Gallus_gallus Locus ENSGALG00000003235
snOPY snoRNA Orthological Gene Database
Gallus_gallus ENSGALG00000003235
Gallus_gallus
ENSGALG00000003235
Z
SNORA66
14105..14241
41995
GTGTTTTGGACCCCTCATTACAAGAAAGGCATAGAGGCCCTGGAGCACATCCAGAGAAG
AATCTGGAGCACAAGTCTGAGGAGAGGCAGAGGGAACTGGGATTGTTCAGTCTGGAGAAG
AGGAGGCTTAGGGGAGATCCTTTCACTCTCTACAGCTCCCTGGAAGGAGGCTGTGGTGAG
GTAGAATTTGGTCTCTTCTCCCAGGTAACAGTGATAGGATGAGAGGTGATGGCCTCAAGT
TGCACCAGGGGAGGTTCAAGTTGATATTCGGAAAAATTTATTCTCAGAAAGAGTGGTGAT
ACGTTGGGATAGGCTGCCCTGGAAGTGGTGGTGTCATCGTGCCTGGGGCTGTCCAAGAAA
TGCATAGATGTGGTTCTGAGGGACAGGCCTTAGTAGGCATGGGGGGGGGGGGGTGGGTTA
ACAGCTGGACTAGATGATCTTAATGCTCTTTTCCAATCTTAATCATTCTATGATTCTACG
AACTGCGCTGTGCTGTGTCAGTGTGTGCAACAATGAGAAAATCGGGCTTACGTATGCCGC
AGAAGTTTGTGGGTATGGCCGTGGTGTGATTATTAGCACAAAACACAGGATAATGAAGGG
AGGAACGCGCCGGCGGAGGACTAAGAACAACGCCTCCCCACGCCTCGGCCTCAAGATGAA
GGACTACAGTTCCCAGGAGACATTGCACATCCCGCGCATGCGCACCCCCACCGCTAAGTA
GTGGCGGCGGCTCCCGCGGCGCTGGGCACGCTCTGTGGCGGGCAGGGGGAGGAGGCGCGG
CCGCGGAGCGGACTACAGCTCCCAGCGGCCCCTCGCACATCTCGCGCGTGCGCACAGCGC
CGGCTCGGCCGCACTCCGCCGTTGTCGCCGTAGGTGGGTGGGAGGGGGTGAAAAGAGCGA
GCGCGGCGGTGAGGAGGAGGTGGAGGAGGAGGTGGCGGTGGGAGGGGGGGGGCGAGAGTT
GAGAAAAGGGACGCCGCCGTCGCTGCCGCCAGCTCGGACTCATTAATGGCATATGCCCGG
TTGTTTCTTTCACCTAGGTAAGTAACTGCGCTGAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCGCCGCCTCTGCGTTACCGCCG
CCACAGTGCCCAGCCGGCTGGGAGAAGATGCCAAAATGGCCACCGGCAACTACTTTGGAT
TCACCCATAGCGGTGCTGCTGCTCAGTATAGGTAACCGCCGCGACCCCGCCCCGCTCCGC
CCGGGCCCGCAGCCCGCGCTCGCGTCCCGCTGCGGGACCTCCCCGCCTCCTGGGGCTGCG
CGGCCGGCGCCGCACCTGGCCCCCGCCCCGGGGCCTGCTCCGCTCCGCGCTCCGCTCCGC
GCCGGGACCCTCCTGCCGCCGCCCCGCCCGCGGGCATGTGTGCTGCATCGACGCTCGCCC
GGCCATCCCCGTGTGTGAGGGCGGGAGGTCGGGCTGGGCGCCGAGGGCCGGGGGAGCAGG
AGACAGCATCGCGTCCCGGGGCCTTAAATTAAAATGGCTACTTTCAGTCGGCACCGACGT
GTTCCGTCTGCGCCCCGAGCCCTTCGGCTCCTTCGGCCCCGCGGAGGGCAGGGCTCGCTC
CCCAGGTCTTTCCCTCTAGCTCTGTCAGCGTGGGAGGGTGCAGTCCCCGTTAATCTAGGT
TAAAATTACGCCAGCCCAGATGTGGGAGAGTGGGTGGATGAGGGAAGAGCTGGAGCCCCA
GAAAATACGGGGGTCTGTCTCATTTCCCTATAATATTCTGTTATAATGAGCGTTCTGTCT
AAGAAAATAGAGCAGGTACCTTCAGGGCCTATCACCTTTCAAAAAGATTTCCTTTCTTGG
TGTTATCTAAGACCAGGAGAGGTCTTATAGTGGAGCTCGGGGACCTGAAACTGTACCTCT
TGTTCAGAGGCAGTCCTGCAAATTTTCAGTTTTTTGTTCACCGAAGGTTGTGTATCAGAT
TGTAAAAAACAGAGTAGTAATTGGTAGCGTCTATTATCTCTTCTTCTGATATTAACTCAT
TTATTTTGAGGGGAAAAAAGCGGATATAAGCAGAAACATTTATGTTTTTGACTTGTATTA
GAGTAGCAACCTAAAGCCTGCATTTAAATCCATGTTAGTTGTTTCATAAATCTGTAATGA
AGACTTGCCTTGACTCTTAAGTCTTGGTTAATGGAGAAGAAAAAAAAACAAAACAAAAAA
ACCAGAGGAATAAAGCAAATACATGAGAAGTTATTAGAAACAAATGCATGTGCGCGTTAC
TGGTAAGAAGCTGATCAAACTTGAATACCTGACGTAGTTTCAGGAGAGTCGAGTTTTATG
GAGGTCTTGAAATGGCTCTCAGACCGTGCAGCTATTCTTTCCTGGAAGCAGACATAGTAT
ACTTTCATTTTTATTTACTTCCAATGTTGAATATTTAAAGGAAGGGATTAAATTCAGCAT
ATCTTCTAGTTCTTCTAAGATGGGGTGCTTGCAACATGTTTATGTGCTACTTGACAGTTA
CAGTGAAATTTTAAACTGAGTCCTCATGAAATGTGGAAGAGTTTTTAAATAGCTTAGAGG
ATTTTTTTTTTCTTTTGGATTAGAAAACAAATGATCTGTAAGTGAACAATAAACTATGAG
ATCCATATGACTGTAATTACAAAGTGGAGATGAAGTTTTAAAGTTATTTTTCCTTTTATA
GTGGAGCTGAGGGGTGTATAGATTTAAGAACTTGAACAACTCATTTGAAATTTACTTTTG
CACTGCAGCTTAAAAACATAATTGGAATAAAGTTCAATTTCAGAACTGTTTTCATTTAAT
TGTAAATGTATTTTTGAAAAAAATGGGAAAACTGAACAAAAGGAGATTTGTCCTTTCCTA
CCGCAAGTACCGTAGGCTGTTCCATTTGTGTATCAGTAAAAGACTCTGTGTCCTATAAAT
GGTGTGTGTGCGTCTACCATCTTTGAAAGTTAAGAGACACAGCAGCCAGTGTTAGGGCAG
TTCTTTCATAAGAATATAATATTTTGAGCAGAAAATACAGGAAGTGCTTAAAAAATCTGA
AAGGGGAATTTATTATCAAAAAGCAGATCTGTCAGATCATTAATAGCTGGTTTACTGAGA
GCCACAAAATGTATATTCCATTCCAGTATATTTGAGCAAAAGATGGTGGTGGTAGGGAAA
GATAATTGAAGATTTAATATTGCAACAAGCTCTCTAAGCTGTCTTTTTTTGTTGTTGTTC
ACAAACACTGGTTTTCATAAAGAACACTTGAAATCTTACCTCACTTTATATTTAATCAAA
GGCAGCAGAAGAACTAACTGCTCTTTAATCCTATAAATAATGGATTAGAAGCATTCTTGT
TCCTTTCAATATTGTAACTGCATAAAATTTCCTGCTGCCCACTTCATTCAGAATTCTGTG
AACTAGCCAGTAATAATATCATGACTTAATGAGAGAATAATTAAAGTATTTTATATCTGA
TCCCGGAAATTAATCTGAGTGTGTGTGTGTGATGCGTTCTGCTGAAGGTGGTATTAGGGT
CTAAAGTTATAAACCTGTGTGCAGTGTGAAATTCATCTGCTACTTATTTCAGTAACAATA
TTCCATTTATGTACAGGTTTGAAATAAATTTTTTTAATTTGGCCATACCAGTCCTCTTTT
GTGTGAATATGTGCACACTATAGTTCATTTGAGCCACTGAGTCTGTTCAGTTTGAGGTGA
AGATCCTAATATTGGCTTGCATTCTGCGTGTAGGAAATATTCAGTGCATTGTTATGCTTT
CATTTTAAAGTTGGCTGATAGACATATAGGGATACTGATGGGGAGATGAGGGCATTGAGA
ATTTAGATAGAGAAGTGGGCTTTTACTTGCTTGCAACTGCAGTGGTCTTATCGAATGAAC
TTGGTGTTAAATTTTTTTGTTTCTGTTAAGAAGAGTAACTCATTGTGTTTCATTTCATGA
TGTCCCTCCAGTAATGAGACAGGTCGTAAGGTAGGAAATCATTGGGTACTTAGAAGTGAT
TTATTAACTTTAAGCTGCCTGCAAGTAGCGCGAGTATTATCAATTCAGTATTGTAAGCCA
TAACAGGTAAGGGGAACGGTAGCAATTCAGGCACAGAGCAGATCACGGTGTGTGTAAGTT
TAGCTTAAGATGCAGTCTTCTGTGCAGCAATGTAGACAGGAGTATGTGTGCTGTGCACAG
TTTTACAGGACATTGAGAACTGGTGCAGAGCAGCAGAGGAAAGGGAAATGCTGTGAGTGG
ATAAGTTTGCTATTGAGAAATTGGGAGGAGTGTGGGTGTGTGTTATTTCTTTTTATTTTT
CATGATTGATAGTACTTCACTTTTATTTCAGCAGTGTCTGTTTTTCGATCAGATGCAAAT
TCCAGAAGCATTTAGTATCAAGACTACTCAGCGCAGGCCTGCTAGCCCAACCTTAAAGTA
TCACCAAGCGTAATTCAAGCTTACAGTGGTGGACAACAGGAGAATAGGCAATACTGAGTA
GGAGTTATAGCTTATTCTGAAGTGAAAATGCATTATTAGACAAACTTAAGAATATTTATT
AATTTAGGTAGCGTTAAGCACACCCAACTCTTAAACATGGGCAACAAAACTGATAGTAAG
AGAGCCGCTTCAAAAGCGATGCCTCCTATTTTATTATGCTGGCCCACAGTGTTAGAGGCA
GATGGTGGGATGGCAGTAGAGGATGAACCTTCCCACCAGATTTCTGTTACGTTTTGTTGC
TGTGTGGCAGAAGACAGCAGAGGGGCAGTCTGACAGAGTGGTGTCTGGCATGAAAGTGCA
CGTGAAGGAAAGCCGTGTAAAAATGGCACCCATTGACGTTCACTGTCTCTTGCTGAATGT
TTATGGAAACGAAACAGTTGATGTGAGCACAGTGAGGCATTGGGTGCTGTATTTTAGCAG
TGGCAACAAGTGACAGCTGTTCACCTCTGCTGATGCATATTTCTATGAGTATGGCATGCA
AATGCTTGCTCACTGCTGGCAAAAATGCATAGTGAATGGTGGCCACTATGCTGTAAAATG
GTGTTTTGTAACTGAGAATTTGCTTTATTAAAGTGTTACTGTGCTCTTTGTATCTGCTAC
AGATTCTGTGGAAATAAATAGGAAGCATTCCTTTTGGAACAACCTATGTAATTTTATCTC
GTGATGAATGTATCTACATCATGGAGTAAAAACTCCCGACTCTGCTTTTTTTTTGGTTTT
TTTTGGGGGGTTTTTTTTTTGGCAGAAGTGACTTCTTGGTACGATTAACCTGCACGGTAC
TGATTCTCCTTTGCTCAGTCTATGCTAGTCTTAAGTGCTATCCTAAACATTCTGTTTTAG
CTTATGAAATATACACGATAAACCTCTAATAAGCTACTGCTGCTTATGCAAACCAGTGAC
ACGCTGCTCTCAGATGAGATATGCCAACATCAGGAAGGCACTAAGAAGCTCTGGGTTTGG
TAATGCAGACCATGTAATGGTAGTGACAGGGAGTTAGAGAAGGTTGCTGGTAAAATGGGG
GGGCAAGGTGCCTCTGTAATCAGAGGAGCCTTTGTTGTTTCTGAAAGGGAAGTCTGCCAA
CTTGTTTAAATTTGCAGCAGGATCATTTGTGCAAGAGCCAAGCACTTGGGGAAAGTTTTC
TGTTATTGGTATAGTTAAGTTCTTTGTAGTTGTAGCCTCAGAATGGTTTGGTAGTTTAGG
CTTAACTCTGGAATGTTACACGATAAGTGAAATTTTGTCCAGTGGTTAAATAAAAGAATG
GTAAAGTGTGGTTGCATTGTTGGTACTTAGAAGAGCAAAGCAGTGACTAAAGTCAGGAAA
TAAAGAATGTCTGAAGAATTGAATACAGTTTTCCATGCTGGTGAAGTTTCTTTCCTCTAA
TACAAAACTTGCCCGTCTTAGCTTTTTTTTTTTTTTTAAATGACAAGGAAGATGTTAGAA
TTGCTAGTTTTTTAGGCAGATGTTGCATCTCAACTTGTTCTTTTTGTTTTGTGCTATCAT
TGTGGATATGGCTTTAAGAAGACTCTTGAATAAAAGCAACATTTTGATAATGGAAGACTG
TGTAGGCGATGAGCAGCCCATTGTATGCAACAGAGTACAGGGTGGTAGATACAGAGTATG
TATTGCATCACTGGTTTAGACACTTCAGTTATGGTGTGATGTGAAGAGAGCTGCCAGATT
TGATTGGTTTTAAAACAAGTAGTGAGGATAAAGGTGAAGATTAATTAAACGGGAAGAGTG
TGTTGAAAACATGAGCATCTTTGAGATGAGTTACTGATGGTCTATTAGCTATTAGTAGTA
GTCAGTACTTTTGGAATGTAGTGGAATAATCCAAGGATGATTTTAGAAACAAGGAAGAGG
AAGGGAAAATAACAGTTGCTTTAAGGAACTGTATTTTTCAGATGAGATGTAATTAGATTG
TAGAATGCATTACCAAGAGCTGCTAAAATTTAACAGGATTCAAGAGCATTGTATATGTGC
ATAGCTTAAGGCCTCCCTTTGGGTTCATAGTGAATTGCATTACAATCAATATTCTGTTCA
CAGAATTATCATAGTAGGAAGTAATATTTTCCATTAATGTTCTAAATAATTTTATTCAGA
CCTCATCAAAATTGTGTGCTTACATTCAGTGGCAGACTCTTACAAAATACAAAATGTCTT
ACTGGAATATTTTATTTCACCATATTATGATGTTTATTGTTAAGTGCATTCAGGATAAAA
GAATCTTATTATTACTAATGTTATTGTGGTTATTATTTCAGCCCAAATTTCATTCACAGA
CCTACAACTTCATCTGCCCAGTTACTTAGTAGTGCCTCCTTATCTGTGTGTGTAAAGAAG
CAGTAGGTTGTAATGCTTATTTCAGTTTTTGTAGATTTAGGTCATACTTATTTCAATCCT
ACGGTCTCTGAAAGAAAAAACACGGAACTGTATTTTTAAACAGTGCTTTGCTGTTCTGCT
AGTAACACAACAGTCTATCGAACTTTGAGAAAGTCTGCAGTTAGGTCTCAATGAATATGG
GTTCCTTAATTCTAAAATATTCATAGAAGTTAGAATTCAAGAAACAGGGCTTAATTGTTT
TGTTTCAAGATATCTCTAGTTTAAAAATTATGCTTATGAGTAGCATAACTGTTATGTTAA
GCTATCCTGAAAAGGGTATTCTTTATATGAAAAAATAAGTTTCCTAAAAATGTAATTTAG
AAGTTGACATTTCTGAGAAAGCTTGTAATTTGAGTAGGGATGAAATTGGGTTTAGCCCTG
GTCTTAAATCTGTATCAGAATGGTGCTCTTTAGAAGGCTAAAACTGAAAATTTACGTACG
TCCTCCAGTTGTAAGAAGAGTTTTCAGTGTTTGGTGCTCTAAACTAGGCATATCCAATCC
ACGGGCCATCTGCACCCCCTCACAGCCAGTAGTGTGGCCCCACATAACTGTAAACTTCTA
CCATTATTGTGATTTTTATCAATGTTTTTCATGAATCGATTGCACATAGCTTCAGTGTGA
ACTGTGTAGGTGGCAACAGCTGTGGAGTGGAGGTTGCAGCACAGTGCTGACTCCATCTCC
TATGCCCACAGCACACACTCAATCCGACTGATATGCACATATGATGCTGCGTGCGTTTGT
GCTGCTTGGCAAGTAAAATGCTGTGATTGCCGATGATAGTAATTCAACCTACCTACATCT
CTGTGTGCCTGTGAAGATGCATGTGTTTTCCTACTAATGACAGACATGTAACCTTTCTTA
TTTAATAATTAAACTTGGGTAATTTTGCATTTTTAGTGGACATGAAAGCTCATTTAAATG
AGTCAAATGTGTGTTTTCAAGGTGAAAATCAACCTGTCTGTGCTACATTTCAAAACACTG
CTGTTGAAAATGAAACTTAAATTATGACAAGATTAAGTTATGGGTCCTAATTTTATGCAT
TTTGATACATTGGCTAAACACACTTCTGTGAATGCTGAAAAGTACACAGCCTTACTTTCT
GTTCTGATAAAGGAGTTTGAGAATAGGTTCCAAGATTTCAAAAAAAAAGAAAAAGATTTT
TTTTTGCGTATTTGCGATTTCATTTTTAGCTGACATAAATACATTGCCTGCAGATTTTCA
GTCAAAATGCACAGAGTTGCAATCGGACATTCAAATTTAAGCAAAAGTTGATCATGTCTC
TTTACCAGACTCTTCTAAGATGTCTCTTACCAGAGAAAAAATATCCTTTGTTTCACAATT
GCCCCTTATTCATGTAATCACTTTTTGGCAGTGCATACATTTGTGACCGACTGTTTTTAA
GGATGAAGCACAGTAAGAGTAAAATTTCATCAAAAATCTCTGAAGAGCACCTTGAGAGCT
CACTAAGAACTGCTGCCACTGCCATCAGACCAGACATTGATGCATTACTTTTGCAAAAAG
AAGGTCAAATATTCCATTCTGACTTTGCTGACCGCTTTCTTTTTCTTCCTTTTTTCTTTT
TTAATGTTAACAAAAATTGTTTCTTGTATACATGAACTATGTTTTTAGCATATATATATA
TAATTATCTTTCTTTTGTTTTATATTTATATAATTCCTCTGCACTCAAGTGCGGCCCAGG
CAAGCCAACGTACTGGACACCCATATTCTGAACAAAGCTGGAGTAGCAGCAGCTTTACAA
TGTATATGTTGTTTGTTAGTTTCTCAGTGGATGACTTAACTCCACAAATAGCCTCATGTG
GAAAATAAAGTATCTTTACATTTAAATCACTTGAAATTATTACCTTGCAAAATAGACAGT
GTTATATCGAAGTGTTGCACTCTCTTGATATTGTTAATGTGCAATAAATAAAGCTTTCTG
CTTTTTTTTTTTTCTTTGTAACAAAGAAAGCCTCGAATCTTTGTTACTGGAAAAGGTCAG
TATCTGGAAAAAGATAAAAGCAAAGTGTTCTCCGGAGAAGAATTCAAAGGTTGCTAATTA
AATGCTTGTAAGTCTGTCATTCTTGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGGAGAGATTCAATTTTTTG
CTAATTAAATGCTTGTAAGTCTGTCATTCTTGGGCTGATAAATTACAGGAAATTCAGTCT
TCCTATCAGTATTAATCTTTAAAAGTACCTAATAAGGGATCTTCTGTATTAGATCTAACA
GTTTTTATACTTGCCTAAGCTTGTTTTTGTGGAGGCGTGTTATTTGCTTTTTTATGTAGC
TATCTAAATTAGACAAACCTGTTGTTTTGGAAATGGACAATAATGTTTTACTAAGTGAAC
ACTGGTACTTCATTATTTTTTATTGATCTGCATATGCTCTGTAGCCAGCTTCTGACTTAA
AATTTAAAGCATTCTAGTAGCATATTAAAAAAGACTTTCAAAATGGAAAAAAATAATAAT
ACTTTGGAAGTCCATATTTCTTTTTTTTTTTACTTTTATTTCAAAAACACTGCTGCTGTT
TCCTTAGTGAGGATCTTTCTGTAGTTCAGAAGAGGTTTTTCTAATTCATCTTAATCAAAT
ATAAGTGTTCAGGCAGGAATTTTGCAAACTAAGTATCTACATAGAAACACACTTTTTTTG
ACCAATACTATAGCTTAATTCATTTTGCAGGGTAGAATTGTTCATAATTCTTTGCTTCTG
TGTTTTGGAATTGCACCAGCCTTGTTTAACGTAGAATTGTAGAATCTCCAAGGTTGGAAA
AGACCTCCAAGATCATCCAGTCAAACCATCCACCTACCACCAGTGTTTCCCCACTAAACG
GTGTCCCTTAGTGCAACTTCTGAATGTTTCTTGAACACATCTCTTGAACATTGTCATGAA
TGATCTGGACAATGAGGTAAATTGGACCACTCAATGAGAAGAAATGTGGCCTGAAAGAAT
GACTCACCAGAGAGCTGCACAGCTATGCAGAGGGACCTGGACAGAGTGGAGATGTGGGCT
GACAGGAATCTCATGGAGTTCAGCAAGGAGAAGCCCAGAGTCCTGTACCTGAGGACTAAC
ACAGCAGCAAACAGTACATGTTGGAGGACACCTAGATAGAATGGCAGAATAGAACGTGGT
TGTCCTGGTGGACACTAAGTTGAACATGAGTCAGCAACGTGACTTTTCTGCTAAGAAAGT
TGATTGTATTCTTGCCTGCAGTACAGGAGAGACATGGGCATGCTGGAAAGAGTCCAAGGG
AGGGTTACCAAGATGATCAGGTGATTAGAGCATTTCTCCTATGAGGAAAGGCTAAGAGAG
CTGGGATTGTCCAGCCTGGAGAAGACAACTCTCAGGGGATTTCATCTATGTTTATAAATA
CCCGAAGGGAGGATGTGAATATGATAAAGCCACGCTCATTTTGGTGGTCCCTGATACTAG
GTCAAGAAGCAGTGAGCACAAACTGTAACACAGGAGATTTCCTCCAAGCATCAGGAAGCA
CGTATGTAATGTGTGGATGGTGGAGCACTGACTGGTACATGTGGCCTAGAAAGGTGTAGA
GTCTCCTCCTTGGAGATCTTCAAAAGCTGCCTGGATGTGGGCTTGAGACACCTGCTCTGG
GTGAACCTGCTTGAGTAGGGGTTGGACCAGATGGATCCAGAGGTCATTTTCAATCTTAAC
CATTCTATGACTTTGAATTTGTAAATAGGAAAAAGGTTTTTATGTGTTGGTCTGTTTGAG
ATTACAGTTCTGAGCATATGCAATCTTAAATGCTGATACCATGAAAGTAGCTGCAGTCTT
ATGTCCTGCATGTAAGTTATACAAACAAAACACATTTGTCTTGGAAACATTTTCTTTCCT
TTGATCAAAAGAACTTCATACACCAGACAACAATGTGGGCAAGGCTAATTTCTGCGGTGG
CCTCTACTCTGGGATGAATTCTGCAAGATTACAAGCCAGTGCATCCCTTCACTGCCCAGA
AAAATCAGATTGACATGGTTTTGAAGATTAGTATAGAAAAAGACATACAGTCACAGTTCA
CTGTAGTCATTACTGTCTAGGAGGTTTACTGTCATAATGGTATTTCATAATATGTGGTGC
TTTAATATTAATGTGTTAGAAAGATCTGATTAGTATTTGCCATTGTTAATGTTAGTAGAT
ATTAGTATAGATGTTCTACAAAGCTTGAGCCAAATACATTTGACAAAAAACACTTCCTGC
ATGCACTGTTGTCCAATAATTGTGAACAAAGGGTTCATTCTTTCAATCTACAAATTCCTT
TAGTAAGTTATTAAAAATGAGAGTAAGCTAGGGTATAGGATTAAAACTTCTGAATGGAAG
CAATGGGAGGAAGAAGCTAAAACATGGGAAAATAGAAATGTGTATGCTAGCAGTTTAGGG
CAGGGAGGGAAAGAGTAAATTAGGTAAGATGCTGAAAATGAACCTTAATTGACTGAAATG
TCTACAGAACTTCGGGTAGAATAATTCAGTGCAACATGTAAACTGTAAACTGGACGTGAC
TGGAATAGCGAAAATACAGTGAAATAGAGATCTGAACTAGAGGATGAGTTATTAGGATAA
CACAGCAGAGTACAGTTTGAAGCTGCCAAGTCCTTCCCTGGTAACTTAAGTCACAGAGTG
GTGTTTACTTTGGTTTTGTTCTGATAGTTAGATTATAAAACAGCAAGAACTGTAGTATGA
AGTTACCTTGAATTGTGTGGTCACAAAGTGGGTTTACTTTAAGTAGGCATTGGCCTAGAA
CTCTTTTGCTTTTTAAACTGATAAGGAAAATAATCTTCACACGGAGGGTGCTCAGACTCC
GGAACAGATTGTTTAGAGTAGCCTTGCAATCTCCATTCTTGGAGATAATCAGAATGCGAC
AACACAAAGCCCTGAAAAACCTAACCGAGGTTAGCTGTTCTTTGAGCATGGGATTAGAGC
AGATCACCTCCAGAGGTTTGTCTCAACCTAAATTATTCTGTGATTTTAAGCTTTACCTCG
TTAGTAAGGACAGGTGGCCTGAGGACCTTGTTGTATGAAGAGATCTGGACCTCTAAATTC
AACGATACTTATAAGAGCATGAGAATTTGTCTAGGGGAAAGGAAGAATTAACCTACAGAA
AAACCTGAGTAATTTGCCAGAACACTGGGTTTGTGTCATGTGTGCTGCAATCATTGTGTG
TTCTTAGCCCATAGAACATAGAGTAATTTTATGCCAACTGCGTTGAGTGATTAAGCTAAA
TGGCATTACTTTCTTTGTTATGGTGAAGAACACGCACATGTTGTGTTACAGTAGCTCAGC
TGACATATTCATCATTTCCTTAACAACTTGAACACCTGCCAAGTCTTTTGGAGTCTAATG
TATTGGGACTAAGTTGAAATGTTCTGTGTGGTGCAGTGTGGAATATTATTATGTAAGGTA
GAGATTAATAAAGGAATTAGAGTAGTGGAGAAGTCAGTAGAAAAATGATTATCACACAGG
GATAAATACACTGAAATTACGCAGGGACTGATCTTTATAATTATTTAGTATTTACATTAG
TATACCATGTCATGAGATATGACGCAAAGGAAATCTGTCCATTTTTAGCTGACTTCACAA
GAAGCCGTTCTGAGGAAAGTAGAGTGGAAAGAAAAGCACAGTCTGGGGCAGGGTTGATAG
CACAGTTAAAGCTTCATCTGAATTGATGAATATGCTTTTTGCCATCCTTGGTCAAAAAAG
ACGAGTAGGTAGCACTAGGATAGGTGCAAAGATGAGCTGCAGAAACTGGAGAAAGACCAG
TGCAATATGAGATCTGGCAGAAAAGTCCAGGAGGAAGTAGGTTGATCTCAGCAAGTGCAA
TGACGCATTTGTCACTGAACAAGGATAAAAAACATCTACTAAATTGAAGGACAAACAGCA
CAAAAGTCCTTTGGCAGAAATTAATTATGTAGAAATGACCGGTCATCTTAATGTTAAAAG
ATTTTTAGTAAGAGCTCCAAGAGAAAAAGAAACCTTGTAAATTTGGAAAAGATGATGCCA
TGTACTGCATTGAGTAGTTCTTTCAAAAAGGAAGAAATAGTTCTAGAGCATTTTTTCTTC
TAATCTTGCAAACTCGATCACTAGCTCTGCATGATGTTGCAGAAGCAAGGGGAACAGGTT
TGCTAAAGTAAACATGGTAATAGAACCATATTAGCCTTAGAAATCAAATGATTGGGGCTG
TTAATTCTATACCATGATAAGGAATTTTGTTACAAAAATAACAAAGAAGTGGAACTGAGC
AGAATGTTAATGCTTCTGCTTATAGCAATCACAGTCTCTTCACAGTATTGAGTACTGAAA
ACTCGGGAAGCTTTAATAATATATATTCTGAGAATAAAAGCATTTTTTTTCATAAACTGT
CTGATAATGTTACCTGACAGTGTGTTGTGAGCACCTTAATGTATTTTGTAATAGTAAGCT
GAGCACGGTTTCATGAAACTTGAAGAGCTGATACTTTCGGGACAGGCTTCTCTTCTTTCT
CTTTTTCCCATTTTTTCCCTGCTTCCATATGTATACCTCATGTGTTCTGGCAGGCATACT
GTTCTCTGGGCTCCAGTGTTTGTGAGAGTTCTACCATGTTAAAAAATGAGTCCAGAAAGA
AAAAAATCTGGTAGCATTCTGCAAGATGAATGCAGTGAATCAGTAGCTTGACAAGTGGCA
GAACTAACGGGATGGAATAGGATGGCAGGGCTGGGATTGAGGACAAGATGGAACAAGGCT
TTTCCTTGTTGACGGTGTTGGATTGTTGAAGCTTTCAGGTGCAGTACAAATTAAAGAATA
AGCCTGCCTGCGCTCTCAGTGTTGTATGTTTTTATTAGATTCACGTGACACTGTGAATTA
CCTTAACACATGAACATTTCACACTTCTTTGCTGTTAATTAAATAGGTAACACTGCCTAA
TTTTATAGATTAGCATTCACTTTTACCATCATAAAATAGTCTCCCTGAGGTTTCTGATGG
AGTCTGATTTCTGAACCCAAACTGATAAAACAAAGACACTACCTATGTATGTCAAGCAGG
AGGAATTGCTTCAAGCAGTGTTAGGAGCTACACCAAAGTGGGTGAGGGAGGTGACTGTCC
CTCTCTACTCTGCCCTTGTGAGGCCCCAGCCGGAGTACTTTGTCCAGATCTGGGGCACCT
AACACAGGGGTGATGCGTAGCTGTTGGAGGGGGGTCCAGAGGAGGGCCACACAAATGCTC
TAATGGCAGGAGTACCTCTGCTATGAAGAAGGTCTGAGGTAGCTGGTCTTGCTCAGTCTG
GAGAAGAGTGCTGGGAAACCTCATTGCAGCTTTTCAGTATTTAAAGGGAGATTATAAACA
AGAGGAAAAACAAATTTCTGTGCAGGTAGGTAGTGATAGGACAAGGGGAAATGGTTTTAA
ACTAAAAGAGAGGTTTAGGGAAGCTTTTCACTGAGAGGGCGAGGAGGTGCCAGCATTGCT
GCCCAGAGAGCTGTGGGCGCCCTGTCCCTGGATGTGCTCAAGGCTGGGTTGGGGCCTTGG
GCAGCCTGAGCTGGTGCTTAATCTAGCACTTAGCAACCTTGCCTCCGGCAGGGGGGCTAG
ACCTTGATGATCCTTGAGGTTTCTTCCAACTCAGTCCATTCTGTGATTCTGTTATTCAGA
TCTTTTCCTTCCACTGCTGAGCTTAAAAGCTGAAAATAAGATGAAATATACCTGTGAGTA
TAGCTCACAACTAAGTTAATTTGGATGGAATGTAGTTGATGTTTCAAACAATGAAATATC
AAGGGCCCGTGGTGGAAAGAAGGTAGAGCCTGCATAGGGCAGTCCAGTAGTAATACATTT
TTTTCTGTGTGTTTCTGCCATAAGAATGGCTTTCTAACATGTTAATTTGTTCTGCTGTAA
TTAAATTACAATTTTGTTTCTTTTTAATCACTAAATTCAAGGGAGTTACAGAAACGTCTT
TAGCAAAAATTATATCTGCAGCAAAAAGGTGCTTTGTTTCTGATTGTTATGTTAGAGAGA
ATATTGTAGGCTTGTGGGAAAAGTACTGTGACTTCTTGTTCCTTTTGGTTTTGAGTAGAA
CTGCACTGCAATTCCAACTTGCTGAGTACGTTCCAAGTCAGATAGCATATTTCTGTTTTA
CTTAAAGTAAGAGATACTGTCTCTTGATAGACATGAAATGTGGTTTTCATTATCTTTTAA
TAGTGCTATGGAGATCTGGAATCCAACAGTGCAGGAAATGTGAAGACATAAATCAGAGTA
ATCACTGGATCTCCATTTTATGTCATTGTTCCAGGCAGTGTTATTTTGCCCAGTTCACTG
TGTTTGTTTAAAAATCAAAGCAACTATGCTAAGCTTTAATTGTAATGCGTGGTTACAGAT
TGAAATAGAACAGTAACATCATCTTTTCTTCAAAGAATTAAACTTCAAAGGCCGTAACTT
TCTATTTGGACCGGTGGTACTTACTCATTCTTTGTAAATAGCCACATATTAATGTCCTAC
CTGCAAATTTTAGGGAGGCAGATTAAGCTCAGCATGTGCTTGGAAGGTTGCCAGAGCTCT
GGTGGCAGACTTCTTGCTTGATCTGACTGTCCTTTGTTGATGATTCATATGATTCATATC
ATGAGGCTGTGGACTGCTGTACAAGCAGGGCCAGTATTTTCTAATTCTAAATTTTTGTGG
GAAGATGGTATTAGAGGTATGTTTTTAAGTGTCCCTGCCTTAACTTCAAGAGTTTTGTGG
AAGTCGATAAAGCTTACAACTTTAATGCATTTTACTAGAAAACATGCAAGTGCAGGTTAA
TAATGAGCTGTGACAGAAAAGTATTAATCTTAATTTGGCTGGTAGTTTTATTGAAGAACT
AATAAAGCACTTAAAATCTTGTCAGACACGGAAAGATAGCTGTTTAAGACTTACATATTG
TTTTGAATGGAAGACATCTTTGAATGAAAGAATTCTACTGCTACAGGAAAAAATAACCAC
AAAACCAACCCGCAAACCCTCTCTAAGAAACAGTCATCAGCCACTCAATTTTCTGTATTC
CTGGAAACTTCAAAATGATATAGATTTTTTTTCATGGAGGAGGAAGAGAGGTAATAGAAG
CCACTGAAATGTATTCATAAGTAAATAGCTGTTCCTAGGTGACTTGTAGAATAGCAAAGT
GTTAATCAAATCCAAGATTTTGAAATGCATAGGCATTAGCTTACTATGTTGAATTGATCT
GATTATTTACTTATTGTCTTTTTCCCATATAGCCAGCAGCCAGCTTCGGGTGTAGCATAT
TCCCATCCAACTACAGTGGCTAGCTACACTGTCCACCAGGCACCAGTTGCTGCGCACACA
GTTACTGCAGCCTACGCTCCAGCAGCAGCTACAGTTGCAGTAGCCAGGCCTGCTCCAGTG
GCTGTTGCAGCTGCTGCAACAGCTGCTGCATATGGAGGCTATCCTACAGCGCACACAGCT
ACAGATTATGGTTATACACAGAGGCAACAAGAAGCTCCGCCACCACCACCTCCTGTCACT
ACGCAGAATTACCAGGTGTGTTCAACAAACAAAATTACTGCTGAATTACTGTGATCTTTC
TGTGTTGGGATTTTTAAGGCCAGTGTAGGATGATGGTGAGGCCCCACCTCGAGCACTGTG
TTCTGTTTTGGGCACCTCAGTACAGAAAGGACATTGAAGTGCTGGAGCAGGTCCAAAGAA
GGGTACCAAGGCTTGTGAAGGGCTTGGAGAATATGCCCAATGAGGAGTGACTGAAGGAAC
TGGGGCTGTTTAGTCTGGGGAAGAGGAGGCCAAGGAGAGACCTTATTGCTCTGTTCAAAT
ACCTGTAAGGTGATTGCAGCGAGAGTGGAGCTGGTCTCTTCTCACTGGTGACAGGTGACA
GGACGAGGGGAAATGGCCTCAAGTTGCACCAGGGTAAGTTTAGGTTGGATATCAGGAAAC
ACTTCTTTACAGAAAGGGTTGTTAAGCACTGGAATGGGATCCCCAGGGAGGTGGTTGAGT
CACCATCCCTGGATGTGTTTAAAAACCGTTTGGATCTGGTGCTCAGGGACATGATTTAGC
AGAGGGTTGTTAGGGTTAGGGTAATATGGTTAGGTTGTGGTTGGACTTGATGATCTTTAA
GGTCTTTTCCAACCTGAGCAATTCTGTGATTCTATGTTTGTAAACTTGTGACTTCACATT
TTGTCAAGATGTGCATTTTTTTTTCCTACGTATTTTATAGGAATATGATAGTCACTATGA
AAAGCTAATGAAAGTAGTTGCTTTTTTATTTACAGAAGTAGTTTGTGAAGGAGAGTAATT
TAAAGCATTTGGTTAATTTTGGCAAGGTGTGTCAGGTTTTTCTTCAAGCATAAGGTACTT
GTAAACTAATTTAAAGTGTTTATCTATATACAATGCCTCTGTAAATATTTTTTCAAAAAA
ATGTCTTCAGTGCAGATTAGAAGGAAATGTCATTAGATTTTTTTTCCTCTGCTAATAACC
TTTATTTCTCCAGACGCGTATTTTAAGGATAAGTTCACTGTTTTTTCCTTTTTAAATGTT
TAGGATTCCTATTCTTATGTTCGATCTACTGCCCCAGCCGTAGCTTATGACAGCAAACAA
TATTACCAGCAGCCAACAGCAACTGCTGCAGCTGTGGCCGCTGCTGCCCAGCCTCAACCT
TCAGTGGCAGAGTCGTATTACCAGACAGGTGGGTTGCATGCTCCAAACTCCTGTTGTTAT
ACAATGTAGGTACTGCTTTGATATCTTAAAATATATGTACCCAAAACATACTTCTAGGGA
AACTTTTTGCTTATTCGTCTTGGAAGTTTGCTGAACTAGGTCAACATGTCAAGGGTAGGT
TCAGTTGGTAATTTGGTTTGACTTATCTGTAATTCTTTAGTTAGTTAATGTATGTAGATC
CTTAATTATTAGTATCATGACTGCTATAAAGAATAATTACTTTTTTTGCATTAATAAGAA
GTGATATGAAAATTTAGATGTACTTCAGTTTAGCATACTCCAATAAAACTACTGAATGAG
AAGGTTAGTTTGGCAGCACTGTTAAAAACAAACAAACAAACGAACACAGTAACTGATTCT
TACTAATATAACAAGAGATATCATTATGCAGTGGTGAGTTACACAATTATACAGTGCATA
ACTATGACTTCAAAAATAAATAAATTTTTAAAAATATTGCAAAAGGAACCAAGCAAAAAA
GCTACCTTCACTTGTTAGATTTATTCCCCAGAATATAATCAAATATCATTAAATATTACA
TAATATGGTTGGCACTTCATTCAACTAAAGCCTGTCTATGTTTGTACACTTATATTTTCT
ATCCTAATTAGCTCCAAAAGCAGGATATAGCCAAGGGGCAACTCAATATACTCAAGCCCA
GCAAACGCGACAAGTAACAGCTATAAAACCTGCAACCCCAAGTCCAGCAACAACTACGTT
TTCTATATATCCAGTATCCTCTACTGTGCAGCCTGTAGCAGCTGCAGCTACTGTTGTTCC
ATCCTATACTCAAAGTGCAACATACAGTACAACAGCGGTTACTTACTCCGGTAAGAATTT
TATAGATTATGCTATTGAGATCTTTGCAGTTGTTACAGAAGGTTACAGGATTTAAATGTT
CAGAATTTTAGCATTTTGTGTTCAGTTACATCAGCCTACAGAGAAGTATCAACCACTTAC
ATAAAAATATTTTGGCAATATAATGATCTATCTTTAGAAGAGATTTGATGCTTAAATATG
CTTATTTTGTCCCATGTGAAAATATACCGTATACTGACAGTGTGTTGAGACTTACCATAA
GATTTAGAGAAAAGATGAGGGGGAATAGGAATAAAGAAGGAGACACATCCACACAAATAT
TAACCCAGGGAAATGGGAAGGAAGCGTGATGCCATGAAACAACAGTTACAGTGGCAGGGA
GGAACGATCCATTATAAATCTTATAAGTCTGGGTTGTATTGAACCAAAACAGCAGACTGA
TCAGTGCTTCAGAGGAAAAGCAAACAAAGAAACAAAAAAGCAATCATCTTTCCTTCAGTA
ATTAGAAATCCAGAATGAGCTGGCAAACTGGCATATTATAGCTAGTTTGAGCATTTTTAT
TTTGTTTCTTTTCTGTTTGTAAGAGGGATTTTAAAGGGACTGTCTTGAAACAGTACCTGA
TCAGAGGGTTAAAGTAGTAGAACCAGTAAATGTAGAAAGTTTGTGGGAAACCTGGCTCAA
AGGTAAAATAACCCAGTTTCCTTGACTTATTCAACTTCAGTAGTACCAGTCAAGGAGTGC
ATACCTAGTGTGTGCTGCAGAGGTTTTAGCAGCCCAGCAGCTTTGCACTAAAACAATTTA
AATCTCTGAAGTAGAATGTGATAAAGCAAGTTGTTATATTTTTTGTATTCATTTTTTTCC
CCCCTTCCTTTACATAATCTCTGTCTTCATTTTCATCTTGAATCTTGAACTGTAAATCTG
GCTCAGAAAAACTGTTTACTTGCCTTTGATAATTATTCTATTCTTGTTACATCATAATGA
GACCTCCAGGAATTTTCACATACTCTTTAGGGATGCTAGTTATATCCAACAACATAACTG
TGCTTTGCAGAGATGTGTCAAAAATCAAATAAGTTTCTGATAAGAGTGGTATGTTACGTG
TTTGTGTACTGTGAAACATTATGAAAAACCCAGACTGCTTAACAAGATCTCAATACTTTG
TTCGTATTCTGCCCTGCTCCCTCAACTTTTATTACAACGCATGCTTGTAATTTATGTGTT
ATGTAATTGATACATGATGTACAGTGATGTAATATTTATTTTATTTTGATCTTTGAGGTA
CCTCTTATTCTGGCTATGAGGCTGCAGTGTATTCAGCTGCGTCGTCCTATTATCAGCAGC
AGCAGCAGCAACAGAAACAGGCAGCGGCAGCTGCTGCTGCTGCTGCAGCGACAGCTGCTT
GGACAGGGACCACCTTCACTAAAAAGGCACCATTCCAAAATAAGCAACTGAAACCAAAAC
AACCTCCCAAACCACCCCAGATCCACTACTGTGATGTTTGTAAGATCAGCTGTGCTGGAC
CACAGGTACCTGTATTATGTAATATTCTGCTATACATTTTTGTCACCGTTTCTCCAGCTA
AGAAGACTCCTTCAAAAATATTTGTTAATGTTTAAGGACCTGTTAAGGACTCTGTAATTT
TATTAATGGAATAAATAATCAAAATGTGTGCTGTTACAGAATTACAATGAGAAAACAGAA
AGGTACCTTCTGTTAGCTTGTACAGAGGAGCTGCAGCTGTATTTCAGACTCAGAAGTATT
CTGAACTTTGAATTTGATTTGCTTTTTTAGCATAACAAACTTCTTAGAAAATACTTTCAT
CAAAACTCCTGAATCATATAAATGTTGTGAATGGTAAACCTGAAAATTTATTCTTCATTG
TATCCCATCATCCCAGTTTAGTTTCACAGAGGATACAAGTGTGTAAAAATTAGATAACAA
TTAATGCTGTGTTTGTGTGTGATAGGCTATGCAGTTATTTAAGTGAATCTGCCATTTTTT
CCCAGGTTGCCAATGTCAGCACAGGAGCTAATCTCAACTTCTGCATTTCATTTTCAACAC
AGCTTTCTGTGCTATCTTTATTTGAATCCAGTTTTTTAGTTCTTAGAATACACTGTCTTC
ATACACATTGATCAAAAATTGAAAACCGAGAATTATTCTGTGCAATGCAGGAAACTGCAA
CTGAGATATACTTCTGTGGTTGTATCAAGTTTTCGATAGCAGTATCTTTTGAACAGTACT
TCATTGAGGAATTGAGAAGGTGTTGGAGACTCAGACAGTATTACCTCTAAAAGTGGACAT
CTATTGAAAGGGAAGAAAATGTCCTAGTCTTACAAGTGGTCTACTTATGCCTTAGAGCTT
GTCATATGAAAGAAATGCTCAGCATACCAACTGTTTCTTACATAAAGTGTGTATTTTATG
CTCTGTTCTATACTATGTGTGTTCACGTGAATGATGGACAAACAATACAAAGGCAGCTTA
CTGTGTGTGTATTATTTGTTTAAACAGACTTACAAAGAACACTTAGAAGGTCAGAAACAC
AAGAAGAAAGAAGCAGCGTTAAAAGCATCCCAGAACACCAATAATAGCAGCACTTCTGCT
CGTGGAACTCAGAATCAGTTGCGCTGTGAGCTTTGTGATGTGTCTTGTACAGGAGCAGAT
GCATATGCTGCCCATATCCGTGGAGCCAAGCATCAGAAAGTAAGAACTTTCTCTTGTTCT
TGATGCTTGTATATTTTTCTGCTCATCTTAGAGGAGAGAAAGTGAGCGGAGAAACAATAC
AAATAATTTGAATAATTTTGTTTAAAAATATTTTGTTCTGCATTTATTTTTAAACATATC
TTTAATCTCACTATTAGAAGGGCATTGTTGGGAGAAAAGGGGAAAAATATTGCCACCACA
TCAGTGAGAAAAGAATGTTTTGGAAAGTTTGAAAATCATAGGATGAAGATGTTGACTAAG
GTGGGGAAGAGAGTGAGTGAGGACATGTCCCTCCTTACTCTTTCCAAGACTATTTTCAGT
AGTGGTCTTGGTCATTGTTCCTTGGCATTTCGTGCAAAGACAGTATATGGGAGCAAGAGC
AGCGCCCTGCAGTAGACTTTATAATGAGTATTTGGAAAAATTTGGTAAGTGTACACTTAG
GTAGGAATTCTGGAATACAGAGTACAGGCTGCACTGTGAATCCTTGTGACCCGTGTTTGA
ATTTGGCCGTACAGTAGTAAATGGAATGTTGGAGTGGGTCCAGAGGAGGCCACAGAGATT
TTCAGAGAGCTGGAACACTTCTCGTATGAGGAGAGACTGACTGAGTTGGGCTTGTTCAGC
CCAGAGGAGAGACTCGGGCCTTTCAGTATTTAAAGTCAGCTTATAAACGGGAGGAAGACC
TACTTTTTACACAGTCTGATAGTAGTAGGACAAGGAAGAATGGTTTAAAACTGAGAGGAG
ATTTAGATTAAATATTCGCAGGAAACTTTGTATTCAGAGAATGGTGAGGCACTGGGACAG
GCTGCCCTGAGAAGCTGTGAATGTCCCATCCCTGGAGATGTTGGGTGGAGGTTGGGTGGG
GCCCTGGGCTGCCTGATCTGGTGGGTGATAACCCTGCTGCAGCAGGGGGCTTGGAGCTTT
AAGGTCCATTCCAACCTAAGCTATTTTATGCTCCTATGTTTCTAGAGTTTAAAAGTTTTC
TAAATACATTTTTTTTTGTTGTTAGTCCAGTTGTTAGTACAATTTAAATTGACTTGTCTA
GTATTCTTTCTTTTATAAATACATTGAGATGTTAAATTTTTGGGTTATGCTCAATAATCA
CATAAGTACATGAGGTGTGATACTTACTGTCCCCATGCACTTGGATGTAGCTTTCTCTTC
CCTGTAGGTAGTCACTAGCCACTGCTTATTTAGGTTTCCATCTGTGTAAAACTGAAATCT
CAATCTATTACTTCGGTACACTCTGAAGAATCTTGTCCATTCTGCTGCAAAAAGTCATTT
GAAGAGTTGCTTAAACTTCCACTATTACCAGACAATATGTCTATGGGCAATATGATTTAT
TTAAAAAATAAGAACAAAGAGAAAAAGAAGTGTGTGTCCTATTGTATACATATTATCATT
GTCTACAGGTGTAGATAAAAGCAGACTTTTCTTGCTGGTTTCAAATCTTTCTTGATCTTT
AGCTTTCATCATGTGTATTTGGTTTTTATGAACCCTCTATATTCCTTTCTCAGGTGGTGA
TTGGCTGTCTGTAAAAGGAACTACTATTCTGTCCTTAAGCATTACTTCTAAGAGTAAACA
CTGTGCCTCTTCGTTTTCTTGAACTTTAAGGAGCACTGAAATACTCCTCACACATCCTCC
TTAATTATCTCTGCAGATCTGTATTTAAAATATATATATATATAGAAAGAAAAAAGAAAC
AACCTTTCCCTAATGAATCTCTTCAAATTTGCTAGATAATTTGGCAGTTCTTTCAGTATT
CTTAAAAGATAGTGATTAAAAGAGACAGTGTTCCTGAATTTGAATTAAATAACTTTTATT
TATAAGTAATATTTGGAACCAGAATAGCTTAATGTACTATGGTTTTTGAAGGGAAGAAAA
AACAATCAGGCAGCAGAGCAGTGACATAGGAACAATTTGAGCAAAATGCTTCCTTCTGTT
TTATTGTCTTACCAGTTTATTGGCTTTCTGTTCTCACACACATAGCTTTTGGAGTAAGTA
TGTGAATTTGTGATGAAAATAAGCAATCTGGGATGATGATTAAGTATTTCCTTGTTTCAG
ATGACAAAAGCTTTTACATCTCCATCCTTTTTGTACCAAGATCAGTTTTTGTTAAGAAGC
AGTAATTAACTTTTTAGTTACTGATTTTTTTTCTTTGATATTATGTTTGTGTTTGTATTA
GAGCTTCCATAAGCTATAAGTTCATTTTTTCTAGTTTTCCCAGGGAGGTGATATGATTTT
ATTTTTATTCTTACAGGTAGTAAAATTGCACACAAAACTTGGCAAACCCATTCCTTCAAC
TGAACCAAATGTGGTTACCCAGGCTTCTTCCTCAACATCCACATCTGCTTCCAAACCAGC
TGCCTCTGCTTCAAGCATAGCAACTAGCAGCAGTACTGTGAACTCCTCTGTTGCGTCCTC
TGCGGTGAAAATTCTTACTCCCACGGCAAACACACCACTTAACACAGCGTCCAACAACAA
AACATCTTCAACTGCTGCTAATATAGCAGTAAAGAAAATATCTACACCGAAAATAAACTT
TGTTGGCAAGTACAGAAGTCAGTCTTTATTTTGAAACCTAACCTCTTCCATAATTTTTTT
TAAGATCTTACTGTAGCTAGTACAAATGTATTTAGTTAACTATGCATGAATAACTCTGTT
GTATTTAAGAGAAATACTGATAGGTGAAAATAAAAATGCATATAAAAGTTTTGCTACACA
ATTTATTATGTTTTTTGTCCTGTTGTCTCTGCCTTTCCTGGAAGCTTCTTTGTACTTCAT
AAGAGTGTAGTAACTTCTGGAGTACGGCAGTTTATGGTCCAGCTGGTCCTAATTTCAGCT
TATAGCCTGGGCTGTTAAAGCACAGTGGTAGTTGGTAGCTGGGCAACTGGAACATCCTTG
TAGTAGTGGAAACGTAGCACGGGAAATTTTGTAATGAGCATGACAGACTTTCAGAGATGA
GAAGCAGTTGTTCCAAAATAAGCTTATCCTGCTCTCGAAGGAAAGACTCTATTGTTGCAG
TTGCAACAGTGGGAGCATAGAATCTTTGCTAATGCAAACATATGGTTTTAATTACTTTTT
TTTATCCATTTACAAAAATAATATCAGATGATGAGAAGAGATCATTTCAGTATCTCTGCT
AAACTGTTCCCTTTAATTCTTGTCACTTTTGAAAAAGCATGAAAATGATGAAAATTGCAG
TTACTTATGTAACTTCTGTTACGTAAGTTACATTTATGCAATGAACTTTTTCATGCTAAA
ATAAAAAGCTAATATTAAGTGTTCAAGTAACTTAGATATTTTAAAATATATTTATTCAAA
TAATGTTTAATTGTAATTTAAGCATAGTTAAGTTTTAATTAGTTTTAAAAGGCTTCTAAT
GCTTTGCCCAGGACATTGATACTTGTAAATGAAGTCTTCAGTGTGCATATCACATGTAAT
CATACTCTCATTTGATGAAAGCTAAAAATTGAAATGTTTTGATTTCTAGGTGGCAATAAG
CTTCAGACAACAGGAAGTAAACTGGAAGAAATGAAATCAACTGAAAGTGTTAAAACAACT
CCTACTGCCACGGTACAAACACAGGAAGTGAAACCAGACACTGCAGCTGAACCAGTGACT
CCTACAACTCTTGCTGCCTTGCAAAGTGATGTCCAGCCAGTGGGACATGACTATGTGGAG
GAGGTATTAATATGACAATTTGTGGTGTTTTTTTAGCTGTTTTGGTGAAAAATTGTTCAG
AATGAAACAAAACATTGAACCTGAAAAGGCTTGTTTATGTGCTTACCTTAGTGTATTGTG
TGCTTTTGTTTTGAGTTTAGTGAGACACTATTCATGTTGGTGGGGTGAAGTGTATAGGAT
CAGAATCTGATGTCAGTTTTTCGTATTTTGCAGATTTGCAATTACTGACTTCAACTCAGT
ATGTTCGTGTTCAGGTTTGAAGCTGCCTATTCTTTTGAATGGAAGAACTCTTTTCATATC
TAAGCACAATGGTGTCTCTGACAGAACTGAAAGATCTAGTTTGTCTTATTTCAGTTAGTG
TTTAGACAAACATTTTAACGTGTGTTGAAATCAGACAGTATCTAATATCACTGAATTAAA
TTCATTTTTGCATCAGTTTTGGGTTTAAAAATCAAAACCCACAGAAACACGTGTTACAAT
CTTATTTTCCAGGTAAGAAATGATGAAGGAAAGGTGATCCGCTTTCACTGCAAACTTTGT
GAATGCAGTTTTAATGACCCTAATGCCAAGGAGATGCACTTAAAAGGAAGGCGGCACAGA
CTCCAATATAAGGTCAGTAGAAATGTTTACGCTTCTGTCTGAGAATCTACCAGATGTCAG
CGGACTAATTGCATGGTTTTACAGTAAGGATTACCAAATTAAGTGTTCTGAGCACATGAA
AAGGTAGAGAAATACATTCACCTTCTAGTTGATTTTCTTTATAGTTTTTAAATAAGTTAA
GCAGACTGAAAATGCATTTTTATTTTTTATTTTTATTTTTTAACATTTTGAATGCAATAT
TTGGGGACATTTGCAATGTTAAAATACGGTACAACAGCAAGCAACATTAGGGTTCTATGT
TGTTTACCATTAATTTCAAACACTGTGTGAATAGTTTTGTCAGGGTAGACTACGTAAACC
TTTTGCAGAGACATGAGAAACAAATGTAGGCCATTTTTTTCAGTCATGAATGGAGAGAGA
CTGATGTACAATATGCATTTTGGTTATTATAAAATTACATAAGAAGAATCTGCCGTGGTT
ACTGGAGAGGTAATGGGCCTGCATAATCTTGAAAAGGATGAAAGATAATTACTAGAAAGA
TGTTTTCAGTAATTCATGAATATGTTCTTTCAGGAACAGGGTATCAGAAAGCACATAGTA
GGAAGGAGGATTTTTATTTTTTTTTTCTGGCTACAGAGTAGTCATCCAGCTACAGAATGA
ACAGTAAATTATTAGGTATTACATGAAACATTTTAATCTTAAATTGCTTGGTTCTTGAAG
CAAGTGAAGAAGGAATTCATGCTGTTTGTAATACATCATTTCTTCAAAGTAGTGGAAACA
TATTTCTCTTGAACTACTCAGTGTAGTTCTAGAACTGTATTTTATTCCTCTTGATGTTAT
TGTGCACAAGTAGTGTGTGTTAAACATTCCAGAAAAACTGTTTTAGCAATGAAATGATGA
GAGAAAAACCAACATTTCCTTTTTTTTTTTTTTTTTAACTAGAAAAAAGTAAACCCAGAT
CTTCAAGTAGAAGTGAAGCCCAGCATTCGAGCAAGAAAAATTCAAGAAGAAAAGATGAGG
AAGCAGATGCAGAAAGAAGAATACTGGAGAAGGCGGGAAGAGGAGGAACGCTGGAGGATG
GAAATGAGGTAAATGCATTTATACCAGTGAGGCAAAGCTGCAGTGAAATTAATCTAAAAC
CAGTTGGTGCCTCTGGAGTTGGTGCTTTTGAATGTTATGGGAGCTCTACACTATCTTGTT
TTGAATTAAATAGTTGTTAACCCTCTAGGGTTTTTTGTTCATTAGTGTTTAGTCCTTCTG
AGAAATGTAGACTTACTAGAATTACTTTGCTATAAAGAGTCTGACTTTCAAAAAGCCATT
CATTTTTGTTTGCCTTCTGGAGTTTCCTGATATTTGCAGATGACTACTAGAAATGGGTTA
GAGAGGACATCCAAGAATTCATTACAATGTTTGGAAGTGCTAACAGCTATGTAAAGGGAA
TGTTTTGTTTGATGCACTTCAGGCGATATGAAGAGGACATGTACTGGAGGAGAATGGAGG
AAGAGCAGCATCATTGGGATGACCGTCGTAGAATACCAGATGGGGGATATCCTCATGGTC
CTCCAGGACCTCTTGGCCTGCTGGGAGTTAGACCAGGAATGCCTCCTCAGCCCCAAGGAC
CAGCTGTGAGTTTCTTAAGGGGGGGAAAAATGAGGTCTTACTTACCAGGAGGCACAGTTA
AGGACTGTAAGTTACGCGGTGCTGCATTGTCTCCAGTATTTCTTAGTGAAGTATTTGTGT
AGTGAACAAAAAATTATACGTGAACCTGTCTTCCTACATAAGTCCACTTATAAGAAGAAA
GTATGCCTCAAAGACAAATACTGGTTCTTATGAAATACATGTAATTGTGGGTTTGTGTAT
TACTTTCCATTTAAATGCGTTATAGAACATTATTTTCTTGATCTCTAAATATCATTTCCA
ACCCAAAACATCTTATGATTGTGGACAGATGTATTTGTCCAAAAGTGGCTGGATCATCAG
TCCCAGAGGATGGTTGGATTTACCATAGAATCATAGAATACTTTGGGTTGGAATGGATGT
TAAAGCCCTTCTAGTTCCAACGCAAATTCTGTGAGCAGGATTGCCACCTACCAGATCAGG
CTGCCAAAGGCTCCATCCAGCCTGGCCTTGAATGCCTCCTGGGCAGCCTGTGCCAGTGCC
TCACCACTCTGTGTAAAAAAAATTCCTCCTAACATGTAATCAAAATCTCCCCTTTCTTAG
TTTAAAGCCATTCCTTCTTGTCCTATTGCTATCAGACCTTGTAAAAAATTTGTCTCCCTC
CTGTTTGTAAGCTCCCTTAGTGGTGGGTCCTCTGCCTTGAGATTAGTAAACCCACTATAT
TAGTTTGTCTTGAGATTTGTCATGTTAGTACCTTTCAGTCATCTGAAAGTTATGGAGTGA
GTGCATGCTCAGCAGGACCATAGCTTGTTTGTGAGGAGTGTTAGTTGTTGAGGACACAGG
TGGTGTTTTATTGCATGTAAGTGATTTGAGGTTTGAATATTCTGTGAATTTTAAAATAGG
CACACATTTCAGAAATATGCTTTTTCCTCTGTTTAGCCTCTGCGTCGCCCTGACTCCTCA
GATGACCGCTATGTGATGACCAAACATGCAGCAATATATCCAACAGAGGAGGAACTTCAG
GCAGTCCAAAAAATCGTTTCTATTACTGAGCGTGCTTTGAAACTTGTTTCTGACAACATG
ACTGACAATGAAAAAAACAAGAGCAAAGAGGGAGATGACAAAAAAGATGGCAGTAAAGAC
AGGTATTTTTATTTTTTGAGAAATTCATCTTTTGTTTCTAGAAGGCATTTTATGTTTTTT
CTCAGACTGTTCTCAGGGCTTCCAGGGATCCTGTTCTTATAAGGTTTTGATATAGCAAAT
TTTGATAATGACTGTGTCCTCAAATGTATGTGGGACATTCCTGTTTTATTTCATTTTTCT
ATCCTCAGGATTAATTTTAAGGTTTTTGAATGCAGCTTTTAACTATAATTTACTTCACAG
AGCTTTGAAAGGAGTTCTGCGGGTAGGCGTTTTGGCTAAAGGCTTGCTGCTCCGTGGAGA
CAGAAACGTCAATCTTGTTTTGTTATGTGCTGAGAAGCCTTCAAAGACATTACTCTGTCG
TATTGCTGAAAGTCTTCCCAAACAACTTGCAGTAAGTAGAATTGAGATTTTTTATGTGAT
TTCTATGTGATGATACTGTTTAAAAAAAAACAAAAACAACTCTTCATAGTATATATCATA
TTCTTCAAGCCGATTGCTGCATTTCCTAGCTCAGGTTCAGTTTCTTTTGAACGTTTCCAT
CTGATTTCAGTGACCATGCTATATGTTTTACTTTTTCTTTATTGCGGGTTTACAAGTTTC
TAGATGGTTATGCTAGTGATGTACTATGAATCATCATTTAATAGACTTCATTTAATTGTC
AAATAAAAATGAGCCAAGGTAGAATTTCTGTTACTGCAGTATTACAGGAAGCTTGCTGCC
TGAAGCTCAAAGTTCTGAATTAACGCCTGTCTCTTTTCAGTGTGTATGCTTTGAGGTTCC
ACAAGTAAGTTAACAAAATAAGTCTTGTAGCTTTTTAGTTACAAAAAAATTCCCAAATCA
AACATGCAGTTTTAGACTGTTCAGTGGAATTCATATGAAACATTTGCGATACTTCCATAA
GTAATGAATATAAAGTCTGTAGCTCCATTTCTCCCTACTGAAACCAAGTCTGCCCACTAT
CATTATAGAAGTCCTGCCATACCGTCAGTGTTTCAGTACCATTCAGGGAATTACATGGCA
GAATCAGTAGCATCATAGAAGTGTCATCAGGATCTGATTAATTAAGAAATAATATTGAGT
CCTGCTCGAAGTAACAAAACAAGAAGAATAAAAAATTGTACATTTTGGTCTGTGTATGTG
AATAAGTCACCTCTAGTTTGTGGAAGGAGGTGACTGATGTGCCTGTTGCTTCTTGAAGTA
GAATCATTAAATGTGGTAGCAAGAAGCAGTTTAGAATAACCATTTTGTTATTGTAACATT
TTCCCTGGGTGTTTGTCTGGCCCTTTGTTCCTGTCTGAGGATGCTGTGACAGCCAAGTAG
AGAATCTCCCTAGCAGTACTCAGCTTGTAAAAGTGAAAGCTGGAAGGAGAGGAACTGCTG
CAGCTTTGTGGCTGCTGTATTCGAACGGGACACATACCCTGTTCACATTTCAAGTGGCTG
TGAGGATTTATTTTAAATGCTGTTAGGATTCATGTTATGTAACTTACTTTGCATGTGAAT
TCCCTTTATGAGTAGTGCTTTTTTGCATGCTTCTTCACTACTGTGTATTTTCATTAATGA
TTTGGAACAGTGTATAAGTCTGTATCTATATATATCTCTATGTTTATACATTTCTTTTTA
ATTGGATATACTGTGACTCCTGTGAAAGCACATGAATCTGCATTGTATAATTATTACTGT
ATTTCTTTCTTTCTGTTAAAAAGAATTGTATTGACGTCCATTTTCTTCTCCATACTTGCC
TTGGTCATCTGCTAATAGAAATCTCTGTTTTCCAATATTTAGGTAATAAGTCCTGAGAAA
TACGATATCAAGTGTGCAGTCCCAGAAGCAGCAATAATTTTAAATTCATGTGTGGAACCC
AAAATGCAAGTTACTATCACACTGACATCTCCAGTCATTCGGGAGGAGAACATGAGGGAA
GGAGGTTGGGAAGTTGTTAATGATATTACCTCTCTCCTATGTATTTTGATATGTTTATCT
ATTCTGCTTAAGATGGCATTAAGGTCCTGGAAGGTAACATGCTGGCACAACACTGATTGA
AACCTTGTTTTTCAACAACCAGTCTTGGTAGACAACAGTTGGTTAAAATAAATACTTACA
TGATGCATTTATTTAATTTTTTTAAATTCTAACTTTATGTCCAACCTCAGCTTTCTGGAA
AAGGTACGAACTTGATTATTTTTTCTGCTCTTCATATTGATTAAGTGAAAAACTAAGCAC
TCTGTAACAAGTGGCTATAAACTGCGTTCTAGAGCAGTCTTGCCTTAAGAGAAGGATTGT
ATCCTTTTAGAAAATGAAATCACACAGTTTTGGATTTAAACTGGATCGGTATTACCATCA
CTTACACATTCCAATTAGCATTGGCACTTAAAATGCACTTGTGTAATACTTTTGATGGTA
ATAGCACTTCTGACTTTAAAAGACAGTGCAATTTTTTCCAGCTCTCTGAGGTTGTTTTTT
CAGTCTGTAGTGCTTTTTGAGTACATTTTAGGCTTCTGGTACTATAATGAGTCTTATATC
CAACTGGCAAACCCAGACTAGTACAGTGGGAAACAGCTTGTCATTAAGCTGAAGAAGAAG
GTGGTGTGTGTAAATCAATTTACGTTTCTGAAGTCCACGGTTTTCTGGTGCCAGCAGTGT
TGCTTTAGGGTCTATTCTGTAACACTTTCAAAGCTCCAAAAGCTTTTAAGCCAACAAGCA
TGATTAATGTCTGCAGTACATTGGTTCTTTTTGTCTATGGGTCAGATAAAATTAACGTTT
GTTTCCTTTTAATCCTGTACTTTCTTAGTTGAAAGACATCATGGCAAACAGGGTTCTGGT
GTTTGACAGTGAACCTACAAATAGGAAGTCTGGGGTTATTTTAATGCTTCTCATGCAGGT
TGAAAAAATTGTACGTGTTTATGTATATATGTGCTTGTGTATATACATATTTATATAAGC
TACAGTTGTTTTTTTATTTTATCTCGTCATTCCATGTCCTCTAAAATATTTGAGGTTTTT
ATACTGCATTAGTTATGTTCTGTAGCTGTGACTAGTGCATTATAAGCAGACTGAGTTAAC
AAAGTCACCCTGTGTAATCAGAGAAAATTCCAGATGTCTCCTGTAGTTTGGATGACTTCT
GAAGAGTAGTTAAGAATGCTTTGTACATGACTGCTAAGCTGTGCCTATCATACCTACCCA
TGAATGTTTTATACATAGACTGTCACATCCAGTCAACACTACTCGGGATTTGGCAATCTT
TAGTGCAACCTGACTCTTCGTTGGTCTGTGTTCAATCTGACTTTGCACATTGCTTAAGTT
TATAAAGAATACTTTCACTTAATGGCTTTGATTATTAAGTCAGATAATCGTTAAAAGAAT
TTAACCTTAAATGCCATGTTAATGTACTATGCAAAAAGTGCAGTATTGATTTTGCCACAG
TACTCAATTGCAATTAAATTGCTTGTGGTCTGAAATTACATTATACAAGCTAAAAATAAA
AATAAGATGCCTACAATTAATGCCTCAATTTTTGCCGCCAAAAGGAAACAAATTTGTATT
TTTGTCTGACCCACTCTTGAGTTAAAATGATCACTGTGAGTTTATTCACTGCTGAATGCA
GTACTGCCTCTGGGCAAGCAAAATCAAGTTAGATTTCACTCCAAGACACTGAGCAGTACG
AAATAGATGTTCAGCAAAGTTCACTCTTGAAACAAGAGAAAACAGAAGACTGAATTGCAA
ATTGTTGCGGCAAAGAAGGCCTTGTTAAGAAGACTGCTGCTTATTTGCTGCAGAGTTACA
ACAGTGCGTGTTTTGTGTTCTTTTTCTTACTGCAGCTTCTCATGCTCTGTGTCTTAACAA
TGGTTACAAGTTTTCTTTTTTTTAGCTCGCTTGGGGAGCTAGTTCAGGTGATAAGGAAGG
CTTTACCGGAAGAACCAGTTTGAGTAAAGATGAGACTGAGACTTACACACGGAGAAGAAT
TATGTTTGATGTGTAATAATCCTATTACATGATAAAAACAATACGGTGTGAAATAAAATT
GTTAACCGCATAGCTACTGTTCTTTACAGTGTTCTGCGTTTGACAGTTTCCCAAATCTGA
TATAATTGAAGTGCCCTAACCCCTGCTGTGGAGTCTTTCCTTCAGCAAGCAAAGTGTACA
TATCTATAAAGCATACATGTGTGCGCGTGGTTTTTTCTATCCTTAGCTAACAGCCCCGGT
CCAAAGCCTTCTAGCAAAGAGACTTGATTCCTGTCAGGGGTTGCTGCCAAGACATCGGAA
GGATTTTTGACCAAGGTTTTCAAAAGCTCACTGTCACACCTGCCATACTTTACAAAGAAA
GGGGGTTTGGATGCATCGTCCTAGCATCTGCTGTTACTTTGTGTTTATTTTTTGTTTGTT
TTGTTTTTCTTTTCGTCCTTGTCTCTCTCCTAGAATTAAGCAGTGTTCACACTAGTTTTG
AAATAGTTGACTGGGTAATATGTATTTCGCATAATAATGCTACGAAATTGATATACCTGT
TAACTTTTAATGAAGAAGTAGTGTGGACACAGCATGTCTAACTGAAGATTAACCCCTTAT
ACTTAGACTAGTTATAAATATGTTACATAGGGTGAGAATTCACGATTGAGTTTTGTGAAT
TAACTCAACTCTGTGCTTTAGTGTAACAGGGTGGTAGCTTGGGGGTCTGAATTTAGTTAA
ATAGTCATTAAGGGGTTAATCCTATAATGTGAAACAGATGCAAAAATCCACAGATTAAAT
ATTGCAAGAGTTTCCTTTTCTTTTCAGTCAGTGTTTTCTCAGTGTGAGAGGTGCCTTGGC
AACTTCTGACTTTCACAGTCTTTTTAAGTTTCAAGGGTATTCATATGTTCCTTTTATATT
GGTAGCACACTTCAGATGTCCATTTCTAGCATTGAGTAGGATTCTCTATTATGCACTTAG
TAGTGTATTACTTTTTTGTAAAACTGTTTTCCGTCTTGGGAGTTTTTGAGAGCTAGAAGT
CAAGTAAGTGGAGTTTAAAATGATGTAGTGAATTGCTGTGCTGAAAATTTGCAATGTCAC
CTCATTGCATATTAGTTTTAGAAGAATGTAAATAATGAATAATTAGGCCCATCAAAGCCA
TACTTCTGCTTTAAATTTCTCAGCTTTACTTTGCCACTCTTTTCTTCTGTAGGTTTTCTC
TTAGTCTACCCCTTGTTGCTATTTTCCAAGTTGTGCTCATTTCATCAGTTATCTTACCTG
GCACCTCTCTTGCATAGGTTTGGGGTTTGGTTTCATTTTGTTTTGTTTGTGTTTGGTTAT
TTTTTGTTGTTTTAAATGCCACTTTAAATGTGTTCATTTGCTCTGTAAATGCTTTTTTAG
TTCCTTCTTTCCACTTTAACGTATGGTCCCTAAGTCTAAGCATTTTTGTGAGAAGATAAT
GTTATTCTCGACCTGGTTCTTATTTTGAAGTACTTTTCTATTTAATTCTGTTCAGAGCGA
TAAGGCTATCATATGAAAATGCCTAAATCTAAATGCAGTACTTCAACTTAAATTTAACTA
TAATACTGGAAATTTGTAGCGCTGTGCCTATTTATAGCTTCTCATCCTCAGGAAAGTATC
TGACTATTTATTCTGCTTTTCTAGTAGAGTAAGTGGCAGCTTCAGACCTGTCTTTCTGCA
GCATCACTACATGTGACTTACCTAAATTTATGTCTTGCTGCCATAAACTATATTGTGTCA
TATAGCCACCTCCTGTGAAATGCACGCCATTGAGGACTTTTTGTTTCTTCCTATGTTACA
TTACCAATTATGCTACCAATATTCCTTACTGCTAGCCACAATAGCCAATTTCATAAATAA
TAAATTAATCTTTAAAGCTGACTGCTGCAGCACAGCCTTACAATTGTAAGTAATCTGAAG
ACATAGTTTCACTTTATTCAGTGGTTCCTGTGTCATTGATTAAACCACTTCAAAAATGGC
ATTGTGATCTCTTCCATTTAGGTAACAAAGCAGTCAGCTCAGTCAGCATGTCACTTAATT
AATTTTCTGAATACTTAATAGATGGGATCTTCTGTATTATCTTTACCTATCAGACATTCT
GCTTTGTTTTTTAAACTATTCCTTGCTTTGCTTTTTTCTACTAAGTCTTAAGGAGCCCCT
TTCTTTGCATCCTAAGTTATTTTGGAGCACATATGTAGTGGATTGAGGTATTAATTTCTC
TGAATAAGGGAGGGTTCTTAGAAAGCAGTGGAACTCTGCAATATTGAAGAGCATTTCCAG
TTTCTGTAGTCAGCTTTTAAAGCAAAATCATTATGTTCTCATGAGGTATAATAATAATAA
TATTGTTACAATATATCTAAGTTTTTTTGAGATTTTTTTATACTTTTCTTTTGAGGTCTA
GGTCCTAAAAACAGATGACAGTTAAAATATACAAAGTTTGAATGTTTCTACTTGGTTAAA
GTGGATTTTTGTGTTCCTTCTGTCTTGTGTTCTCTGTGCTGGTGCACTGTGTCCAACCAT
CCTTCCTTCAGTAGTTAATTTTAGGGGATATGTATTTTTCTAGTGGCAGCTTAAACAAAG
AAGCACTAGGCATTGCATAATCAGCAATGCATTTGGAAGTAACCAAAAGCATTAAGTATA
TTACACTCTTGATCTTCACGTTGGGTTGATGCCCTAATCCTAGTTGAATACTTTTTATGG
AACGTTTACACTCGTTCAAGGGTTTAAACTTCAAATGGCATGTGTGACATTGAAGCTACT
TTAAGGAAGTGTCTTGCTCACCTGGTCAAACACCCATTCCTCACTGCATTTTGCCAATTC
AATCCATTTTAGATGTAACCTCGGGTATGGTGAAAGACCCACCGGACGTCTTGGACAGGC
AAAAATGCCTTGACGCTCTGGCTGCTCTACGCCACGCTAAGTGGTTCCAGGTTCGGAACA
TCATTTTACTTTCTTCTTGTAGCCTTATGAGAGATTAAGTTCAGTTGCATTATAAGTGTT
TAATTGTCTGAAAACACTCAGCGTTGTTCATGCTAATAATACTTAATATTTTTCTGGTAC
CTAAATTTAAATGTAGAAGGTTGAGTATGGAGGAACTGCTTTATGCAGTTATGGCTCATT
TGACATGATTTTTTTTTTCTGGTCTTTGAGAAGGCGATGTTGAAAGTTTGACTCGCTTGG
GGTGATCATATATTGTATATTTGTTATATATTCCATAAGGCTGCAGAGTAACTTTGCTTT
AAATAATGGAATATGTGTTTAAAGCTTTGTGTTTAGATTTAAGACTTTTTTTCCTATTTC
TTTAAGTGCATTGAGTGTAGGGAATGAAAGGTGAGAAGCAACTGTTTGGTTTAGTGACTT
TGCATTCTGGCAAAGGCACAATAAAGAAACCAAACAGATTCCCTTGACCTTTCAGTCTCT
ATACCTACTTCTTAGACCTTTACTTTATCCTTTTTATTTCTAATATAGAAAGATACTGTA
TTTATTGTTACAAGTGAACATGGGTCAAAGTGTACAGGGGATCAAGAAATGTTATTCTTG
TATAACCTGGGCACTTTGACTTCTACCACCTTAAATTACTAACCCTGTATAAAATACTGC
TGTAAATGGCAGCTCATGGAGTAAACTTGTAAAATTATTTGTTTCAGTCTTGGATCTGAG
CTTCCATTGAACAGTGGTGTTTTAGTCTTTCAACAAGTCATATTTGCTGTTGGTGCTGGG
ATTGATTAATTTGATTTTGTATTGCTCTCAAGGCTAGAGCTAATGGTCTGCAGTCCTGTG
TGATTATCATTCGTATTCTTCGTGACCTCTGTCAGCGTGTTCCAACTTGGTCTGATTTTC
CAAGCTGGGTGAGTAATGCTCTTTTGAATGAGTCTTTTTGAAATTCATATACAGGCACTG
GAAAAGGTTCCTGCCATTAAATGTAGACTTTTTCAAGCAGTAGTATTTTTTGTTGTTGTT
TTTGTAAATACGGGGAATGTATGTAGTCCCTCTAGAAACTTAGTTTTCAGAGGTTCAGTC
ATTTGGAGATGGAACATTTTTTTTCAAAGGAATTTTCTTGTTCATATTAATTTTTTATTG
GTAGAATCCTTATTCTAGATGTTAGGTGTTTCTTATTTGCTTGTTTTAACTCTATATAAA
GAAATCAATCTTTTCTAGCCACCTACTGGTGGTTGGTTAGAAATTGTCTGAACTTTATCA
AATGAGATTTAGCAGTTATATGTCCCCAGGTAACACTGTGATAACAGAAGGCTAATCTAA
AGAACAAATGAAAAAATCACAGTAATTCCTGTGGTTGTTAATACAACCCTTCTGCAAGAT
GAAATATGACAGTACTAGTCAGTGGATGTGTCAAAATTCACATCTTGATCAGTGTCACCT
AAGAACAGGTTTCTAAGTTGAACTCATTTACTTCTTATAGTTTTTCCAGCTGGATATTCT
TGGAGAATTCCTTTTACATTGACTATTATAAAATATGCTCTCTGGGAATGCAATCTGTTT
TACGATTTGTTAACCAGAAAAGATTAGTCTGAAATAAAAACTCTCAAACATACGTATATT
ATGCAGGTAAACTGACTGGTTTGTTTCACAGACCAAATTCTGTTGCATTGTGCTGCTTCC
CGCTGTAAACTCTTCCCTTTTGGTAGTAAGAGAGCTAACATTGTCAAGGCAGTTTCAATG
GTTGTCATTATTTTAATGAACAATGTTTTACATCTGTATTAGGCTTGCAGATAATTTTAT
TAAAATACTTCTGATAATATTGATTGTGTCTGGAAAAATGTAAAAAGGTTACGTTTAAGT
TTTTATAGTAATATACGAATATCCTGCTAGTTACCATGCTACATTTCTGAAAGTTATACT
GTACAAATATAGCTTAAAAGAAGCCAGAAAAGTATTTAACCGACCTCTTTATTATCACCA
CAATACTGAACTGCCAAAAAATAACCGCTGGCATAGTTGTAGAAAAGCATCCTTATAAGT
ATCACAACACACAGAAGGCATATGTATGGGGAACAAGGGACTTTATTTTCCTCTTTGCCG
CATTGTCTGTTCTGAAGAACATCCTGAAGGGAACAGAGATTTGTGTCAGGCATAGCTGTG
TTCTCTGCAAGAAGGCTCCCTCATTTGCTTCTGGCACAGGATGACAGAACAGGCTGTGTT
GGTGAGTGACGTGGACCAGCACTGAAATCTGTGTAGTCAGTTATTCTTCTGGACTATTCT
CAAAGTCTTACTGACAAAAGAAACAACAGAGTACAAATGGTCATGTTTTAAACTTATGTA
ATTTCTGCAAGTCACAGCTGGAATTTTATAGATCTGGATACAGAACTTCTCCTGGCATGT
ATGCTAGCGGCCTGTAACAAGTAAAGGACCTTTTCAAAAAGAGCTCAACTATTTTTAACA
ATAGAAAATCCTCAGAAGATTAAACACAGAAATTGTTAGCCTCCTTATATACCTAAAAAT
AAAAACTAAGCTTGAAGAATTTTGTCAATTTCCTACAAATCATTCAAGATTATTCAAGAT
TAATTTTCCAGACGTGTAATCTAGCCTCTAATGCACACATACGCTGGGGCATTGTAATTC
ACATTGTCCTATCTTGAATCCAGAAGAACTAGATTTGAATAAGTGCAAAAACATTATTCC
TTTTTTTTTCTTTACTGCTACGTTTTGCTTCATGATTGAAAACAGCTATTACTGTTGATA
GAAGTGAGAAGCTTGGTCCAGAGTAATATGGTGGGACCATGGTAATGTGATGCTCAAGAA
GTGAAAATTAAAAGTCAAATCGAGCCAAAAATTGGAAGGAATGAGCATCCTTAATGAAGA
ATTGTAATCAACATTGCCTGCAGTAACTTGGGTGAATTTATTCCTAGGAAGTGAAAATAA
AAGGTAACATTTGAAAAACTGTAAACTAAGGGAAAAAAAAAAAAAAAAGATGTTTGCAAA
TGAAGTTTGCATATGAAGTAGTATTGAAACATCCATTTAATGCTGAAAAAGCTAAGGAAA
GCTGTTCCTTACTACTGCAAGTATCTTCTACGGGTTTTTGTTGTTGTTGTTTTTTTTTAA
ATAATATCTAAGAAATGCAAAAAAAAGAAGGAAATAGTCTCAGAGGGAAAAAAGTAGTAT
TTAAGATGCTGCTAGTCACTTAAGCCATTTTAGATGCGTTAATTTTTGAAAGTCTGTTAA
TCATTAAATGTGGGTTTTTTCCACACTTGTTGAACATCTCAGATATTGTTAGCTTATATC
CAGGAAAAAAAATCTACTGTAAACTTCAGTTTTGTTAAACTGAGGACCTAGTAATTGTTT
AGATTAAACTTCAAAAGACCATTATGTTTTTGATTATTTGAGTTTGTGTTCTTATAGCAA
AAAACATTGTCATATTCTGTTAATCTCATTAGGGATACTGTGCACTGTTCATTCAGATGG
CTGCCAGATTCAGATAACTCATCTTTTTTCATGCATACTCAAAAAAATGCTGGACAAGTT
GGCTATCTTAATGTGTGGGGTAGCAGCACTGTATAAACTTATGAAAAGCTTTTGGGCTAC
CTTTGAAAAGAGAGAGATCAAAACAGATATTTGCACCGGCTTTCTTTTTATTTGCCTTTA
TAAAACAGCCTTTTTTTGTTTGTTTGTTTGTTTGCTTCTGTGTTGTATAATGTTTTTCAA
AATTCCTATATCAAAAGGTCTGAACTGGATAACAGTAGTAGCATTATTCTGTTTCAAATA
GTCTTCTAAATTAACCAGGTTTTATTATTATTGCAGGCCATGGAGTTGCTCGTGGAAAAA
GCAATCAGCAGTGCTACTGGACCACAGAGCCCTGGGGATGCACTTAGGAGAGTTTTTGAG
TGTATATCTTCAGGAATCATCCTTAAAGGCAAGTTGAATTTGATCTTTGTATGTATACTT
ACACTGAAGTAATATAAAGATTTCTAATCTTAGTCAAAATAAGGTAAAGATGTGCTACTA
ATTAGCCTAACCATTCTAGGTGGTCCTGGCCTTCTGGACCCTTGTGAAAAAGATCCTTTT
GATACACTTGCTGTAATGACAGATCAGCAACGAGAGGATATTACTTCAAGTGCACAGGTA
AGGTTAAGTATGTTTAATGTAAATAAATTTTGATGACATTGATAGCTGTCACTGTCTACC
CTCTTCTTTCCAGAAATAAAGTCAACACAGTCATATGCACATGTAACATCTGCTGTACGA
AGCTCACAGTCCCAGCTTCAACGTAATGTGTTTTAGCTGCTGGCTGAAACAGTAGATGTG
ATGTGCACATACTATGTTACCTTTATTATGGGAAGGAAGAACGTGGATAGCAGAAGCTGA
GAGTGGTAATATCTGACACCACTTCTTCATTGTTTGACAACTTACTCAAATTTGATGTTT
GTTTCTAACTGAAGTATCTTCTTTCTACCTTTTTTGTAGTTTGCACTGAGACTCCTTGCA
TTCCGTCAAATTCACAAAGTTTTAGGAATGGATCCACTACCACAGATGAATCAACGCTTC
AACATCCATAACAATCGTAAGAGGAGAAGGGACAGTGATGGGGTTGATGGATTTGAAGCA
GAAGGAAAAAAAGACAAAAAGGATTATGATAACTTTTAAAAAAATTTCATCTTTTATGCT
GAGATTGAAGGTGATAAAATATCCATTTGTTGCCTTGTTTTTACTCCATGCATAATAATG
TCTGTTTAAAACATCCAAAACCAATTCAGAAATCAGATTTGGGATAGGACGATATAGCTC
TTCTGTGAGGTTCTGAACATTGTAATGGATGTGCTGTATCAGACAAATTATGGATGGAAA
GACTACAAATGGAAACTGTCATAGGAAAAAAATAGTTCTGAGTTTTTTTCCCTCATAGCC
TTTTCTTTAAAAGTATTGCTAACTTCAGTAACTCTTGTTATTTTTTTGTCCTTTTTTTAA
TCAACAAGTGCGTTGTTTTATCCTGACTGTATTTAATGCAGCATTTGTGCTTTTGTTGCA
ATGTGTATTTTGACATTTTATTTAGAAGGTTTTTTGTTTGCTCTTGACACTAGTTGTGTA
AGTTACCTTGTGTTCGATAGTTCCCTCCCAGTTAATATTTTACAAACTTTTTTTTTTTTT
GTAAAGTGAGACTGCAGGATTATGGTTTTTTTCTAAATGTGAAGGGGTTACAACACAATT
AGCCTGCCGTTTGAGTGCTCAGAGTTAAATGTTTTTGCCAATCTCGTGGCATTTGTCTTA
GTGTGATATAACGTTGTAATTAAGACAAACTTGTGTTAATCTAAGCAAATTTGCTGTTAG
TTGTGCATTAGCAGTATAAAAGCTAATATATACAGTATGATCTTGCAACAGTTTTAAAGC
AGCCGCATAACTGATTAATGTTTTGCATGATGTTTGTTTTTAATAGAAGGGCTTTAAAAA
CTATTATTTTAGTTTAAATGCGTAGTTCTTTGTATGATTGACTTTGTGACATAGCAAGGC
CAAAAAATAACTTTCTGACTTTCTTTTTCTGAACATATAAGCAGAAGCAGGCATTTCCCG
TTTGGACAAAGTTAATCATTCTTTTCCATCAACTTTTGGCAACATGATATTAATGCCTCT
CAGTCCTTAAAAAATAAATGTTTGTCATATCGGTGCCTGTGAGGTTATTCCTTATAGCTA
TTCCTGTATAAGATTTCTGTGATTTTTTTCAGTAATTCAGATTTTAAAAGTGAAGTATTA
ATAAGTGGAGGTTATCGAAGAAAAAACCCAGAAAATTATTTGGTGTGGCCATAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1032, 1897..2010, 17252..17534, 18543..18687, 19331..19549, 20817..21064, 22047..22238, 24496..24784, 25729..25922, 26412..26531, 27462..27607, 27982..28144, 29076..29281, 29520..29670, 31062..31203, 36072..36169, 36992..37087, 39996..40107, 40219..40316, 40659..40995
1001..1032, 1897..2010, 17252..17534, 18543..18687, 19331..19549, 20817..21064, 22047..22238, 24496..24784, 25729..25922, 26412..26531, 27462..27607, 27982..28144, 29076..29281, 29520..29670, 31062..31203, 36072..36169, 36992..37087, 39996..40107, 40219..40316, 40659..40835
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved