Gasterosteus_aculeatus Locus Poly:2:SNORD31
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:2:SNORD31
Gasterosteus_aculeatus
Poly:2:SNORD31
groupVII
SNORD22, SNORD31, SNORD31
1001..1127, 1797..1864, 4863..4932
5932
TCATTCTCCTTGGCTTAAAGACAATGCGACATAACTCTGCAAAATCAATCAACTCTCTT
CTAAACCCGATCTCTTCCCTGCAGATGTTCATGGCTGAGCAAATGTGAGGATCAAGAATG
AAAGACGACAGGTGAGCCTAACTGACACTAGAATTAACTCCTTCACCAAGGGACACAACT
GATTCTAGAAGACAAGCATATACCTGATATCAGTGATGCCAAGTTGTAATCTGATCAGTC
CATGGAAACCGTCAATCTCGGGTGTAGGTCTCAGTTTATGGCTAACTGGGATGTCTCTTC
AGGTGGTCCTGCAATGTTCCCATAATGAACTCTTCCAATGAAGAACACAATGGTGAGTAA
ACCCTCGTTCATTCATTCACACACTGGTTTGGGGTTAAACATGATGAGTATACTTATTGA
CAAGCATATGCCTGATTTCTGTGATGTCAGCCTTCTATCTGATTGCCTTTATTTAAATAA
ATTGCTGTCATTTTTATTAATGGGATTTATAGAACTGGATTTTCTTTTTCCTGTAGGTTG
GTGTCAACCAGTGTTTGAAAAAGGATGTCACCAAGAAGCAATCCTGTAAGTCCAGATTGT
GTTGACAGTGGATGCTTCCCATCACAACATGCCAGTTAAATGCTGCTTCAATGATACTTC
TAGCTCACTTTGATACTGCACTGTAGTGTTTTCTAAACCGGGTTAATCAAACCACAATAA
AAGTCATCCTATGAAACTTCCTTTTGATGGAATTGGAGGAATGCCTCCAATGGCGCTTTG
TTTTGCTGAGAATGATGAAATATTTTGTCTCGTTCGTCTGAACTACTGTTGACAAACCAA
ATCACTGACATCAGTAAACATCAACCAACAATAGTGGAAGTCTCTTTGTGCTCGGATCTG
ACAGTTGTCTGTTGCAGGTGACTGACTTTGAAAGATGATGCCAGCTTCTTAACCTTTGTC
CAGGTGAGTGATCTAAAAGTCTTGAACCTCAGATTTAGTTTCCTTTGTGATGACATCCGC
ATACGTCTTACGCCTCTGTTTAACGCCAGAACCTGTAAAGGTGGACCCACTGGTGTTGCC
TTGGCAATAAGGGGAAGGAAAGTTGGTGTCGCCAACAGTCTGAATGGAAACTTTAAACCC
GCATGTAACTCAATCCAGTTGTGACTGTGCTGCTAGTAGATATGGGGATCTGAATGCATT
GAACTGGACCTTCTTCTGATGCTGCTTGATGAACTCTGTAGTGAAAGTGACCAAACATTC
CCTGTCTTTACTCTTTAGGATCGAGCTGCCTGACGAGCAAAATATGGATCATGGTATGTT
TGGATCTCAACCACCAGTGAAAATACTATTGCTTGTGGTGTGATGACCTTGAGTTCCTTT
ACAGTCATCCTCCCCCTCCCGGTAACACACTCTCTGCCTACCCATCAGACGCCCCGTTGG
CCCGGTAAGACACTGAGAACCCTGAAACAAGCTTTCAGGTGTAAGGTGATCTCCGGCTCC
CTGAAGGGCTCTGATGGTGGATAGTTTGTTACTTTGATGTAATGACTGAAAAAGTTTGCT
GACTACATTCCTTAACAAAAGTTCTCTGCACAAAGATAATTGAAAGAGAATAATTTTTAT
TTTCTTTTTCTAGATATCAATCTTTATGCTGAACTGAGTTAGAAGTCATCAGGATTGCAG
TGACTTGTAAGTTGTCTTGTGAATCTTAACTCTGCAAATAAACACAAATGTTGCTTTAAC
TTCATAGCCAGTGAGCGTAGTTTGTAATAAAAGGAAACTAATTTCGTCACTATGCTCATT
TTGATGTGATGAGTATTACCGCCCCAGTCTGAGAATTCATGACTGATTGGTTACTCTGAT
CAAATTAGATGTGTGACTTACTTGCACCACCTTCCATAGACTGGATTGTTTAAATTGTGT
TTCTTGTTGCAGGAATGGTGATTGTTAGTCTGCATAGTGGAGACACGAACGAGTCTTTAA
AAAGGATGTCACCAAGAAGCAATCCTGTAAGTCCAGATTGTGTTGACAGTGGATGCTTCC
CATCACAACATACCAGTTAATTTAAATGCAGTTTCAATGATGATACTTCTAGCTCACTTT
GATACAGCGTGAAACGACATGAACTTCTGAGCGACTGCACTGTAATGTTTTCTAAACCCG
GTTAAACAAACCACAATAAAAGTCCTCCTAGGAAACCTTTTGATGTGCAGTAAACTTATT
TGTTTCTCCTACAGATGATGGATGTTGTCGGAAACGGTGAGTTACACTTTTAGAGGAATG
CCTCAAATGGCGCTTTGTTTTGCTGAGAATGATGAGATTTAATCTCGTTCGTCTGAACTA
CTGTTGACAATCCAAATCACTGACATCAGTAAACATCAACCGACAATAGTGGAAGTCTCT
TTGTTCTCTGATCTGACTGTCTTCTGTTGCAGGTGACTGACTTTGAAAGATAATGCCAGC
TTCTTAACCTTTGTCCAGGTGAGTGATCTAAAGTCTTGCGCCTCAGAATGAGTTCATTGA
ACTGGACTTTCTGATGCTCCTTGATGAACTCTGTAGTGAAAGTGACCAAACATTCCCTGT
CTTTACTCTTTAGGATCGAGCTGCCTGACGAGCAAAATATGGATCATGGTACGTTTGGAT
CTCAACCACCAGTGAAAATACTATTGCTTGTGGTGTGATGGAATCGGTGACACCAGTCAT
GCTCACCCTCCCGGTAACACACTATCTCCACCTACCCATCAGGCGCCCTGTTGGCCCGGT
AAGACACTTAGAACCCTGAAACAAGCTTTCAGGTGTAAGGTGATCTCCGGCTCCCTGAAG
GGCTCTGATGATGGTGAATAGTTTGTTACTTGGACGGAATAACTGAAAAAGTTTGCTGAC
CACAACAAGTACTACTTAGCAAAAGTTCTCTGCACAAAGGTTGTTGAAAGAGAAGATTTT
TTTTTTTTTTTCTTTCTAGATGTCAACCTTTTATGCTGGACTGAGTTAGAAGTCATCAGG
ATTCCAGTGACTTGTAAGTTGTCTTGTGAATCTTAACTCTGCAAATAAACACAAATGTTG
CTTTAACTTCATAGCCAGTGAGCGTAGTTTGTAATAAAAGGAAACTAATTTCCTCACATT
GTGCTTCCTCTTGGACACCCAACTTTACACTCTGCTCCTTTTTGATGTGATCTGATCAAA
CTAGAAGTGACCTGCTTGCACCACCTTCCATAGACTGTATTGTTTAAATCTTGTTTCTTT
TTGCAGGGATGGTGATTGTTACTCTGCATAGTGGAGACACAAACGAGTGTTAATTGCTGC
AGGTAAATGAGAACATTGACTTGTTTTTTCATGAATTTGGTTGCTGTCAACTAGTGTTTG
AAGCAATCATGCAAGTAAAGACTTTGTTTACACTACAATAAACTGTCACATTCACCAAGG
GACAGAACTGATGATTCAAGAAGACAAGCATATACCTGATATCAGTGATGCCAAGTTGTA
ATCTGATCAGTCCTTGGAAACCGTCGATCTCGGGTGTAGGTCTCAGTTTATGGCTAACTG
GGATGTCTCTTCAGGTCGTCCTGCAATGTTCCCATAATGAACTCTTCCAATGAAGAACAC
AATGGTGAGTAAACCCTCATTCATTCATTCACACACTGGTTTGGGGTTAAACATGATGAG
TATACTTATTGACAAGCATATGCCTGATTTCTGTGATGTCAGCCTTCTATCTGATTGCCC
GTAGTTAAATAAATGGCTGTCATTTTTATTAATGGGATTTATAGAACTGGATTTTCTTTT
TCCTGTAGGTTGGTGTCAACCAGTGTTTGAAAAAGGATGTCACCAAGAAGCAATCCTGTA
AGTCCAGATTGTGTTGACAGTGGATGCTTCCCATCACAACATACCAGTTAATTTAAATGC
AGTTTCAATGATGATACTTCTAGCTCACTTTGATACAACGTGAAACGACATGAACTTCTG
AGCGACTGCACTGTAGTCTGTTTTCTAAACCGGGTTAATCAAACAACAATAAGTCATCCT
AGGAAACGTTCTTTGGATGTGCAGTAAATGTGTTTGTTTCTCGTACAGATGATGGACTCA
TCACCATGATGGATGTTGTCTGGGAAATGGTGAGTTACACTTTTAGAGGAATGCCTCCAA
TGGCGCTTTGTTCTGCTGCGAATTACATATTTTGTCTCGTTCGTCTGAACTACTGTTGAC
AATCCAATCACTGACTTCGGTAAACATCAACCGACAATAGTGGAAGTCTTTGCTCGGATC
TGACAGTTGTCTGTTGCAGGTGACTAAAAGATGATAACGGTTAAGCTGATGGCCTTTGTC
CAGGTGAGTGATCTAAATCTTTCACTGGAGCATTAGTTTCCTTTGTGATGACATGAGAAC
CTGTAAAGGTGGACTCACTGGTGTTGCCTTGGCAATAAGGGGAAGGAAAGTTGGTGTCGC
CAACAGTCTGAATGGAAACTTCAAACATGCATGTGACTAAATCCAGTTGTGACTGTGCTG
CTAGTAGATGTGGGGATCTGACTGCATGATGTAGACATTCAGTTGTGTCGACGGGCACCG
CGTTGTCCTCCAGTCAGCCTCCCATACTGTTGACTCTGTCACCGAGAACCCTGACAACCT
CCTTCAGGTCACGGAATATACAACTATTACAGATGTTTGTATAGCTTGATGTTAATACTT
ACATAGAACTGTGTATAGCTAGATAGATGCATGTATAGTAAGATTATGAGTATTTAAATG
TTTTAGGTAGACGGATAGATGTGTATTCCTTGTGTTGGGTGTAAAGTGACAGAGTCCCAT
GGAGGTGGAGCGCTGACCGTGAAGGCAAGACTGAGAAACCGAATCCTGCATTGTAGTACA
GTTCTCAAGTGATGAGTTATTTATTACCGCCCCAGTCTGAGAATTCATGACTGATTGGTT
CACTCTGATTGAGCTGGTTAACTCTGATTGAGCTATGTGTTTTAACCGCCTTGTCATAAA
CTGGATTGTTTAAATCTTGTTGCAGGGATGGGGATTCTTACTCTGGATGGTGGAGACAGG
AACAAGTCTCAATTGCTGCAGGTAAACGAGAAACATTGAATTAAATGTTTCTTCATGAAT
TTGAGTTTCTTGTGATTACCAATAAAACGATGGCACGCAAACTAAACTGGCTTTTATTTG
TGTTCATTTTTCTGACTCTTGTGTTTCAACTTTTCAGAGGTTGATCTGCTTTGGGGTTGA
AGGTAAACGTTTACCACTTAATGTATGGGAGTATTTCCATCAGAAGTGATTAATTGCCCC
CCCAGTCTGAGATTTCATGACTGATTGGTACCTCTCTGATCAAAACGATGGCTTAAGATT
TGATTACGCTCATACTTCGTTTCTAAAATGTTGTTTTGCAGCGTGGCTCAAACCGTGGAC
TTTGTCAGCAGTTGTGATGCTGCTGAAAGATTTTTAAAATCTCAATGGATTTTTCAGAAG
TTTATACATGGAATATTAAACTATTATGCAAAGGCTTTTGTGTTTGACTTCATATAAACT
TTCAATCTATTCTTGACGTCTGTTGCTTAAAAATCTTGAAATGTGTTTGTAGTGCCACAC
AAAGTAACTACAAAGTGATTAAACCTGAATGTTAACTTAAATTTCACTAATTGGGTAGAC
AGTGGTCTCAATAAAACCAAATAACCCATATAAATGCTTATTTTGTATGTGATAGATGTG
TCATGTCTTATCACTAAAAAGGCTCAAATAAGTTTGACCATATCCCCTTTTTAACTAAAC
TATGTTAAATGGGCTCAACATGCTTTTGACAGATGGCTGTGTTGACTCCAATCTCCCCAC
TTGTGTTTTTGGGGTGTTAATGACAATTGAACAATCCAGTTATTCAAATATAGCTCTAGC
AAACTGGTGAACAATACCCAAACTGCAGGATGATGTAAATTGAAGTTCTAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved