Gasterosteus_aculeatus Locus Poly:8:SNORD38
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:8:SNORD38
Gasterosteus_aculeatus
Poly:8:SNORD38
groupIII
SNORD38, SNORD38, SNORD38
1001..1063, 1585..1647, 2798..2860
3860
TGGAGAACTGATTGCCCAAGCTCCGAAAATAACACTGCAGTGTCCTTTTTGTTGTATCA
TGATTTAACCCCCGCTCTTGTCTATTCTAATCTTGTATTTCAGGTATCTCCAGGGATAAC
TGGCATAAACGCCGCAAGACCGGTGGTAAACGCAAGCCCTACCACAAGAAAAGGAAGTAT
GAACTTGGGCGCCCTCCTGCAAACACAAAGGTATGTATGAGCCAGTGTTCACCTACTCAC
CTACTAGATTTTGTAAAGCGTGAGTGATGAAAACATGACCTTAGGTTTGTCTTTTTGAGC
CGTCTTGGTTCAAAGTTCTAGACCTACCAATGTTAGGACTTGTCATAGTTACACTGACCC
GCTTCAACATATGCACTGTACGGTTTACAATTCTGTCATAACTTTTATCGAATTAAATTG
TGTGTGTTCTCTACGACACCTGAGTAAGGCCTGTTACCAATGTGTTGCCCTTTTAAAGAT
ATGTTTGACTAAAATAGTGGGAGAATTGGCAGCTAATGGCCTTTTAATATATGAATGTAG
GCTGCACACGCAAGACCAGAATTATCGATGTGGTCTACAATGCCTCAAACAACGAGCTTG
TCCGAACCAAGACCCTGGTGAAGAACTGCATCGTCTTGGTCGACCGCCTTCCCTACAGGC
AGTGGTATGAGGCCCACTTTGCCACTCCGCTGGGACGCAAGAAGGGAGCAAAGCTGGTAC
GTGTGCCAGAATTTTTGTTTTCATGCCGTTTAGTGAAATACTAATTTATCATGGCCCTTC
GCCTGGTACTAGTAGGTAGCTGAATTCCCTTCATGGAAATTGGTCGGAACGCGCCAGTTG
CATCTTAACCTTATTTCACTCCATATATTTGCTGGCCTTGTTGGACTAGTCAAACATTGA
GGTCTAAAATACACTTTTCAGGGGGTGCTTGATGGATGGCATATACTTTGTTACAACTTG
CGTCACCAACGGAAAAGTGGTTGGACCCCCCCAAAAAAGTCTTTCAATGAAGATAACTTC
AGTTCTGCTACTGAATGAAAGTGATGAAAATGAAGACTGAGAAAGACAAATTACCTACAC
CCACCACCCCCTTTTGTGCTGTCAATTTAGAGTAACGCAACTAGTGTTTAGGAGAGATGT
GAGCTTTTCATTTGCTTGAATGTGCACCAACTGAAGTGTATTCCCCCCTCTCAGATCAGC
CCATTCTTGGAAGAGCAGTTCCTGCAGGGAAAGCTCCTTGGTAAGTCGACATGTTAACTA
TTATAGTAGCTATCCTAAAATGCTTTAGGGTTATTTAATCTGCATCTCTTTGGAAAGACT
GGTTGCTGTTGGTGGTTAAAACACAAGACTCCAGAATCTTGTTGGATGTGTCTGACCTGT
TTCCTGGTGTTCATAATTTAATTTAAATATTCTCCTCTCAAATTCATATATTTATAGTGA
TGTCATTTTGATAATCAAATCTTTTGATGTTTGAATACATTCCACTTTATTGAGATATAC
ATTTCTACGTTCAACTAAGTTTAAAAGCACTAGAATACTATTTTCCTTCATGGCATTCGT
TGCAGACTGTGATTTGGTGCAGGTCTTTCAATGAAGATAACTTCAGTTCTGCTACTGAAT
GAAAGTGATGAAAATGAAGACTGAGAAAGACAAATTACCTACCCCCCCCCGCGCGCTGTT
AATGTAGTGTAACGCAACCTGTGTTCAGGAGACTTGTGAGCTTTTCATTTGCTTGAATGT
GCACCAACTGAAGTGTATTCCCCCTCTACTGTAGACACCTCCTCAACAAGAAAAGATCAA
AGAGGACCCAGAAGTACGATGAGCGTAAAAAGACAGCCAAGATCAGCCAGCTCTTGGAAG
AGCAGTTCCAGCAGGGAAAGCTCCTTGGTAAGTCGACATGTTAACTATTATAGTAGCTAT
CCTAAAATGCTATAAGCCTCGTTTATGATTCTGTGTTGTCAGAGCGCCGCAGACGCAAGA
CCCCCTTGTGTGCCTTTTCACACCTCCCTTGCGTGTGTCGAGCCATTTTTCTAGGCTTGC
GACGCAAGCCTCCCGCAACGCACAAGGCATTGGTCCGCTAACTACATCCTTTACGGATTC
TCACATTTCCGCTTTCATAGCCCGATACCACCATTATTAAAACGAATAATGTTTACGAGA
GAACGGATCAGATTTAAGAACTTTTGTCGAAGAAATGCGTAAATATGACCACTTATACAA
GCAGTCATTGGCGGGTTGGATTCACCGAGGGAGATCGCACAAGAGGTGCACAAAGTTGTG
GAGGAAAAAAACGGGACTAATGTGTCCGCGATGAAAAGCAGCAGTGGCTATGCAGAGGGC
AATAAAGTCTAAGATGAATAAATAAACAGACTCTGTAGGCAGTCTTCAACAAAAACGCAT
TACTCCCCCTGTTCTGGCAGTGAATTGCTCTGCGACACAGGCAAGCCTTTTAGAACCATG
AATTGAAACGAGTGCGTTGACACAGAAGCATGCGCCAGCCTTTAGGGTTATTTAATCTGC
ATCTTTGTAAATACTGGTTGCTCTTGGTGGTTAAAACGCAAGACTCCAGAATCTTGTTAG
ATGTGTCTGACCTGTTTCCTGGGGTTCAGAATTTAATTTAAATATTCTCATCTCAAATTC
ATATATTTATATTGATGTCATTTTGATAATCAAATCTTTTGATGTTTGGATACATTCCTC
TTTATTTAGATATAAAATTATACCTTCAACTAAGTTTAAAAGCACTGGAATACTATTTCC
CTTCATGGCATTCGTTACAAACTGATTTGGTGCAGGTCTTTCAATGAAGATAACTTCAGT
TCTGCTACTGAATGAAAGTGATGATAATGAAGACTGAGAAAGACAACAAATTACCTACAA
GCCCCCCGCTCCCCTGCGCTCTTAAATCACTGATTATTTTCTCCACTCCTGCAGCTTGCA
TTGCATCCAGACCGGGCCAGTGCGGCAGGACAGAAGGCTACATCCTGGAAGGAAGAGCTT
GAGTTCTACCTGAGGAACATCAAGGCCAAGAAAGGCAAATAGATGTACAGCTGTTTGATA
CTTCAATGAAATGCGAACGCCACAAACTGTCTACTGACACTTCTTTCTAACGGGATGTGT
TTAAATCTTGGACATAACATGTCTTAACATTTTATAAAGTGCATAAATTCTAATCTGTAT
ATTTTAAAGTATTAGTTGGTAAACCGTTAATATAGTGTAAAAATATATTTAAATAGCTGT
TTGATGTCATTTAAACTTGTGTTAAACCAATAAACTGAAGGTGCCCGTATGTTTTACAAT
AAAACCAAAGTAACTTTGTGGGGCAAAAGACTGACAAATCTGTACTCTGCGCCAATTATT
GATATCAAACCAGAAATCCAGCTCCATATGCACTGAGACCTCAATAAAAGCCATTTAAAA
ACAATCTGACAATCCACCTACAATCACCTGAATAATGTTATGGATTAGAGCATTTACGTC
TGGACCAGATGTGGAAAAACTTCCTTTAATCTTCAGAAGTAAACTTGACTAATTGTGCGG
AGTGCTTTGCTGAATGGTTAAAGCCAAAATACATGTCAGACCTGCTGCTTCCTTAGAAAC
CACCCCGACCCCACCAGGTTGTCTGTCGGGTCTGTTCTGCTCCCAGAGTCGAAACAACGC
GCAGAAGCGGCGCTCAGTTCTTGTGTTCCACACATCTGGAACAAGCTCTCAAAGCTGACA
GTCTGCTAAGATGAAGACTTCTGTTAACGTATAAATCTTAAATCTGATTTAGGATTTCAA
ATTGTAACCCTTTAAAAAGTCCTTTGTGAGGTTGCTTCAAATCCCGTTCACAAGCAAATT
TCTCTATTTTTCAATAATACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved