Gasterosteus_aculeatus Locus Mono:0:SNORD99
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Mono:0:SNORD99
Gasterosteus_aculeatus
Mono:0:SNORD99
groupX
SNORD99
1001..1079
2079
CAAGCTCAAACTATGCTAAAGATGTACTTAAATTACATCACGCATAGCTTTTCTTTAAC
AAACATTTCTCCACAGGGTAAATCTGAAGCCGGATCGCCCACCCGGGACGCCCGACTACG
TCTCGTTGCCCTCCCAGCAGGTGTGTTTGTGGAGCAGTTTTCATTTCTTACCGTCTCAGT
GAACCGGCTCCTATCGAAGCCGTCCATGCTCTCCAGTAGCACTGAATGGTCAACAGGAAG
CCCAGAGGAAAACTTCCACCGACGGTCGCTGTTCAGTTTAAAAAGATAACTGTTATAGCA
ACATTAAGGGGAAGGACATTTGGATGAAATCACGTGAACGACCCATCGGGCCGATGGTAA
AGTTGTGTTTAACTAACTGGTACTCTTCTAGCAGGAATTGGGGACTGTGGAGGGTGAAGA
GGCAGAACGTGAACGTTGCATCGCATGCAGGTACTTTCTGAGCCACATCTTGTGCATTAA
TGATCTGGCTGTGATTACAAACTTGCCCTCACTGAAAATTCTTGATTGAGACATTTTTAA
ACTGAGCCACACTTTATCGACATGTATATTTACACAAAGTGGTTGTAAAAACTAATTTAA
GTCGTTGTTTTTAGGTGACCCTGATGACTGACTCATAGGTGACAGGAGGAGAACTTTGAA
TGAAAAGGTAACTAATTCTCGGTGTCTTGCTCACATTACAGCGTGCTCTCATAAGGACCG
GGGCTTGTTTGTAGCTCTTATGTTCTCAAAGTGCATGCAAGAGAATTGGGTGGTCTTTGA
CTGCTGTGGCCTCCTCTGCCACCAGCAGCCACTCTACTGTCCTACAGATGAATGTCACTT
TAGATTTGTAGATTTACACTCATAGGAGAGTTGTTAATGTTTTTTTTTTCCCCATCTGTT
AATAGGCATAAAGTTGAGCCCTTTGGTTACATTGGCCCAAAGGCTGCATCACCAGTCTGG
TGTGAAGGTATGTACAGTTAAATCCTAGTATCTTTCTTTTTGTGATCTATGATGATTCAA
TACTAAAATTGTGACTGCTGGATGAAGCTTGCGGATATGGGACTGAGATCAGCATTTCAA
TGAGTTAAGAAAAGCAAATCATTGCCTTATACTGAGTAGCTTTTTTTTCCTTCCAGCTTC
GTGCCCAGTTAAAGGTGGTCGACATCCACCTGTGCAAGAGGATCACGAGGAAGCTGCACC
AAGTTATTGAACTTCATGGTTCAAGTTGTGTGTGTGTGTGTGAAATAAAACTATTTTGAT
CAAATTGAGTCTTTGCTTCATATTCTTACAGGACATAAAGTCCTCCCTATCATGTTTTCA
AGTGATGTAAGTAGGGCTGTCAAAATTGCTTGACTATTCGCTTTACATTTTAAACTAGAT
TTAACACATTACCTGCGCAAAAATAAATTTGTAAATAAAATTGCTGCGACTGCAGAGCTC
ACTCGCTGCGGTTTAAATGAATGCTGAAGCGGTTTGTGCACGCAATTCAATGTGGTGATT
CTGGTCCCCATACGGCAGGCTTCATTCAGTGATTGAAAGATTTTACAGTAGACATTACGC
GTGCTGTAAACACAAACTTTGATTATGTAATTTTATGCCAAGGAAAAGTGCATGACTGTT
GCAGCCGATCTTGTCTGTTTTATTCATGCAATAGTGAGGCGTGCCGCAGTTTTATACATT
TGAATATAGAATATTAGTTTACAGCCCTAATGTAGTAAATTCTCTTCACACTGTTGGTGT
CTAATATCAATCTGACTTCAACCCCCCCAGCATATGGATATTATCAGTTTTGACCATTTG
CATCATTAGACCGTTCGGATTACCTCATGTGGACATAGTTGAGTGACTCGACTGCACATT
TGAATTTTCATTCATGTTTATAGGCACAAACCTTTTAAATTGGGCAGTAATTTCTGCCCA
ATGGCATAAATGAGTACAAGTTCATTTCTGGCCATAACTTGTTCACTGCTCGAATACTAG
TCTGGATAAAAACCGTGAGTATTTACAATGTTAGATATCATGTGGTAATGTTTAAGGATG
TGAAAAAGCTCTTGTATCTACTGGTCAAGTTCAAATTGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved