Gallus_gallus Locus Q6EE61_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus Q6EE61_CHICK
Gallus_gallus
Q6EE61_CHICK
Un_random
SNORD58, SNORD58
3795..3861, 4344..4411
5739
TTATTATACGATGGATCTCCAAGGGATCCGTTGCAAGCAGAGAATCAAGATCCGATTTA
GAATTCTTATTTTCCTGATCAACCAGGTACATTGATTCAGGAACCTGGTTTTTATCTATT
GAAATATTATGGACCTACCCTATCAGAAAATTCAGGGTTGTTTTTTTCCCCATCAGTATA
CCGAGTTCTTGCTCTAATTTTTCTATGCGGTCTCACAATAACTGATTTTCATTTTCTAAG
GTATTGGCCCTCATTTCAACCTCGTTTAAAGCATTTTAACAGTGGCCATGCCACCGTAGA
GGCAGCTACCTGTCGTTCTTTTGTAGCCAGTATATCTTTGCTCAGCCTATGAAAATAGCC
CGCCATGTGGAATTGGGAAATATTTCCCATAACACGCAGGGGACACCATTTTTCAATTAT
GATTGCCAATTCATAACTAGGGGATCCCAGAAATCCAGGGATCTGTCCAGAGATTGTTTT
ATCTAGGGGGGTTATGTTGTCCCCCCAATCCATTTATAGGTATACCAAAGAAAAGACATT
ATATAGATCTTAGTATAAATGCAAAAATCAAGATATCAGTGCTTCAGTTACTCCTTATTC
TTGTTTTTTTTTCTTTTTACTCCTTTTCTCTCTTCCCTTTCTATTTTCCTTACATAAGCA
TTACATTTTGTAACTTGTTCACACAGCTTGTGTTCTTCATGCTCTCTGTGAGGTTCCATA
TCAGACATTTCAACAGGAATTTCATAGAAATTCATAGGAATTTCAATCGTACAATGGCTT
GGGTTGGAAGGGACCTCAAAGATCATTTATCACTCAGGCTCCAGCTTTCTGGATTAGTGG
CTGAAGAGAGAGCTATGATAAATATAAAGACTCATATTTGCTGGTTGGAAAGCTGTAGCC
ATTGGGTAAAATACAATGAAGGCACGACAGAACTGTAAGCTCAGTATAGGGGTCACAGTA
AGTATTGTTAAATAGATACAAAAAAGAGTANNNNNNNNNNCAGCTGAGCTCCAAGGATGG
TACGCTACTCACTGGATCCAGAGAACCCTACCAAGTGTGAGTGCTGTGCCATGCATGTCC
ATGTAGGGCTGCATGGGGTGGCTGAGTTTTTGTTTCATACGTTTTTGTTTTTTCTTTGTA
CAGCATGCAAGTCCAGGGGCTCCAACCTGCGTGTGCACTTCAAGGTATGCGATATGGGCA
TGGCACCAAATGTAGTTTTTGAAGGAAGTGTCCCTTATTCTTTTCTGTTACTGGGGAGTT
ATTGAAGAATGGTGGTGTAGGTTGTGACCTGTGTGTAACTTCCAAATTAAATGTTGTATT
ATGCAGGTGAAAAGAGGTCTTGTTTATTTTGATTTGACTTCCTATTGCAATAGCATGTTA
AATGCAAAAATCAAGATATCAGTGCTTCAGTTACTCCTTATTCTTGTTTTTTTTCTTTTT
ACTCCTTTTCTCTCTTCCCTTTCTATTTTCCTTACATAAGCATTACATTTTGTAACTTGT
TCACACAGCTTGTGTTCTTCATGCTCTCTGTGAGGTTCCATATCAGACATTTCAACAGGA
ATTTCATAGAAATTCATAGGAATTTCAATCGTACAATGGCTTGGGTTGGAAGGGACCTCA
AAGATCATTTATCACTCAGGCTCCAGCTTTCTGGATTAGTGGCTGAAGAGAGAGCTATGA
TAAATATAAAGACTCAAATTTGCTGGTTGGAAAGCTGTAGCCATTGGGTAAAATACAATG
AAGGCACGACAGAACTGTAAGCTCAGTAATAGGGGTCACAGTAAGTATTGTTAAAATAGA
TAACAAAAAAAAGTATTGTTAATTTATTTTCCTTTTTTTTTTTTTTTTTTGGTGTTGGTT
TATTTGTTTTGTTGTGTATTGTTTGTTTTGTTTGATGAGTGCTTCTTTTGAACTGAGTTT
GTAGCAAAAAGGCTTGTCGAGGAAAGGTGGTTGCTCCAGGAATGAGGGACAAGTGGTTTT
GATTCATTTGAGTTGGAAGGGATCTTAAAGCTATTTGGTCCAACTCCCTGCAATGAACAG
GGACACCTACAGCTCAATTAGGGTACTCAGAGCTCTGTCCAGACCTTGAGTGTCTCCAGG
GATGAGGCATCCACCACCTCTCTGGGTAACCTGTGCCAGTGCCTCACCACTCTTATTGTA
AAGAGCTTTTTTCTTATATCCAACCTAAATCTCCCGTTTTAGTTTAAAACAATTTCCCTT
TGTCTTGTCACAACTCCCACTGTAACTTGGGAAGAAGCATTAAGAGGAACTTTCACTGTG
CATTTTAGAACACTCGTGAGACTGCCCAGGCCATCAAGGGCATGCACATCCGCAAGGCCA
CCAAGTACCTGAAGGATGTGACCTTGAAGAAGCAGTGTGTTCCCTTCCGTCGCTACAATG
GAGGAGTTGGTCGATGTGCCCAGGTGAGGATGGAGCTAGGAAAGAAAAGGTGGAAAGGGT
GCTTTGTGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCAGGTACCAGGACCAAA
ACAGAACTCCTTTTCTTACAGGCCAAGCAATGGGGCTGGACACAGGGACGCTGGCCCAAG
AAAAGTGCAGAGTTCTTGCTGCACATGCTCAAAAATGCAGAGAGCAATGCTGAGCTTAAG
GTAGGCTGAGTAATGTTACTAAATGCAAACTGTTCATTTGACACTGTGCTTCTGTGCTCC
TAAACTTGGTGGCTCAAATGAAAAAAGTGAGGATTTGCTCTATGGATTAAACAGATATAG
AGGGCTTGGTTTACTATTTGTTTGAATTACACTGTGTTAAGTTAAAATGTGAGTAATGTT
TTTTTCACAGTTCATAACTGCATGAGCTATTTAGAATAAGTGTGCATCTGATCTCTTAAA
ACTCACAGAAATAGTAAAATCTGTAGACTGTTTGTAACTTTGTAATGTGCTCAATGCTTT
ATTTGGCAACTGTGATGGTGGTGATGACTATCTTAGGACACCTTTGGAACAACCATGAAA
TAATAACTACTTTCTGAGTCATCTGCATGATGTAACTTCATTGTGACGTGTAGAATAGTC
TGTTTCTCTTACTTTGGTTAGTCGTAGCTTGGTAAAACAATCAACTTAAACTGTGAAATT
TGCATGGTGTGCTCGGGTGGGGGGGTGATTATTTGTTTGTGCTGTGTAGATTACTGTAAA
GAGAAATAAGTCACAGTATTTTAATTTTATCCCCCCCCCCTTCCCCCACAGGGTCTCGAT
GTGGATTCTCTGGTGATTGAGCACATCCAGGTGAACAAGGCTCCCAAAATGCGCCGGCGC
ACCTACAGAGCTCATGGGAGAATCAACCCCTACATGAGCTCCCCCTGCCACATTGAGATG
ATCCTCACCGAAAAGGAGCAAATTGTACCCAAGCCAGAGGAAGAAGTTGCTCAAAAGAAA
AAGGTAGAAAGCATCACGTTCTTAGTGTCTTCTCTCTCACTTCTTAGTGTCATTAAGAAA
CCTGAACGTGAGCAGGCAAAGGGGTTACTATGATGACTTATCTTAGGACACCTTTGGAAT
ACCCATGGAATAAAAAGTTATTACTGAGCAACCTCAGCATTAAATACAGTAGTGAGAAGT
GATAAAAACTCTTATCAGTAATATATATTGCAGAGGTGATTTGCTGATTTTTTTCCACTG
AAGTAGTTATAGCATTCAGATGTTTTCTGTAAATACAGACCCACAGAATGGTGGCTCAGT
GGGGAGGCCTGAGTGTTGAAAGATGATTTGTAACATGATTTGGAAAAGTATCCATTTTCA
TTGTTTTGTTTCTTCAGATATCCCAGAAGAAGCTGAAGAAGCAAAAGCTGATGGCTCGGG
AGTAAATCTGACACAACAGATGTACATAAATAAAGTTTAAAAAAAACACTTTAATTTGTT
GTGTGGGCTTGTGCTGTTTGAGGGATGTTCCAGTGCTCAGCACATCCTTGGGACACAATT
CATGGTGGTTCCTCCACTGGCAGTAAAGTACTGACATCACAAAGCACCACACTCCCAGAA
CGAAGCTGCTTACGGTGCGGGAGTGTTTCTAAGCATAAACCAGGAAGTCCCAGCAGTGAT
GACGCGTGCTTTATACGTCATTTCTGTGAGGCGGGGCCATGTGAGGCACTCACTACCTCT
GATTAGGTGCAGTCGACTGCGCATCTGTGGAAGTGTGGTGGTTATTTCTAGCGTGGCTGT
AGCAGAGCTGTTGGGGGTGAGCGTGCTGCTTTTTTGAGTTTTGTTCTTGGTGCTGACGTA
GCTGAAAGTTCCTGGGGGTTGTTTTCCTACTTGTCTCTTGTCCCTTTGGCCGTAGCTGGT
CTCTAGCTGGAAGCAATCTGTGCAGGAAGCAGAAGCTGCTTGTTTTCAGCGCCTGTTGGA
GCAGAGCTTCGCTCGTTCTGAGGCTCTCTGTTCTTCAGCTGTTGCATCCATACCTGCGAG
GGTGGAATGCAGCTGGCAGCAGTAACTCAGTGGTTTAACGGGAACTGGGAAGATTCTGGG
AATGTTCCAGCTTTAGCACCGAGACAGAGCAGGGCCGCATTGCACAACTAAGCCCTCCAT
CTGCATAACCTTTTTTTCTGTTGCCACAGGAATAGTTGGTTAACAATAGAATTAAACATG
GGAAACAAAGATCTGGTGTGTTTAAGTGTCATGCTTGTTCTTTCTGCTGATTTGAACGTG
TGGTGGCTTAGAGACAAACAAAAGCACGTTTGATTAAAAAAAGGAAGCTTACTATTAAAA
TTTCACCCTTTGCCACTTCGTTACTTTTTTTTCTGAAAATTAATTGCTTTCCCCCCAGGC
CCTAGGGCATCATGAAATCATGTAAGAAACTTGGGAATAATATTTCAATATTTTAGGACT
GTAGTTTTAGTTCTAGTGGCTTTCCTCTTCATCTAACAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1143..1183, 2288..2422, 3381..3479, 4071..4262, 4637..4739
1016..1055, 1143..1183, 2288..2422, 3381..3479, 4071..4262, 4637..4681
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved