Gasterosteus_aculeatus Locus Poly:3:SNORD65
snOPY snoRNA Orthological Gene Database
Gasterosteus_aculeatus Poly:3:SNORD65
Gasterosteus_aculeatus
Poly:3:SNORD65
groupVII
SNORD65, SNORD65, SNORD65, SNORD49, SNORD65, SNORD65
1001..1072, 1301..1372, 1583..1652, 2056..2121, 2292..2357, 2578..2647
3647
ACTTCAGAGTACCTGGGTATCTACCTGGTTCTGTTTTGTGGGGGAGAGGTTTTATTTCA
ACAGTATAGGTGAGGTGCAGCCTACACTATCTTTCTCATATTGGTATTGATTAATAATAG
AGAATATGTTATGTAATGAGAGACAACGATTTTTGCTGGGTAGCTAAATTAGTAGTTTCC
AAAGAAAATGTGTGAAGGTCCTAATGTTCATCTGCAAAGTAACTTACTAATGTCAAGTAA
CATTATTTTACTGAGGCAAATGTTATCACACGACTTACGCTTGAATACAATGGCTTATGT
TGCGTATTTAAATGTGAATTTCATTATTTTTACTCTATGACATCGTGTTGTTTGTCCTCC
GGTACAGCAGGAGGCGCAGAGGACTTTTGCAGTCCGTTGATCACCCGCCAAAACTGAAGA
ACGCGTGACCTCATATTCCTGCGACGTTGGTGGTATAAATATCTCACCGACGCACTGTTT
CTGTCTCTTTCGCCTTCTCCCTCCAGCGAGCAGGAGGTGCGCCAGCGGCAGGCTTCGTTC
AACTAGTTTAGACATGTTTTGTTTGGTGTAAGCGCCTATGTTACTATATTTAAACTTTTT
CTCGATCTGTAGTTTGTAACTGTAATTAAAAGCAACTTCTGTAGCATTTCGTGAACGTGG
CGCAATAACGTTAACGCGAACAGGGCCTCGCGCCGCCACGTGGGGAACACCGACCGACAC
GATGAGAGAAAAGTGAGAACCTTAAGCGTTTTGATTTATAACCTTTGGGTGTAAATCCTT
ATTGAAAGCATGCGTGTTTACTTTTTTAAAACCTGTCTAATGGTTGAATTTGACATTTTG
CTGCATAGGTCGACTTCAGGCGGGATGAACGCAGGACTCATCTTACAGTCACAACATTGG
ATAAATGGAGTCTCCTGATGTCTGCTCAATGTCAAGGCACACTTGAGGTTGGTTTAATGT
GCTTTTACTTGTAGGTTGTGGCTGTATCCATGAAATGATAATCGTGATGAAATTCAAACA
AACAGCTGGAATTACCGGCAGATTGTTTAGTGGTGACGCTTTGTTTTCTGAACATTTTTG
AGATTCAGTTCTGTAACTCCTAAGAATTTACTTAATGTCATCCGACTAATTGTGACCTTC
ATTTTATCCCTTCCATTGATGAAAGGCGTGTGAGCTGAGCTGCCTTAAGATGCGACGTTG
CACTTCTGTGTATCGGTCCAATTCAACCTGATGAATAAGGGCTTGTGGTCTCCAGGTGAA
TATACATTCTCAGGATGTAAACATGCTGTTCTCTGCCCCTGTGGTGATGAAATTCAAACA
AACAGCTGGAATTACCGGCAGATTGTTTAGTGGTGACGCTTTGTTTTCTGAACATTTTTG
AGATTCAGTTCTGTAGCTATATTAATGTACTGGATGTCACTAACCAATCATAACCTTCAT
TCCTATCCCTCCCGTAGGTGAAAGACTTGTGACCAAATGACGAGGCATTGTTCTACTGCA
TTGGACTAATTGGATCAGATGACTAATGATTCTTGTTGTGCAGGTGAATATTCTGTCTGT
AAAATGTCGTCTATCCACTCGTTATGATGAAATACAAACTGAAATATCTGGAATTACCGG
CAGATTGTTTAGTGGTGACTCGTTTTTCTGAACATTTTGAGATTCAGTTCTGTAACTCTT
GAGACTTTACTTGATGTTACCGACTAATTGTGACCTTCATTTTATCCCTTAACTAGATGA
AAGGCGTGTGAGCTGAGCTGATGTGACGTTGCACTTCAGTGTATCTGCTCAATTCAACCT
GGATCCAGTAAGTTATTTTAAACTATTTTCTTTCCTAATTGGAGCATCTGGAACACATAA
GTTATTAAGCATTATTCACATTGTAATGTGGGGGGGCACCACTGCTTGTGTGATTGAATC
TTGTGGTCTGTTCCAGGCCAGAACAAAGCCTACATATAGTTACGAAATACTATATTTATG
GACGTAAAATAATGCTTATATCATATGTGCTTGTGTTATTTGTTAAACTTAACAATGTGA
ACCTGTGTAACGCGGTCGATGACGAAAACCTGCAATAGGAAGTGCCGTCTGATGCGACAA
CTGACGATCCACTATTCTGAGTCCGTTAAAGTATTAATTAGAAGTTAGTGGAATGTTTGT
CTATTCCCTCTTTTTTTACATTTATTTTGTTTTTTCAGGTATCCAAAGCGCCATCTCCAG
GAGTCTGGTCCACTGAATATGAAAGGTATATTTGAAACATCGGTGAACTTATTGGTCTCT
GCAGTTGTGATGAAATTCAAACTGAAATAGCTGGAATTACCGGCAGATTGTTTAGTGTTG
ACTCTTGGTTTTCTGAACATTTTGAGATGCAGTTCTGTAACTATAGTAATGTACTTGATT
TCACTAATGATAACCTTCATTTCTATCCCTCCCGTAGATGAAAGACTTGCTCTCAGCACA
CATTTTACAGTGAAAACCTCGGATAAATGGAGTCTCCTGTTGTCTGACAATCTAAATGTC
AAGGCACACTTGAGGTTAGTTTAATGTGCATTACTTGTAGATTGTGTCTGTATCAATGAC
ATGATGATATTCAAACAAATATCTGGAATTACCGGCAGATTGTTTAGTGGTGACTCATTT
TTCTGAACATTTTGAGATTCAGTTCTGTAACATTAATGTACTTTGTTACCGTATTGTGAC
CATCATTTTATCCCTTTCATAGATGAAAGGCGTGTGAGCTGAGCTGCCGTAAGACGCGAC
GTTTCACTTCTGTGTATCGGCCCAATTCAACCTGATGACTCACAGGAGTTGACGACTTTG
GAGTTTAGTTTGATAATTAAAAATCAGCGTATATTTGAATAAAATGGCTTGTGACACTGC
AGAACGTTGGCAATGAGTGAAATAAAGTACTAAATTGAGCTTTTCTTTCAAAGATTACGT
GATTTTAGAGTTGTCCTAACAGACCTCACACTAATCAATGCATTACTTAACCAGTTTACA
ATATATATTTGCTGACTGTTACTTAAATGATCTGCGCTTCTCAATGATATTTCATGTGAA
CGATGCATCTCTTTAAATATTACGGAGTGCTTTAATTTTGTAAGAGCTGGCCCAGTGGTT
CCTGTGCTGGAGCAGCATTGTACTGAAGCTCCTTAGCATTCAGATAACCGGAACAGCGCT
CGTCATTTCACCCAATTAGGCACCTTCCTCTGAAAATTGACAATTTGAATCCAGTCCCAT
TCTTGCCTGCTCCTCCTAAACGTTCTCACAATTCTTGGAAATTTGTATATTTTTATAATA
ACCTAGGGGGTGTTGCAATTTTTTTTTACGTTTTAAAAAACTCCCAGAGATTAAACATTC
TTTTCAAATGATCTTGAGCCCCTGCTCCTCACAGGTAAGCACATCTCAAGTTGTCACTTA
AGACCTTGATAATGCTTCACTGAATGTTCTAAGAATTAGAAAGGGCGGCAAGTGAGAGCA
TCAGCAAAGTTGATCATTTGCCATGTTTGAGACACTGGGCCTGAAGATATGTAAAGTTGC
ATTTTTCCTCAGTCATGGCGCCACCTACTGGTAACACGGAGTACAAATGTGTTCATCTTA
TTGGTGTAAACCTAGTGTGCCGTGATATCAGGTGCAACCATCACCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved