Gallus_gallus Locus ATP5B
snOPY snoRNA Orthological Gene Database
Gallus_gallus ATP5B
Gallus_gallus
ATP5B
E22C19W28_E50C23
SNORD59
1369..1441
2055
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGGAACCCATCGACGAG
AGGGGCCCCATCACAACGAAACAGTGAGTGATGCTGCAGGCCGGGCCGTGGTGCCGTGTG
GGGTTTGGAGGCTCGGGGTCTGGCAGCAGTTGCTGTCCGTAAGGGATCCACTTTGGTCGC
TCATTTGCTTCCCTCTGGTGCTGTAGGTTTGCTGCTATCCACGCTGAAGCCCCTGAGTTT
GTAGAGATGAGCGTCGAGCAGGAGATCCTGGTGACGGGCATCAAGGTGGTGGACCTGCTG
GCCCCCTATGCCAAGGGTGGCAAGATTGGTACGTAGCCCTCAGAGGGAGGGCGGAGCAGA
GGCACTGTGCCCACCACGAGGCTCAGAGCCCATCCCCACACAGCAGCTTCCTTCGCTGAT
GAGTAACCTTTTGACTTTCGTTCTACTGAGCTTGCTGAAGCAACGTTCATTACCTGAGGA
GGAAAGGGGTGAAGGGAGACCCCAGGGGGGCTGGATTGGCTCCGGGTTGAGTGGGTCACC
CTTTTCCCCCAGGTTTGTTTGGAGGCGCTGGCGTCGGCAAGACGGTGCTGATCATGGAAC
TGATCAACAACGTGGCGAAAGCTCACGGCGGTTATTCGGTGTTCGCTGGTGTGGGGGAGC
GAACCCGCGAGGGCAACGATTTGTACCACGAGATGATTGAATCCGGGGTCATCAACCTGA
AAGATGCCACCTCCAAGGTGCGTGAGGCCCGGGCTGGGCTGGGGGCCCGCTGGCACGGCA
GCTGTGCTGATGTTGGGTCTCTCCTTGTGCCAGGTCGCTCTGGTCTACGGACAGATGAAT
GAGCCCCCGGGTGCCCGTGCCAGGGTGGCTCTGACTGGGCTGACGGTGGCAGAGTACTTC
AGGGACCAGGAAGGCCAGGACGTGCTGCTCTTCATCGACAACATTTTCCGCTTCACCCAG
GCTGGCTCAGAGGTTGGTGCTGACCACCGGGCAGCCAGCTGTCCCAGCATCAACAGCCCT
TCATCAGGCCCATCCCCATAACAATGGTGCTCTTCATGTGGGCTCTGCTGGTTGTCTCAC
CGTCTCTGTTCCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1042, 1166..1287, 1512..1696, 1773..1919
1206..1287, 1512..1696, 1773..1919
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved