTGC
AGAAACTATTATTCAGATGTGATGAGCAATAATCAGGTCTCCGATATTTTTGAGGAAGTA
ATTTAATCTGATCTGGATTGTTTTTTTTAAGAACTTTTAATTTATTTTATTCATATTAAT
TTACACAAAGCTTCTTACAGGTGATGTCGCTTGTTGGCTCTTCCAGAGGACAACATACCA
GCAGAGTGAGTATGAGAGTGAACCCACACAGACTCAGACGACCAGGTTCAGGTGGTATAG
AATCAAACAATAAGGTGGCAATATATTAGGCTAATGTCCACTTCCCATTGACCACTGAAC
TCTCCTCTGAGTCTGGACGTGCTGCCAATGTTGACACCTGTGATGACAAAGTTAAGACTG
ACCAATCCATGAAGTCATGTTTATTAGCTCTAACTGACCTGGTCAGTGTGAGTTAGGTTA
TCCTATCCCAAGTTGTGGGCATATTTGACTCACTAATTTCTATTTTCAGGTGTGACTGCT
GACTTTAAAGGCCTTTGACAAGATCAGTTTAGGTGAGACCAAAAATCCTCCAGTAAATGA
AATTAGTGACTTGGGTTAAATGATGGTTTACCAAATGTCTGGACTGAACTTCTATGTGGA
TAATTTATGTTGCTGACTAACCCAGTAAATGTACTTTTCAATAAACGAGTCATTGAATTC
TAATAACTACTATTTGTGCATCCATCAGGAAAGGGCTTTTCCTCATCATAGTACCAAAAA
ATGGGCTGCCTCATCATCCATGGTAAGAATTTTAAGTCTCTAGTCTCAGTAATTCCTCCA
CTAGACCTGTGATGAAAAAGATTCTGCCAAATGATCTCATGATTATACTCCTTCCGTTCC
ATTTTTTCCTGAGGCAATGTAGTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved