Gallus_gallus Locus RPL37
snOPY snoRNA Orthological Gene Database
Gallus_gallus RPL37
Gallus_gallus
RPL37
Z
SNORD72
3215..3294
4631
tcccctcccctcccctctcctcccttgtcctctcttcccccctccttttccctccccct
ccccccttctttccctttccttctcttttctcaaagaaaacagattatttaaaaacattt
ccattctgttagggcaaaggtcatcttacctacatttagccatttatgtgccttgcctaa
gggggctgtctaggctcctgttagtagggctcttcccaatggcaatttatgtagcccacc
ttggacccctcatgtaaggtgagacaacttccctttggaaatatttctctcctctttaag
tatgggcacaacgtggacagactagatgagatgctgagactttcagctagaatcagtgat
gcaaggtgaatgcagcttttgccttcagttttattctgaaggtagaaactgccaaactga
aagagctgagtgaggtgaccttggccactttctaaggtgtaattttctacagactgtaag
tgcactggaggtgtacagtaggctagcatatgagagttcatgtggtgcatctgcattagg
atctattttgccgcagtgattgctttgaacaatggacaggttgctatgggatatagtgga
gagcagtggggactctgttgtttatggctgttctcttgatgtgtactgcagcccagaacg
tcccgtattcccgtgagaacagctctgtgagcttgtcattagatcctgcagcctggcatg
agctatggctgcacatagaacagctcactccgtgagtaacacagctttactgagctgaac
attttcttcaccagcaatgtacgattacaggtaactgcccctcggtctctgctcctcggc
agccgcaccacgacgcaacatggcacaccagcagaggcagaaccactaaagggaggcgga
cgcaccggaaatagcgcagggaaccaacccgggcccacataaggtacttccgctccgcca
cgccgaaccctgccgcgcacccggaagtagttgtgggggttATAGCGGAAGCGGGGCGGG
GCTCGCTCTCTTTGGTGCTGGCGGCCGGCAAAGATGgtgagtgctgtgctggggtcgcgg
ggcatcggccgacatccgccactgggatgggcccagggcgccggcgggcctcgtgtggtg
ctcgggatgaccctgtgcactgttgcagcctggcctggtggcgggatggctctgcggggg
gccggctgcggggccggggcctgggggcctgttggcgggcgcggcgctgggcccagtccg
ggactagttgcagagggcgaacgtggggcgtcttgttctaagcgggagttacagggctgc
gctgtcttcaaggggcttctcagtaatgtggtccgagcgggccggggctgaggccacgcg
gctagcttagcaagtggggagtcggctatgatctgtggggaacgtatggccaacgttacc
caaggaagtatttttatacgggaaaattttttaacatgaacgtgttcgggggcagctttg
atggtaactgctgggtagttttgttcagcggcgggtgggggacggggttggatggcgcag
ggagggtcaaggagctgaactctaaaaatggaggagacctacaggtaaagctgggttggt
gactgagcgcagtgtgccaccgtcatgcttatgggttttaaagaaccgtacttttttttt
tttgtgagcttatttgttgtggtgtgtaccttgcaaaatgctaattacaagtgtcttgaa
atgtttttcagACGAAGGGTACATCATCCTTTGGTAAGCGACGAAATAAGACACATACCT
TGTGTCGTCGATGTGGGTCCAAGGCATACCATCTGCAGAAGTCTACCTGTGGGAAATGTG
GATACCCTGCCAAGCGTAAGAGAAAGTgtaagtaaggaagttctgactgacttgagttta
aatgcttgtgtttctttgcttttgggacatcagatttttttcagaccagggaagaatact
ctcattttggcgtttgaagcctttttcaatctgtaaattggcagtttgtagtgttactgc
ataaaagttgatcttgttttaactttttttttttttacttctgtcagtgaatagttgtgc
ggttgaaatattctatgcagatcagcattaacaataacttatatattccagACAACTGGA
GCGCAAAGGCTAAGAGACGCAACACCACTGGTACTGGTCGCATGAGGCACCTGAAAAAGG
TGTACCGTCGCTTCAGgtatgatgttttattgtaaattggtgtaacgtgatatcctgtgt
ggatttcacttgattgtaaaatcaatcacgcagagtaggcacgtttgcttagaacactat
aatgtggtgtgatctttcttttaaaatatgctgtgatataacggatgtgcagcatgttgc
gttgaggttgaaaagcttgctattagtaacacagcttacataagaagctctgatgtttct
tttaaatatgagtggtatagaacacagcgtatggtaatacaatggctgcacttgaaagac
aatagtgctttgtttgccactgcctatatttgtaagtcagttgagttgctggttgcactc
tagtgtggatttttaaagcagaattcatgaaatgtgttccaatccccctacttatgccca
caaaataaataaataaaattacccacctatttttctgttacttagagctcaattagcagt
aaggagcttttcatcagattttgtgctacgggtttctacaactcattgtgaagctttgag
ttgttcttgcagagtactgtagggatagttactatactgtgaaattacctaacttaagtt
ctagaactaggtatagttaagggatcctttctataggtgttttttttaattatcaatctt
ccccagctgcagccagaagatactttgttgtgcaactgcaatcttcattcccttacgagt
ggctgaaatatcaatgttgcatagaacagcaagcttagaactgactccttcatcattact
gttttagttttttaaaagcatagagaatttctgtaagaaatactgaaatactttgctgag
ttccctaaactatggggtgtcttcagtagatgtactgtatctgattgaattttactgagt
tggctcggttactaaagtcctatttgaacaaattcctatttgaagttgccagatttactt
tctgaggagagaaaacaataccgcttattccaaacagcttgtcaatgatgtttcttacta
aaatgtctgaacatatgaacttcatagtgatttcagtgcattactgagataagctgaaaa
aaagctggtgaacttgatctataatattacttactatataaaacagccttgatgaaatac
ccacctttcaacgcatggtaactgtattattacttgtagGAATGGATTCCGTGAGGGAAC
CACACCGAAGCCGAAGAGAGCAGCTGTTGCAGCATCCAGCTCATCATAAAGACTCATCTA
TTTGCTAAAATAAATGGTCTTATCCTTAAAATGCCACCTTTTATACATGTTGTACTTCAG
TGAAAAAGGGGATATCTGAAAATATGTATACTTATACAATTTTCAGCGATATGAAAAGAT
TCATTAAAAGTAATTCTTTGCTTGACTCCTCAtttgatagcatctttacgttggaaaggg
ccattatctctgtcctgcatttaaaagaggcttgtaagggttattggagaaatcgcaaga
gaaatggaatgctggctgtgggcttgtccctaagcttttctgggtacttcacagacacag
caaatgataacatggagagtttatctcaaatctagtaacatggctaatggctttaagtgc
tgttctgagatgcagtagtttaagagagatgcccagtcttggccatattatttattattt
tgtgactctgaaaggcctgctaaagtattgcttattcagtgggtcactgcttcttggggt
agggtgggggaaattactccaaaatctggagggctgtattgccaggaaaaaagaagaaaa
tacgctgtagttgagacaagagttacccaaactgtctgggaagatcagtgtggaaaggtg
aggaaaaagtactaagttaagctgggtgtgaacaagtaaattaaatggtaggtagtaagg
tacagataagagtaggccacatgtaagtgtatctgaattaaagactgatagctgatgaac
ttagatgtagtgtgtcactgggtcattgctggctttgaaattcttgtcttaaacattagt
agaggatggtgatcactagaacaggattttcagttaccttgaatagaaaattggtatggt
aaggtgagcaggaacctgattcttgctttaagcttgacttttgctgcatttctaattctt
aaaattactgatgagaggcacaaaataagttcatttgggttatagtaaatatattcaaaa
gagctcgggtagtttggcattacgtccgtcacagttggcctggaagtaaggttgctgaat
gtagattcaggcacttcacttcttttaagtgctgaaaactttaaatgccatggtggtttc
tttagtatagaaataatttcttgtaaaagtggtaaaataatcctaactcaagagttacta
gaattgagtctc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1751..1886, 2151..2235, 3399..3631
1053..1055, 1751..1886, 2151..2235, 3399..3468
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved