Gallus_gallus Locus Q6EE61_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus Q6EE61_CHICK
Gallus_gallus
Q6EE61_CHICK
Z
SNORD58, SNORD58, SNORD58
2532..2598, 3086..3154, 3613..3680
5006
TCTGCAAACAGCGCTGGCCTTGAGCTGAGGTCTCATAGAATCATAGAATCGCTAAGGTT
GGAAAAGACCCATAGGATCATCCAGTCCAACCATTAGAAAGATGTCAACAACTATGTCTT
TCTTGGCTCCCATAGCCGTCTTTCCTGCACAGAAAGGAATCTGCCGTGGCTACTTCCTAA
TTCCTTCAGCCACACATCTGGAGCAAATATAGTGATACGAACAACCCACATATCTCTGTA
AGGTGGTCAGAGGGCTGGAGCAGCTCTCCTGTGAGGAAAGGTTGAGGGAACTGGGCTTGT
TTAGCTTGGAGAAGAGAAGGCTCCGGGGAGACCTCATTGTGGCCTTCCAGCACTTGAAGG
GAGCGTATAAACAGGAGGGGGAACGGCCGTTTATGAGGGTGGATAGCGATAGGACAAGGG
GGAATGGTTTTAAACTGAGACAGGGAAGGCTCAGGTTGGATATTAGGAGGAAGATTTTCA
CCCAGAGGGTGAGCCGAGCTGTAGGGCTCCAGGAGAGAACACATCCCCACACTCGGACCA
CCACCCGCAGCCCTGAGGCGGACAGCATCCCGCCCTCTCACTCCCCCTCACTCCTGTCAG
TCCAGCCCCCTCCCGAGCTCTCGCGAGAGCTGAGGCACTTCCCGCCCTCTCCCGGTCCCG
CCCTTCCTCTTCCGCCATCGCGCCGAGGTGAGCGGCTGTGGCGGGTTGGGGGCTGCTGCA
ATCCGGCCGCATCGCGCCCCGTCTGGCTGCGGGATGCCGTGGGGAGGCGTGGAGGGGCGT
GGGGTCTGTCGGTGCCCTCGGTATTGGCGGGGTTGGCGATGGCTGGGGGGCCGTGGGCCC
GCAGAGGGCCGTGGCTGCGGTGATGACTCTCTTAGGACACCTTTGAGTTGAGTTGTGAAA
AGAAACGTAAGCTCTGAGCAGCTCCTCGGGGTAGGGCTCGGCCTTGAGGCACACAGTCCG
CCTTCTGCCTGCCTGATGATGTTTGTCGCCTCTTTTCCTGCAGCTGAGCCCCAAAGATGG
TGCGCTACTCGCTGGATCCAGAGAACCCTACCAAGTGTGAGTGCTGTGCCACGCCTTCCC
ATAGGGCTGCAGCGGGGCGATCATCTCATGCCTTTTGCCTTTTCTCTTTGCAGCATGCAA
GTCCAGGGGCTCCAACCTGCGTGTGCACTTCAAGGTATGTGGTGTGGGCATGACACCAAA
TGCTCGTTTTTGAAGGAAATGGCTTTTACTGGGTAATGTGGTGATGTAGGTTATGGCCTG
CGTGTAACTCCACGTCAGTGTTATGTTACGGAGGTGAGAAGAGGTTTTGTTGACTTTGCT
TTGCTCTCTTATTATAATAGGATGTTGAATGCAGAGTACCTGAAGCCCTGATACCTTATC
CCTGCTGTTCCTTCTTCTTTTCTCTTTTTTTTTGCCTCTTTTCTCTTTTCCCCTTTTTAA
TTCCCTTATATAAGCATTAGGTTTTCTAGGTATGTGTAGCTTATGCTCTTGTGAGAGCTT
TCTGTGAGATTCCATATCAGACAGTTTAACAGGGATCGATCACTCAGGCTCCTGTTTTTT
GGAGTAGTGGCCAAAAAGAGAGGTGTGAGAGAGAGAGATACGTACACATTTATACATATT
ATATGTGTTTACATATATACATACACACACACATATATATATATATGTATGCATATATAT
ATATACATACATATATATATATATAATATTATGCGTATATATATAATATAACCACTTACT
TTTCTGGTTGAGAAGTTGTAGCCATGGGGTGAAAAACAAAGAAGGTATAATGGAGCTAGC
TGCATGCTTAGTAGTAGGGCTCAAACTAAGAATTGTAGAAGTAGATAGCAAAGGAAGGGA
TTGTCAATTATTTTCCTTTGTTTTTGGGTTTTTTAGTTTTGTTTTGAATGTTTATTTTGG
ACTGTATTTATCGCAGAAAGGAAATTGTCAAATTAAAGGAAAGGTAGTTGCTCCAGGAAA
GAGGGACACCTTGTTCCTCTTGACAAGTGGATTTAAATAATAGAATCTTAGAATGGTTTG
AGTTGAAGGGGACCTTAAAGGCCACATGATCAAACAGGGGCACCCACCACCTCCGGGCAG
CCTGTGCTGGTGTTTCACTGCCCTTATTGTAAAGAACTTTTTTCTTATATCCAGTCTAAC
TCTCTTCTGTTTTAGCATGAAACTGTTTCTCCTTGTCCTGTCACAACTCCCACTGTAATT
TGGGAAGGAGCATTAAAAGGAACTATCCCTGTGCATTTTAGAACACTCGTGAGACTGCCC
AGGCCATCAAGGGCATGCACATCCGCAAGGCCACCAAGTACCTGAAGGATGTGACCCTGA
AGAAGCAGTGTGTTCCCTTCCGTCGCTACAACGGAGGAGTTGGTCGATGTGCCCAGGTGA
GGATGGACATAGGAAAACGTGGGATGGGTGTTTTGTAGAGTAGAGATAAAAGGTGACATT
CAGACTGCATGGAGAGGATCGGTCATTGGTGATAATCTGTGAAAATACGAGTGGGAGAAC
CGTAGATCGAGATTGCTGTGATGACTTTCTTAGGACACCTTTGGATTCAATGTGAAAAGA
AACTTGTATTCTGAGCAATCTTATTAAAAGGGCATGTAGCAGGAAGTTGTTGGTGTGGAC
GGGTCAGGTACCAGAACCAAACCAGAGCTCTTTTTCTCACAGGCCAAGCAGTGGGGCTGG
ACACAGGGACGCTGGCCCAAGAAGAGCGCGGAGTTCCTGCTGCACATGCTCAAAAATGCA
GAGAGCAATGCTGAGCTCAAGGTAGGCTGAGTAATGTTACTGACTGAAATCTGTTTGACA
CTGCACTTCTGTGCTCCTGAGCTCAGTGGCTCAAACATCAAAAGTGAGGATCTGCTCTGT
AGCTGAAAGCATGGCGTAGACTATTTGGTTTGCTGTCTGTCTGAATTGTGCTGTGTTAAA
TCACAATGTGAGTGATAGTTTTTCTCGGGTAGTTCATGGAGAGTTATCTGATGCATGCTT
ATTCTAAGTGGTTCATCTCTTAAAATCCACAGAAAACAAAATCTGTAGACTTTGCTGTGT
GCTCCTGCTTTATTTGGCATCTTTGATGGCGGTGATGACTATCTTAGGACACCTTTGGAA
CAACCATGAAATAATAACTTTTTTTTCTGAGCCATCAGTGCGATGTAGCTTCGTTGTGAC
GTGCAGAAGGGAATTCTGTTTTTCTGATTTCAGTTTGTCCTTGCTGGCTAAAATGATCCG
CTCAAACAGTACGATGTGCTGCAGGGGGGCGGTTATTCTTGTTTGTATGCTGCATGGATT
ATTGCATGGAGGAGTAAGGCACAGTGTTTTAATTTTATCCCCCCCAGGGTCTCGATGTGG
ATTCTCTGGTGATTGAACACATCCAGGTGAACAAGGCTCCCAAAATGCGCCGGCGCACCT
ACAGAGCTCACGGGAGGATCAACCCCTACATGAGCTCCCCGTGCCACATTGAGATGATCC
TCACCGAGAAGGAGCAAATCGTTCCCAAGCCAGAGGAAGAAGTTGCTCAAAAGAAAAAGG
TAAAAAGCATCGTGTACTCGATGTCTTCTCATTTCTTAACGTCTCTAGGAAACAGTGTGT
TCAGGCAGAAGGGTTGCTGTGATGACTTATCTTAGGACACCTTTGGAATACTCATGAAAA
AAAATGTTATTTCTGAGCAACCTCGATGTTAATTTGAAGACAGGCAGCGATAACTTAAAA
ACACTTGCAGTGGTGTGCATACTGCTGAGAATTTGTTGCTTTCTCCTCCTGAAGGAGTTG
CAGAATTCACGGTGCATGCCTGTAAACACGATCCCAGAGAAGGGGGGCTCCAGGGGGAGG
ACTGAGTTTTGAAAGCTGATGTGGAAAGGTACACCTTACCATTGTTTCCTTCTTTGTTTT
TCAGATATCCCAGAAGAAGCTGAAGAAGCAAAAACTGATGGCTCGCGAGTAAATCAGACG
CAGCAGATGTACATAAATAAAGTTAAAAAATTTAAATGATTTGTGTGTGCTTGTGCTGTT
TGAGGGACGTTCCAGCGCTCGGCCTGTTCTTGGGGGACGGCTCCTCGCGGTATCCCTGCC
GGCAGCAGAGCACTGGCGTAGAAAGCGCCGAGCTGGCTTGTGGGAGCGGTCAGCCCTCTT
TAAGCAGGAAGTCCTGCCCTGTCGTCTCTCACGTTCTGCGTCACTTCCGTGGGCTGGGGC
CACGTGACGCTCACTCCGCCTCTGACTGGGTGGAGCCACCGCGCGCATCCGCCGGAAGTA
GAGGGCGGACTGCTTCCGGTGCGGCTGCAGCAGGGTGGCTGAGGTAAGCGCTGTGTTCCT
TCGGGTTTTGCTGCCGGCCCGGTTCAGGTGGAGGTCCCTGCCGCTGCTCTCCCGCGTACC
CCTCCAGCCGGGTGAAATCCGTGCCGGAGGTGGGAGCTGTTTGTTTCAGCGCCCATTGGA
GCCGAGCTTCGCTCGTTCTGGGGCTCTCCGGCTGTTGTGTTTGTGCCCCGAGGGAAAACG
CAGGCGGCAGCGGCTCAGCGATTTAACGGAACCGGGCAGATTGTAGGAGCTTCCCGGCCT
GAGGGCCGGTAGCGACACAGCGCAGGGCAGCGTTGCACGAGCGAGCAGGTTGTCCTTTTT
CCGGGAGATAAAGCTTTTTTGTGTGTCTTTCTTTTTTTTGTTTGTTTTGTTTTGTTTCCA
TAAGAATAGTTCAATAATAATGGATTTAAAAGTGGGAAACAAAGACCATATGCGTTTAAA
TGTGCCATGTCATGCTTGTTCTCTCCACTGACTCGTATGTGGGTGGTTTAGGACTAACAA
AAGCGTGTTTGACAGAGTAGTAAGCTTACTGTTACAATTTCACCCTTTGCCACTTCATTA
TCTTTTCCTAAAAATGAATTGCCTGCGAGCGAGGCAGCAAGGCCTTGTGAAAGCATAGAA
TAAACTTTGGAGCAATATTCAAATATTTTAGGGCTGTTTTAGTTCCCGTGGCTTTCTTCT
GCATCTGACAGAGCTATCATCTGTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1133..1173, 2261..2395, 2682..2780, 3347..3538, 3904..4006
1007..1055, 1133..1173, 2261..2395, 2682..2780, 3347..3538, 3904..3948
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved