Gallus_gallus Locus KCNMB2
snOPY snoRNA Orthological Gene Database
Gallus_gallus KCNMB2
Gallus_gallus
KCNMB2
9
SNORD36
80105..80181
141888
ACCCTGGGAATTTTCAAACATGACACATCCATCAGTTTTCCTTTCTGACTAATGCTTGG
CAAAATGGAACTGTCAAAACTTCTTAATTCAAACCAAATTGTTTGTTATTTGTTCCAAGC
CACATATTAAATGTCAGTGAGAAAAGTTTCCGTGCAGCAGTCACGGGCACGCATTGCTAC
TCTTTGACCTACACTGAGCAACAGCCCTGCAGAAGCCAAAACCCACCGAGGGACGGTGTG
AACACACAGCGGGGCCGCATGCCTTCTGCTGTCACAGTGAATCCCACTTCGCCCCCTGCA
CATTCCCCTCATCCCAAAGTCTTTAGAGGTGAAATCATGAACTCTCCTTCTTAATTTTTT
ATTTTTTCTGGCACTGAAAAACCCCTCTGTGGCAATGACAGCTTGGCATGTTTTCTCTGC
CTGCCCATCAAGCCCTTAGAAAATTAAGTTATTAATCATCTAAACATTCACTTCTGCTGC
ACCAAGGCTCTGTGGCCACAAAGTCCCATAGGTGACTGTTTCAAATATCACTCTCTTTCT
ATGGAAGATTTCTGGATTAAAACAACACAAGTATGGACAAATGCACCTTGTGATAACTGC
TGCCCAGAACTGTGCTTTTAGAGTGGTCAACCGAGCTCCTAGCTTATATTTCACTAATTT
GATTGCTTGGTCCAAAAAAAGAAAAAAGAAGCCCAATCCCACACTCACTGTGTGGTTTAT
CTGAGGTCTACACACAGCAAAGCATTGCCTGCAAGAACGAAGAGAAGTTTGCAGCAAAAT
TGTTTTGTAGCAGATGTATCAATGGAAAAAGTTAGTAACTGGGAGTGTTCTCTCTTTCCC
TGTCTCTCAGTTGCTATTAGTGCTGGTCTTTTGGGTGTAGCTTTCCTCTTGGGCTCCTGT
GTTTGTTTTACGTACTGCTTTCCTGTTCCTTTTGGTCAGGAGCCTTTTTACAATCAGGCA
AGATAATACTGAGCGGCGGCACTGAACCTGCAGGACAAAATGAGCCTTTGCTTTAAATAT
CCGAGAGACAAATGGAGGTAAGTAGAAACAAATGGCTCGAGCTGTTTGGGTTGGGGGTTT
GCTTTCAGCTCATGACTGGGGGCTGATAACAACTAGTACATTGGACTTATTTGGGTTTGT
TTTCTCCTGCAGTTTGACTGCAATTTTAAGAATGTAACTAAAGTCTGGCTTGGAAATATA
CTGTAGAAGTAATTGCATTCAGGCCTTTGTTAGGGATTATGGAGAGTTGGTTAGGATAGG
AATCCTTTAAGTGGGCTTTGCTAGGCCTTCATGGCAGACCTTAAATACATTTTCCCTCCT
CCTTTTTTCCCCCCCATCTTGCACAGCATCTCTGTATTCCCAATTCACTGTGCACACTAT
ATAGCTAATCAGAGAGTTTGTCCTGCTACTATTATCTTCTTGTATTTCATATATATTACA
GAGGTTGTATTTGCTCAGCTGTACTGAATCCAGTTATAAAAGCAGGGTGCAGAGGGCAGT
TTCTGGATGCACAATGAATCTCTGTAACTAATAACATATAGCACTTGCTCTGCTGGAAGT
ATCAATGTAAAGCCATAATGCTAGCACAGAGCTGAAAGGGTAAGTGAACCCACCTCATAA
TCCTATAACGTTGATACAGTTTGGTGGTACCAGCATAAAAGAGATACTTAGAGCTAAGCT
GGACTTTGAGATAAATTGAAAATGGTGTCTTTAAAGGAAAGCCGTTCAGTACAGGATTTG
ATGACATGCAGATCTTCTACCCACACGGTGTCATATCTGGCACTTGGGTGGATGAAAATA
GTCTGGTGTATTGTGCTGTACAAACAGGGAAAAGGTTTGTGAGGAGAAAGGGGTACGTAT
CCAAACAACACAGCTCGTGTGTGTCAAGAGCAGGCAATAAGAATGTAAAAATTCTAGACA
TCTCTTCTTCCCATTCTCTAAATTACCTTTCAAGCATCTTGAAACTTACTGAGCTGCAGG
GCTTTTTCCTGTACTCTCTTCAAAAAAAATCATTTCTTTTCTGCAGACTGATTCCAGTAT
CAAACCCCACATCACCCAAAGTTTTACACGTGCACCTGTGGTATGTTTTTGTTTGTTTCC
AACTGCATTATCATGACTTTACAGTTCCCAGGAAAAAAAATAAAAAGAAAAAAGAATCTA
CTGTTATTTTCTCCTTTCTGTTCATTCAATCTTATGTCTACTTAGGACTTTTGGCAGAAA
GAAGGGCAGGTCAGACAGCACAAAGTTAGGTCATATATGAAACAGGATGAACACTTCCCC
CAAATATTTTGCAGCATCTGAATCATCCTTCTGTCAGCCACATCACCTCTGGCTGCTCCT
GTTCACTTCCTGCCCCATCTCCTCTCCCACGCAGACACAAATTCCTTGGGGAGGGACTTT
CATTTATTAGGTGCTCATGCACTGCTTCTGAGTGCCTGCCTCTTAGTTATACAGCAGCGT
AGCACAGATAATAACTAAGATGTGCTGGCTTAATTCATCCCTTCCCATGGCAAAAAGTGC
AAAAAAGCTGATGGAAGTTTTTACATGGCAGTAGGAGACCTCATATTAAGTTTACTCGTC
AGTTTCAGGGAAACACTGAGTTAAACTGTGTTTATGTTGGCAAACCCATGCCCAGTGAGC
TGAGTCACTCTGCCCAAAGCAGCAGCTATGGCTCATTGGAACATTTGCTTTTTCAGAATA
CATCCTCCTCCACCAAGGCCTCCAATAAGCTTCCTGCTGCAGATGTTTGCTTTTCAGAAG
TGGCTCTGAGACAGAAACAGGGACAGCNNNNNNNNNNCCTGTATATTACACATACACTTA
ATGCTTTCAGGAATATTGTTAAGAGATTGAAAGACCTGAATGTAGAGCTGCCTACGTATC
ACAAACCAAATTATCTTAAAAAACATGTCTTCACCTGAGCAAGAAGGGCCAGGTCCTCCT
GTGGCACGAGGACTTGCCATCTTACTGCAGCAGCCTTCCCCCAAATTTACGATCACAAAC
GCACACACGGGAAACTTAAGATTTATCTGAGTCAGAAAATGCCTGGATTTTAGTTCTTCT
GCTGCCAAGAAGTACGTATAACTGCTCCCATTATTTCAGAGGTGAGGTTTAATGGTGTTG
TTTTTAATCACCCTCTAATATCTTTTTAAAAATACATTTTTTGAAAGGCTCCTATTTTTG
GACCTTAAGCCTCATAATAAATTTAAACCTGTGAATGCAGTTCAGTGCAGATTCACATGT
TGAGTCATGGATCCTTTTCCAGTACAGTGCAATAGTCTCATCGTGTCCCTGTAAGGGGAT
TGGCAGCAGCTTTGGAAATCTGTCCTCTTTCCCAGCTCAGGCTCCTGAGCCATACTTCCT
GCTCTTTTTTGTTTAAATAAAAGCAAATAAACATTTTGTCTCCAGGTACAGATACTGTCT
CAGTAACAATCTCTGTATCAGTACATTGTTACATAGGATGTTAAGAGAAGCTCTGAAATT
TGTTATAACCTTGGTGGTCTGAACCTTCCACTGCTAAGATTCATGGCAGGCTGAGAAGAT
CCTTTTTTCCCCTTTCTCATCTTTTTCAGTCAGCACCAACTGAGCTGAGCCAAACAAATG
GTTCATATAGTCGTTATCCATCACATACCTACTCTTTTATCATACCCTTGCAGCNNNNNN
NNNNCTACTGTTATTTTCTCCTTTCTGTTCATTCAATCTTATGTCTACTTAGGACTTTTG
GCAGAAAGAAGGGCAGGTCAGACAGCACAAAGTTAGGTCATATATGAAACAGGATGAACA
CTTCCCCCAAATATTTTGCAGCATCTGAATCATCCTTCTGTTAGCCACATCACCTCTGGC
TGCTCCTGTTCACTTCCTGCCCCATCTCCTCTCCCACGCAGACACAAATTCCTTGGGGAG
GAACTTTCATTTATTAGGTGCTCATGCACTCCTTCTGAGTGCCTGCCTCTTAGTTATACA
GCAGCATAGCACAGATAATAACTAAGATGTGCTGGCTTAATTCATCCCTTCCCATGGCAA
AAAGTGCAGTAAAGCTGATGGAAGTTTTTACATGGCAGTAGGAGACCTCATATTAAGTTT
ACTCGTCAGTTTCAGGGAAACACTGAGTTAAACTGTGTTTATGTTGGCAAACCCATGCCC
AGTGAGCTGAGTCACTCTGCCCAAAGCAGCAGCTATGGCTCATTGGAACATTTGCTTTTT
CAGAATACATCCTCCTCCACCAAGGCCTCCAATAAGCTTCCTGCTGCAGATGTTTGCTTT
TCAGAAGTGGCTCTGAGACAGAAACAGGGACAGCCACATTTCCAAACTATCAGAGTGCTG
TCCTGAGAAGACAGGGTGAGGTGGGACCAACCACCCCTTCTCTCCTGAGCTCTCATCTGG
AGCACAGAGCTTGGCTTTCTGCTGTGAGCAGTTCAGAGTTAGAAGTTCTCTGTTCCTCAC
ATTTTACCCCAAATTATTCTAGCTGGGTTTGAATAAAATGCACTGGAGTAGCCAACAAGA
AGAAACAAAAGCGAAACCAAATAAACTCATGGACAATACTTGATAGTTACATGAAGATCA
AAAAGCCTCTCACCTGGAACGTACCATAGGAAAAGAACTGACTGATCCCAAAGGAGATCA
TCAGAATGGCACATTGACGTCATCAGGCAAATTTGAATATAAGATGTCTTAAAAATGGAG
GAAAGCATTCCATAAGTAACAGCAGAAATGTCAAGGCAAAAATACTCTCAAAAACAAAGC
GTTGGGAACAGGCAATAACAGAAAATGAAAATCTCCCATTCAGTTGACTTGTCTAGTAAT
CGATGCCAGCTGTTTGACAGCCATTTAAAATCATTTCACAAGACCATTAAGACATAGTTG
CCTTCCCATCCCCTCGATTAGAGAAAAACCACCACACCTTTTAATGTTGAGAGTTGACTG
ATGTGTGCCATGCTGTGTATCGTGCCTCTGCATCTGACAGAAATCAAAGCAGAGACTTTG
AGAAGCAACTTTGAACTGCAAATTATGCTTCACAAACAGTGTTTCAGCTGCTGTTTCTTA
ATGAAGTTTCTGCTTCTACATAAAATATTTTCTGACACTGTACGTCCTGGGCAGTATGAA
GCTATGCTGCAACCAACAGTTATCTGCTTATTCCCTATGGCACTGCTGTGTTTAAGGAAG
TGGAAGGAATATCCAATTACACATCCAAAACTTCTAGTGAGTTACTGAGGGCTACTGACA
AAATTAACTCTCCAATGTATATTTTATTCCTCTGGATACATCAGCAGATATTAACAATCA
TCTGAAAGTTTGGGGTCTAAAAGTGGGGTTTCACAGCAACTTCTCAGCCCCCAGGAAGTT
CTGCTCTTGCTTTCTGCTCCCCTGACTGTTCCTATGGGGCCTCATTCTAAAAACGTGCAT
AAAAAAGGCAACAACAAAACAAGGCAAAAGATGCACTCAACCAAATCTACTCAAACAATC
ACTATTACCAAACAGGAGAATAGCCATAGAAAGAAAAAATAGCCAGCTCTAGGCCAGCAA
TTCAGCACTGTCTGAATTCATTACATTTTAGTGCTTTGGACAAGGTTCCAAAAAAGCAAA
CAGAAGTGCAGCTCATCCTTGGGATGAGTGCTGCCTGGCCTGCATTGGTTGGAAGTGAAC
ACTTCCATCCCTGTCACAGTGCAGCCTCTCCTGGAGAACTGTAGACCAATCACGTTTGTT
ACAATTACAGTCTAAAAGGTAACCACATAAGTACAATAGTCCCAAAATCCCATCTTGCCA
AAACGCATCCATGCAGGTTACTACTCACCATCCTACAGGCAAAATTAGCACGCATTTCCC
ATTTTCCAGTGTGAAGACCTGCATGTCACCAAAGGATTAGATTGTTTCCTTGAAGCATTA
GTAAAGCACACAGATATTTCAGCAGTGGATATTTTCATTGTCAGACTAACGTCACGGACA
GAACCGATCAGCTGTTCAGCTGTTAACATAGCTCTTACTTTTTACTTGTTTGTTTGTGGG
TAAATCCGGGATCTCCATCACTGATGACTTTTGAAAACCAGTTTGACAGACCATGGAGTA
GTGCTATAGGTAAAGCTGAACACGGCCAAGGGAGCAGACAGACCAGATGACCTTTAAGGG
GCCTCTTGCTCTCCATTTTCTATTATTTCTGTAATTTGATGCTTCTGTTTCCCTGGCTAG
ACAGCTGGCCTGCATTAGTAGACAAGCAACAGAAGCGATGCAGGATGGTTTAGATGGAGC
CAGCTTGGTGTGTTTGCTTTTGCTTTAAGAGCACAGTCCTCCTGTTCCGGAGGAGAGCTA
ATAGGCTGTGCACACAGCTGGTCTTTGTGTTGTCAGACTCCTGAAAAGCTAAAACCCTTC
CCAGGAACAGAAAGGTTGTGCACACAAACTCTGCCCTTTGACAGCTTTTTAGAACATACC
TCGTTGCCTGTATCAGTCAGCAATACCATCTGAGTGACATATCCCTCCACTGCATTGACA
CAGTTGTTCTGACTTTTAAGTGGGGAAATGCACTTCATCTGTGTGGTTAGGAGGCCGAAC
AACTGGCTTTATTTCCCTGAACCCTGTATATTACACATACACTTAATGCTTTCAGGAATA
CTGTTAAGAGATTGAAAGACCTGAATGTAGAGCTGCCTATGTATCACAAACCAAATTATC
TTAAAAAACATGTCTTCACCTGAGCAAGAAGGGCCAGGTCCTCCTGTGGCAAGAGGACTT
GCCATCTTACTGCAGCAGCCTTTCTCCATATTTACGATCACAAACGCACACACGGGAAAC
TTAAGATTTATCTGAGTCAGAAAATGCCTGGATTTTAGTTCTTCTGCTGCTAAGAAGTAC
ATATAACTGCTCCCATTATTTCAGAGGTGAGGTTTAATGGTGTTTTTAATCACCCTCTAA
TATCTTTTTAAAAATACATTTTTTGAAAGGCTCCTATTTTTGGACCTTAAGCCTCATAAT
AAATTTAAACCTGTGAATGCAGTTCAGTGCAGATTCACATGTTGAGTCATGGATCCTTTT
CCAGTACAGTGCAATAGTCTCATCGTGTCCCTGTAAGGGGATTGGCAGCAGCTTTGGAAA
TCTGTCCTCTTTCCCAGCTCAGGCTCCTGAGCCATACTTCCTGCTCTTTTTTGTTTAAAT
AAAAGCAAATAAACATTTTGTCTCCAGGTACAGATACTGTCTCAGTAACAATCTCTGTAT
CAGTACATTGTTACATAGGATGTTAAGAGAAGCTCTGAAATTTGTTATAACCTTGGTGGT
CTGAACCTTCCACTGCTAAGATTCATGGCAGGCTGAGAAGATCCTTTTTTCCCCTTTCTC
ATCTTTTTCAGTCAGCACCAACTGAACTGAGCCAAACAAATGGTTCATATAGTCGTTATC
CATCACATACCTACTCTTTTATCATACCCTTGCAGCATGTTAAAAATCAATGCTAATATC
TTGTCAGTTATTATTAAACTGTTTCTCAATGCTCTAAATCTCTAGAATGCCCAAGCTGAT
GAGGTGATCAGAGCCAAACCATTTCCAACGCTGCTGGGTGTGCAGAAACACAGTGCCTTC
CCAGGAGTCCCCGCTTGCCTGCCCTCATCCCCAGCTGGTACTCCTCCACCAAATGCATTC
GACTCACCCATTGCCTCCTTTTACCCAGGTATATGCTGCCAACTGCATGAGCTGTACTGC
CACAGGGAAGCACAGGGAAGCTTTTTGCTACACAAGAATTTTGCAGTCCTACCACCAAGC
CAGGTAGACAAGTGCCTGGTTTCCTCCCCACTGTATTAGTAAGATGGCTCTTGTTACGTG
TTTTGTTAAGCCTTAAGTACTACAGGGATTTTAGGAGACCCCAGGCACAGCCACCAGTCC
AGCTCCAGATGTAATAGTAAAGCAGTGCTCAAGCAAGACAGGTTTTCCAGCAGTGATTAC
CAGGTTCTAGCTAGGAAAATGTGCTGAACAACCATTTGAAACAATTTATAATCTAATTTT
GTGGACTTAAATAGTTCAGATAAACATCTGAGCATGTTTGTTGTAGGAAACAAACTGCCA
TTCTGAGCAGCTGGAAGTTTAACCATCCCCAGAGCAAAGTACATCAAACCTAGAGATGTG
GCAAAGCACCAGACAGCTGCACATGTGTCATTTTGATGGTCACACAGGAACACCCTCAGG
GCAGGAGAGGATTAATGAAAACTGTGAAACCCCCAGTGCCTCATTTCTGAGCTACCCATG
GCAGTATATTTCTTCTTCCATTTTCACTTTGTTCTTAAAGCTTCAGTCTTCATTTAAACC
CTCTAAGGAAACTCCCTGCAAGATAGATGTACTCTCCTTCTCAGTAGAAACCTTTCAAAA
CAAGAAATATCAAAATCTATTTAATGATGCCCCTCATGTCTTTCTCTCTCATCTTCTCCA
AATATTAGTTCAGAAAACAACTTTCACTTGTAGCAATTTCACTGCCATAATCCAGATAGT
ATGGATTATTTCTGCAGTGATACTCTAATGCTAATGTGCAGGAGTGGAAGGCAATTTGCT
ATCCTAACAAATTACTTTTGTCCTTGGATGAAACAGACAGCGAAGGCAGTGTCTCTGGTT
AATTGGAAACACTAGATAGATACTCCTAATGTTCTATACATTAAGTTAAATGTTATTAAC
ATTCCATTTAACTCCTACAAAATTAGAACAAAGCATTATACTCATTTCTAAGGATAAGCC
TCCTTGGAAATAGCATGATGTACTGTTTTGAAAGACATCAAAAGATCACCTTTCCATAAT
GACCAGGGAGACATGGACCCAAACAACGTCTGGGTATTTATACAATTGGTTCTTCTCAGA
GATGCTCATCAGGGTCTGTTATATACAATGTATGTCAAGCTTAAAAAAAAAACCACAAAA
CACATTTCATGTGACTATGGGATACCAAAGTATCCATGAAAATGAAAGGCATGAGGCCTC
ATTTAAGTCCAGCAGTACAACATAAAAAGCCAGTGTGTGAAATACAAGATCTACCTCGTT
CTAGGTCATGAAGCTAGGGGTGCTTAGAGCTGTATAGATAATCTTTGCCTGCTAGAAGAG
AGTTTGAATTCGGAAAAATATTTCTGTAAGGTCTGAGAAGTGAATTCACCTTCAGACTGT
GCTGTGAGTGCCTGTTCAGTGAGCACACAGTGGCTGATCAGCAGGGACACAGGGAGCAGG
GCCAGGGGAACAGAGACAGAAAAGCTGCACCACCCCTGCTCAGCTCTGCTCAGGACCGAA
CAAGCTCATCTCTGCTCATGAACCCTAGGGCCTGACCAGCTGCAAGCAGCACGCTGTGCA
GATCCAGGCCAACATGTGAAAGCAGCCCTTGCGAACATATTTGCATGAATTGTTGAACCT
ACTGCTGAGTTCAGTGCAAATAATATTTGTGTGGGACAAAATTGATTAGTACCTAGCAAC
CAGCTCTTGGTGAAGTCACCTTCAGACTAGTCAGGTGCAGTCCTTAATCTGCTGTTTCCA
GAGCTGATCACCATGTATCTTTGCATCATGGCCATCCATCACACCACCAGGTTCTCATCT
AAATACTGCCAACAGCACTGTGAGTAGCTCAGCACTCACACTCCCTCCTTTTCCTTCTGC
ATCTTATTATTTAAGTTGCTGCTGGCAAAGAAAAGCGACTATGTCCACAGTGACATTAGC
AGAACTGTCAGCTTAATCAATGCTGATCCATCCCTCCTCACCTCTGCTTCTCTGCTTCTC
CTTTTTGTGGCAAAAGAGCTCTGTAAATTCACCACTTTGCCAAGTCAGACAGAAATACTG
CTCATTTTCCAAAAGCCTTGGGTACCCCGACTGCCTCCAATTGCACATGCTGTGTCCCCC
TTGGCCATGCATGGTCTCAAGCAGAGCCATTGCCAGGAGCCCTGGAGCACCTCTCCCCTG
ATCAGCAGAAACACCTCTGGCAGCCAGTAGGCAGATCAGGGAGCCCTTCTGCAGCCCACA
GATCAATCATCATGAGGCAAATAGGTTTACAACAGCACTAAGGGCAGAGCAGACCACCAG
AAAGGCAGAGTGTTTTGAGAGAGACCTTTCAGCAACCAAAGAAACTCTGAAAAGCTTTAC
AAACCCTTGGATTGTAAATAGTCCCTAATCTCTCTCACTCCAATATCTGCCCCAGCTTCA
TTCATCCACAAGGCCTGATGAGGCAGTGCAGGGCATTTGCTTCACCTGCTGGTCTGTCCA
CCATTCAATACATCTGAACCCCTGCCAAGGCCAAACCTGTGCCAGGAACAGGAGGACTCA
TCCCGGGGCTCAGCACACTCAGACATCGCTTTCCTGTTGTTCATCCCATCCCAACATAGA
TATGACCTCACCGTTTAGATGTGCTCATTGTACTGGTAACAGTAGGATAGTTACCTAGAG
ACTACCACTCTTCTAGCAGGTTCTCTGACACTATCTTTGCAAAATAAACTCAAGGATTTA
AGGACTGTGCTGTGGTATGCAGGTTTCTCTAAGGGGATCAGAGAACATTTTATTTCTCTC
ATTCCAAAATAGCTCTCCTCTCTCCCCCTTGCAGCACTGACAGGTTTCTGCATTTCAGGA
GCATTTCCACCAGGTCAATATTCCCACCGATGTAAGTGCAGGGAGCTGGTTGCTTAGTAT
CTCCAGATTGCACAGTGATATGAGCCTAATCAACTCTGTCTCGATTTTCAGGTCTCATTG
AAAAGCATATCTTGTCTCCCTTGTCACTACTGCTTCATTTTCCTTGTCCACTAAGCAATT
ATTTAATTTACTGGCAGTACCAAGCACTGACAGACAACATAGTTCATAGGGCTGACCCAG
AGCCATAGTCTGGAGCTGGAGGACTCTGATCCCAACAGTCACACAAGCTCTAACAAAGTG
TTGTGTCCCAGTTTCCCTATCTTTGACATTAAGAGCAATGTTTTTACTCCCAGTTGAGGC
TGGAATGGTTACATCCTAAAAATATTCAATGTTAAACACACCTACCAGTCTAATTATCAT
GTTTACAGCGTGATGACTTGCATGCATAAAGGACAGGAGGATAGCGCTAGTTACAGAGCA
GCTGAAGTATGAGGTCCAACTTCATTTCCTGGCTCTTATACAGCTAATGAGAGATCCTAC
CCAAAGTCTGGGCTTCAAATTTCCTCTTCTGCTACAGGAAACTCAACTCCCAGGAAACTG
AATCATTCTTATTTTTGTGTTTGAAAAGGTACTTATTACTGTCTTTAAATACGCTGCTAC
ATACACAGTTCTAGTGTGGATTCAGTTTATTATTAAAGGATAGGAAGGAATAACTAGAAT
TATGAAAAGCTTTGCAGCACTCGATGAACATTTTCTTGTTACTTGATGAAATCCTGTACA
CCAAAATTAATTCAGCAAGAGAAATGGGCCTCACAGCCAATACTGACTTCACTGACTTCA
GTAGTTATTCACAACATTGAGCAAGACAGCAATTACTTTTGTTCCTTTCACTGCAAATAA
GCAGAACACCAACAGGCCTAATCCCCACTATAAAATCAAAGGTTACTTGCAGTCTGGACA
ACAACCTCAGATGCTTTGTAGATTCCCCTCTTAGCGAGTTTCCACACCAGCATCGCTGCC
ACAATCCAAAACATTTGTGGTGCCACGTCTGATTTAGCAGCACCTCAAACACAAGTGCTG
AGGGAACGCACAGAAGTCCAATAATTACAATTAATGCCAAGTGATGCACACAGGCAGCCC
GTCCTGCTGCCTCGCACTGCCCTGCCCACTAAGCTGCTCCTCTACAGCTGCCCTGATGTG
CCTTCAAAACCCTGCTTCAAATACTCTGCTCTGCTTCTTTCCATGCTTTCTGAGGAAACG
CTCCAGCAGCTCATCTGCTCTTTAAGCAAGAAGCGGACTGTATGAAGCATTTAGTGATGG
GAGCTCTGTTTTCCAGCAGTTCACATCATATGGCATGCTAAAACTTCTGGCCTTATGGTC
AGCGTCTGACCAACCAGTATAAATAAATCCTGCAGTTACACTGACATATACTTACAGATT
TTCACAGGTCTCAATCTCATGCACAGTGTAACAATGGAAAGGCCAGCACAATGGGAAGAT
GTTACAAAGTATAAAGGCAAAAGGATCAGAGCTATGAGAAGATGCTGGAAGGGAAAGGAT
TACTCACCCATCTCTGAGGTTCTCGGCTCACAGAGGAACCTCCTCAAAGGAGAGATCTCC
AAAAAGAAAGCCCTGAACGGCAGGGGTCAGCCCCTAAATGAGGTCTAATTGAGGTGCAGC
CAGGCTCCACCCCTTCTGGTCACACAGCTGAATTGCCTTCACCTGTGCTCCCAGGGCTGA
CCGTGTCCTTTCCCCAGGTACTCAATCAGTGGTTCAGGCCGTGATTCAACAGTTCCCACA
CAGGCAGCCATACTGATTTATTACCAAATGTACAATTACTCCCAGGTCTGGCCTCTCTGC
AGATCAGTACTGCTTAGCTAGAGGTGGTGACCAGCATATTATAAACCCACAGATGAAAAT
GCTGTCACCGTTACAAGCACGGACATCCAAAGACACTGCCTTCCAGCTTGCCAGGCACAG
AGAGGGCAGTGATGAATTATCTTGTTAGCTTGATGTTTGGCAGGGGATGGTGAAAGCACT
AAGTTACCACAACACCTGTCTTGCATAAGAGCTTTTGAATAGAATATAACCACAGCTTGC
ATTAGCTGAAGGTTAATGAGAGATGAAGGAAAGCAAAACAAGATTAAAGAAACTGTTTGG
CTCTAAGGAGTGTGTGAAGAGCAAAGTGTCCCTGGCAGGGGGAATTGCCTCACTTGTGAA
AATTATTTCCCTCCTCCTTTTTCTCTGGTTACATCTCCATCCTCTGTTTGCCCCCTTTTT
TTCCAGGGCAGTCTTCTAATATATATTTATACATTTGCCAAAGGTCTTGTGTAAAGGCTG
TATCTCCAACAGCTTTAATACAGAACTGGGGCCGTGTCTTAAGGGATGTTTCTGTCCCTA
GTGTTGCTCTGTCTATGCTAGGATTGGGCTTACTTTAAATTAAGATCAGTGCAGAAGCAC
ATCTGCACACAAAATACTGTTCTGCTCCAGTCTGTATCGGTCTAAGTATGTACTGCCCAT
CCATCCTGTGCACAGCCTTTCCATGAGCTGGAAAGTGCTTTCCATGGCTTTTGTCATAGC
CATCGTTGGCAGCCACTGCAGGGGCTGTACAGCTCAGGAATGGCTCAGCCCACAGGATTA
GGATGAATCCACCACCAGCCCAAGCAGCGGTAGGCAGAGGCAAGGTGAGGTCTCCACGTA
CTCATTAGCTCTCCCACTAAACGGACTGTTTCTTCCTTATATTCTTACCCTGGTCTTGCT
TTCCCCAGCAGACAAGTAGCACAGCTCTGGTTGAACAGCTGCTTCCTTCACATTTGCACC
AGATTTGCAGGTGAAAATCCTGTTAGTTAAAAACTTGTTTAAGAAAGGACAATGTTGTGT
TAGTATTCATTTTCATCCTGCACTGCAGGGTTTCATCCTCAGCCCTAATTTAAAGGTTTC
ATCTGGATTAACTCGAACCACAAAAGATCTACTGAAAGAAACCCACATTTGTCTGACTCT
AACACTTGAATATGGTGTTTCTTCAACCCAACAGCTGTGCTCTCAGTGCTGTGGAAGCCA
TGTGGGGTGCAGGAGGGGAACAGACCACCATCCCACACCCTGGGTACCCTCAGGGCCCAG
GAACCAGTGGAGGTGTACAGCTTGCCTCCTCACCTAACTTTAGGGGCTGAAATAAAGATT
TAGCTCAGCTGTGTGTAGGTAAGAATTTGGGCTTCAGGTTTCACCGCCAAACTCCTGACA
GTGCATTTATCGTGGCTAAATGCTGACAGCAAAGGATGCAGATCTTTGGACCGTGGCAGT
TCAGAGCAGACACCGGCATGAAGGATCCAACCGTACCATCATTTCAAGCCCATAGGAATA
AAAGATTTTAATTAGGCAAAATCCATAGGCAGACACAGCTCAACAGGTGTGCACAAAGCG
AGGGCAGCATGACTTCTGGGCTCCGCTATCCAACCACTGGACAAAGTTCATCTTTATTAA
TTTTCAGGTTTCTGAAGTCAAGGGGGTGGTTTCAAAATATGCCCTTTGGACTCTTTAATG
AAGAGCAAATTATTGTGTATGCCATACTCTTGCTGCTTGTGAAACACTTATTCAGAGATT
TTAAACATAATCCTATTAACTTTGCGTTGATAGAAATGTATTCAACATCTGAATTAATGT
TGGTATACATTGAAGGTACAGATCTACATTTGTGGTGAACTCTTTCTCAAAAATCAGGCC
TGGTGCTTATAGTCTAGCACACCTGCAAGCAGAAATTAATCATTCAATCTGGGATGACAG
AATTAGAATTAACATTGTATTTCTGAGATCCTTAAACTAAATGCATGGGATAATTACTGC
CTATGTGACCTTTGGAATTACAGTAATCCTACAGAAACCCGTTACTGCAGTGACATTTCT
AAAGCAGAAGCTGGGGATCAGAGGAGGGACATACGAAAGGCATTACTTTGTCTGCAGCAC
CTTCTCACAGAGTACTGACCATGTGGGTCCGGTCCATTAGGCAGAGCACAAGGAGCAGCT
CAGCACAGAGAGGTGGCACAAGGCCATCGCACCCCAACCTCCGAACCACCAACCTTTAAG
TGACAGCACTGAAGGACTCTCTCTCTCTGCCAGACCTCGATGCAGAGGCTGGCAGGGCTG
AACACGGAAGCGACAGGGCTGGGATTCAGAGAGGTTGGGTTCGTTCTGGTTTCATCCCTA
AACCCCCCGGCCACCAGAAGTGCAGAGTGCCCCCAAGTCGCGGAGCCCTGGGGCCCCCTG
TGCCTGCGGAGCCCGGGGCAGGGCCGCCCGGGGCCTCTAGGTGCTGCTCTTCCCCCAGCA
ATGGGCTGGGAGCGGCGGGGAGGCGCGGCGGGGGGATGCCGCAGCGCTCCGCACCCCCAC
AAAGTGCTTTTTGGAAGCATTTCGGTCACCGTCCCGTACACCAGCACTGCAGCCGGCCGG
CCAGCAGTAGCCGACTGCTTTCTGCGGGGATTGCAGAGGGAAGACCCGAGAGCACGGTCT
CCAGCATGTTTTGTCTACAGCTGTAGTTTAGCTTTTTGTGCTACCGAGGGAAAAAGAAGG
GGTTAAACTGAGCTCCTGCTATCATCATGATAGGAGTTAACCCCACTCGGTCAAGAACAG
GGGCACAGGGGATTCAACCATCCCTGGAGGTGCTCGAGGAACGTGTTGTTGTGGCACCAA
GGGCCGTGTTTTAGTAGGCATGGTGGGGTTGGGTCAGTGGTTGGACTAGATGATCTTAGT
GCTCTTTTCCAGCCTTCATGATCCTGTGATTCTATGATTTGTCCCAGGGAAGGAGAGCAG
AAACACACGAGGCTGTTGCTTGAAGGAAGTGGCCATAGAGACCGTGCATCCTTTGAAATG
TTAATCCTCATTTAGCAAAGGAGTGGTGCATGATCAGGCACATCTCAGAGAATGACGGTT
TAATTGTGCCCATCTGGGAACCCTGCTCTGAACAAATGCATTTGAGGCCTATACGTGAGC
TCTGGCAGCTGCTGCGTGGCATGCTGATGTGTTAGGATTACACTGTGCTGCTCAGAACAA
GGTCTCAGATATGTGGTGAGAATGAGACGGATGGCAGAGAAGAGTGATGGTGAGGTGCAG
CAATGGGAGCAGCTGAAAAATACTTTTCTGCAGCCATGCTGTTAACCTGCCTTTTGCCAG
CCACTTTCATTCCTCTAGCTGTTTCGTAGGACAAACTCTTCCTGTCTGTGTGGATACACG
TCCTGTTGGCACAAGTCTCACCAAAGCGCATCTTTCCGATTCCTCAAAGCAGAAAGGCCC
CCAGGGAATCCATCCTGATGCTGGAGGCACTGGGCCACCAGANNNNNNNNNNCAACCCAA
CAGCTGTGCTCTCAGTGCTGTGGAAGCCATGTGGGGTGCAGGAGGGGAACAGACCACCAT
CCCACACCCTGGGTACCCTCAGGGCCCAGGAACCAGTGGAGGTGTACAGCTTGCCTCCTC
ACCTAACTTTAGGGGCTGAAATAAAGATTTAGCTCAGCTGTGTGTAAGTAAGAATTCAGG
CTTCAGGTTTCACCGCCAAACTCCTGACAGTGCATTTATCGTGGCTAAATGCTGACAGCA
AAGGATGCAGATCTTTGGACCGTGGCAGTTCAGAGCAGACTCCAGCATGAAGGATCCAAC
CGTACCATCATTTCAAGCCCATAGGAATAAAAGATTTTAATTAGGCAAAATCCATAGGCA
GACACAGCTCAACAGGTGTGCACAAAGCGAGGGCAGCGTGACTTCTGGGCTCCGCTATCC
AACCACTGGACAAAGTTCATCTTTATTAATTTTCAGGTTTCTGAAGTCAAGGGGGTGGTT
TCAAAATATGCCCTTTGGATTCTTCAATGAAGAGCAAATTATTGTGTATGCCATGCTCTT
GCTGCTTGTGAAACACTTATTCAGAGATTTTAAACATAATCCTATTAACTTTGCGTTGAT
AGAAATGTATTCAACATCTGAATTAATGGTGGTATACATTGAAGGTACAGATCTACATTT
GTGGTGAACTCTTTCTCAAAAATCAGGCCTGGTGCTTATAGTCTAGCACACCTGCAAGCA
GAAATTAATCATTCAATCTGGGATGACAGAATTAGAATTAACATTGTATTTCTGAGATCC
TTAAACTAAATGCATGGGATAATTACTGCCTATGTGACCTTTGGAATTACAGTAATCCTA
CAGAAACCCGTTACTGCAGTGACATTTCTAAAGCAGAAGCTGGGGATCAGAGGAGGGACA
TACGAAAGGCATTACTTTGTCTGCAGCACCTTCCCACAGAGTACTGACCATGTGGGTCCG
GTCCAGTAGGCAGAGCACAAGGAGCGGCTCAGCACAGGGAGGTGGCACAAGGCCATCGCA
CCCCAACCTCCGAACCACCAACCTTTAAGTGACAGCACTGAAGGACTCTCTCTCTCTGCC
AGACCTCGATGCAGAGGCTGGCAGGGCTGAACACGGAAGCGACAGGGCTGGGATTCAGAG
AGGTTGGGTTCGTTCTGGTTTCATCCCTAAATCCCCCGGCCACCAGAAGTGCAGAGTGCC
CCCAAGTCCCGGAGCCCTGGGGCCCCCTGTGCCTGCGGAGCCCGGGGCAGGGCCGCCCGG
GGCCTCTAGGTGCTGCTCTTCCCCCAGCAATGGGCTGGGAGCGGCGGGGAGGCGCGGCGG
GGGGATGCCGCAGCGCTCCGCACCCCCACAAAGTGCTTTTTGGAAGCATTTCGGTCACCG
TCCCGTACACCAGCACTGCAGCCGGCCGGCCAGCAGTAGCCGACTGCTTTCTGCGGGGAT
TGCAGAGGGAAGACCCGAGAGCACGGTCTCCAGCATGTTTTGTCTACAGCTGTAGTTTAG
CTTTTTGTGCTACCGAGGGAAAAAGAAGGGGTTAAACTGAGCTCCTGCTATCGTCATGAT
AGGAGTTAACCCCACTCGGTCAAGAACAGGGGCACAGGGGATTCAACCATCCCTGGAGGT
GCTCGAGGAACGTGTTGTTGTGGCACCAAGGGCCGTGTTTTAGTAGGCATGGTGGGGTTG
GGTCAGTGGTTGGACTAGATGATCTTACTGCTCTTTTCCAGCCTTCATGATCCTGTGATT
CTATGATTTGTCCCAGGGAAGGAGAGCAGAAACACACGAGGCTGTTGCTTGAAGGAAGTG
GCCATAGAGACCGTGCATCCTTTGAAATGTTAATCCTCATTTAGCAAAGGAGTGGTGCAT
GATCAGGCACATCTCAGAGAATGACGGTTTAATTGTGCCCATCTGGGAACCCTGCTCTGA
ACAAATGCATTTGAGGCCTATACGTGAGCTCTGGCAGCTGCTGCGTGGCATGCTGATGTG
TTAGGATTACACTGTGCTGCTCAGAACAAGGTCTCAGATATGTGGTGAGAATGAGACGGA
TGGCAGAGAAGAGTGATGGTGAGGTGCAGCAATGGGAGCAGCTGAAAAATACTTTTCTGC
AGCCATGCTGTTAACCTGCCTTTTGCCAGCCACTTTCATTCCTCTGCTGTTTCGTAGAGC
AAACTCTTCCTGTCTGTGTGGATACACAGCCTGTAGGCAAAAGTGTCAGCAAAGTGCAGC
TTCCCAAGTGCTGAAAGCAGAAAGGCACCCAGGGAATCCATCCTGATGCTGGAGGCACTG
GGGCCAACAGAGATGCAAGCCCCAGCATATCGTGGGGACTCACCCAGCTGCCACCATTGC
CCAGACACAAGGCAGGTCCCAGTGAATAGACAAGCTTTCATATGACACTTCCGTGTGGAA
TCAATTTTGACTTATTACCTATTAGCCAAATCCTCACGTTTCCCCTCTGTGGACATGCAC
ACACCACAGCTTTCTTGCACTGGGAATTGGAGCATTATTTCTCATTTCTATGGCATTTGT
TGATATTGCTGCGGGCAGTTGGACTTTGAGCAAAGAGGAGACAGTTTATGCTTTTCAGTA
CAGGCATATGCATGTGTCTGTGTGCATGTTCTGCATCTAATGTAGTGGTACTGGGTATTT
TGCTGCTGGAAAAGAGTGAGCACCACGCATGTCTTCAGCACTACAAGAATCATAGAATCA
TCGAATGACTTCTGTTGGAAGGGACCCCAAGGATCATCAGGTTCCAACCCCCTGCCACCA
ACCTCCTGATCTGGTACTAGACCAGGTTGCCCAGGGCCCCATCCATCCTGGCCTTGAACA
CCTCCAGGAATGGGGCATCCACATCCTCTCTGTGCAGCCTGTGCCAACACCTCACCACTC
CCTCTGTGAAGAACCTACCCGACATCCAAACTAAACCTTCGCTCCTTGAGCTTAAAACAA
TTCCCCCTCATCATCTCTTGCCCTGTTTTACTGTACCTCCTGTAATTAGGTTTTATGTCA
GAGCTCAGAGGCCCTTTTCTGTGTCAGACAATGCATCAGCAAATTTTGGCTAAAAATTGA
GGATTAGTATCTATGGGAAGTGGGCCAGAATTTGTAGCAGAACACACATTTCTTTTTTCA
CTGAATTGAATCTTAACAAATATCAGTGGGTGTAGTAATTGACTTGTTGGATGAAATATG
CCTTTTTCAATCACATCATTTGTTCCAAAATACTTCTAATATTTTCTCCGTAGGTTGATT
TATTAACACTGCTTTGCAAACTGAGAAACTGGAGCTTTTCCCTTCAGCCTTCAGCATGGC
TGATGTGCTGTGTTTGGGACTACTAACACAGACTCACTGTAAGCTTTCCTAAAATACGGA
GATAATTATCTGCTTATACTGCAACAGTTTGCAAGACTTCCTGTAACTCTGTATTGCTTG
TGGTCAAAGAGTGCCATGAGCTACAACATGCTGCCAGAGGACGAGGCTGTCCTCCTCCAA
GTGTTGGTGGCTGAGAACCAGCACTGCGGAGTCCAGCAAAGCAGATCCTGCCTATAGTCG
ACTGTGAGTTCTGTGTAGCTGGAAAACACTTCCAGCTGGAAGAACAGTCACTGCTAAAAA
TGGATTCAGGTCAGCTTTCACAATGCTTTCTCTCAGGAGGGATATTCAGTGAGCTGTCCT
AGTCTCCAAGTGCACTTTCTCTCCCCATTGTGGACAGGCTGTTTTCTTAATCAAGTGTCA
CCTCATGTCACACACTTTGCAGCTGTCTTTCTGTCCCCTTTTCTCTCATCTTGGATTTAC
TTTCTACTTAGCTGATCCTTAAAAATCCTTCTCAACATAAGAATTGAACAACAGTTGCCA
CCATCAGAGGGTGATGTTTATGTCCATCTTCAAGACAGCTGCACCTTCCTTTCCCCTGTG
CCTTCTCCCCTCTTTCCACTCCCTACAGCTGGCTCTGGAGCCTCACACAGCATAAAGTTC
AGCTTAGAAGAACTAGGGAAAATGATCACATCAGACATCATTAGTAAGACAAATTCATCT
TCTGAGGACAGATATTATATTTAGCACTGTGAGGAATCTTCACTGTGGATGTTGAGAAGG
CTGAGGGCTCACTACGGGTATTTCAGGCTTTTCAGAGGCTTTTGGGGATCCTGCACTGAT
GTTCTCGTTGGCCCGGTCTACCAGCACTGGCCTAAAACACACACTGTGCCACTCCTGAGT
CACAGACATGTTCTGTCAATACCCAAGATTCAGACGTATACAATATTGGGGCTGACTATG
CTCAGGCATGTTTTCTTATAAATTGTTTAGTACTTTTATTTCTAAGAAATGGGAAATATA
ATGAAATGAGACAGCAGTGATAATACCATTGTACGTATTTGGTGTAATGATGAGGTTAGA
TCAGATAATGAAGGTGTAAAATGGATAAATGTAGGCATTTCTAAAACCCGTAATAAATTC
TAAGGCATTGAAAAGACTTCATGATACTAACAAATAACAATTCATAACACTAATGACAGC
AAACTCATACAGAAACCATCTATTCAGAGTGCCAGTCAATGAAGGGAAGTGTTCCAAAAT
GCAGAATTCATAACGGGACTGTATGAAGTGATCCATGCAATATACAAAATAAGAAGTCCT
CAGCTTCTTGGCACTGTACTCCACAGAGCACCTTTTGCTTTTCACTTTCCTTTGTGCAAT
GGGGGATGACCATGCAAATGATAACAGTGATCTTAATGCCTATGGCTTTAGCATTAGCAA
GTACTATATATGTTCCTCTACCTGACAGGAAGGATTGTTACAGCAAAACAAAAAGGGCTG
CCTATATNNNNNNNNNNAGCAAAGCAGATCCTGCCTATAGTCGACTGTGAGTTCTGTGTA
GCTGGAAAACACTTCCAGCTGGAAGAACAGTCACTGCTAAAAATGGATTCAGGTCAGCTT
TCACAATGCTTTCTCTCAGGAGGGATATTCAGTGAGCTGTCCTAGTCTCCAAGTGCACTT
TCTCTCCCCATTGTGGACAGGCTGTTTTCTTAATCAAGTGTCACCTCATGTCACACACTT
TGCAGCTGTCTTTCTGTCCCCTTTTCTCTCATCTTGGATTTACTTTCTACTTAGCTGATC
CTTAAAAATCCGTCTCAACATAAGAATTGAACAACAGTTGCCACCATCAGAGGGTGATGT
TTATGTCCATCTTCAAGACAGCTGCACCTTCCTTTCCACTGTGCCTTCTCCCCTCTTTCC
ACTCCCTACAGCTGGCTCTGGAGCCTCACACAGCATAAAGTTCAGCTTAGAAGAACTAGG
GAAAATGATCACATCAGACATCATTAGTAAGACAAATTCATCTTCTGAGGACAGATGTTA
TATTTAGCAGTGTGAGGAATCTTCACTGTGGATGTTGAGAAGGCTGAGGGCTCACTACGG
GTATTTCAGGCTTTTCAGAGGCTTTTGTGGATCCTGCACTGATGTTCTCGTTGGCCCGGT
CTACCAGCACTGGCCTAAAACACACACTGTGCCACCCCTCAGTCATGGACATGTTCTGTC
AATACCCAAGATTCAGACGTATACAATATTGGGGCTGATTATGCTCAGGCATGTTTTCTT
ATAAATTGTTTAGTACTTTTATTTCTAAGAAATGGGAAATATAATGAAATGAGACAGCAG
TGATAATACCATTGTACGTATTTGGTGTAATGATGGGGTTAGATCAGGTAATGAAGGTGT
AAAATGGATAAATGTAGGCATTTCTAAAACCCGTAATAAATTCTAAGGCATTGAGAAGAC
TTCATGATGCTAACAAATAACAATTCATAACACTAATGACAGCAAACTCATACAGAAACC
ATCTATTCAGAGTGCCAGTCAATGAAGGGAAGTGTTCCAAAACGCAGAATTATAACGGGA
CTGTATAAAGTGATCCATGCAATATACAAAATAATCAGTGCAATTCTCCTACATGTCCTC
AGCTTCTTGGCACTGTACTCCACAGAGCACCTTTTGCTTTTCACTTCATTTGTGCAATGG
GGGATGACCATGCAAATGATAACAGTGATCTTAATGCCTATGGCTTTAGCATTAGCAAGT
ACTATATATGTTCCTCTACCTGACAGGAAGGATTGTTACAGCAAAACAACTTATGCTGCC
TATANNNNNNNNNNGGAAAGAAAAGGAAAAACATACTCTGTATGGTCTCCCAGGGCTGTG
ACTTCTCCTTCACAATTCCCTCATCAGCTGGCAGTGAGGGAGCTAAGGTACAAACCCGGC
TATTACACGAGGGATTCCTTCTGCCATAAGATCTCCTTCCAGTGACAGCTGCCCCTGTGA
GAGGCACTCACCTGGCAGCCCAGCTCAGGGCCATGAAACCAGACCCAGCCGCAGAGCTCC
CCTCCTCCTCAAAGAGCAGGCAAGGCATACTTTGCTGTCACACCGAGCTTAGCTTTGCAG
CAGATGTCATAGGTCTGCAAGTGATAGCCATTCCTGTCACTGGCTTTCATAAGGAGAAAT
TGATTTCTCAGACAAAAATCTGCTTTATTGGGAATTAAAATGTACGGCCGCCACATCAAC
ACAGCACAAGTGTATGGCCAGCAGGGCAGCAGCAATGTTTGTGATGGAACAGCCTTTCCC
ACTGGTCCCTCCCCTCCGTACAATAACTTACCCACCATACCACCCTTCCACAACAACTAA
GTGCACATATTTTTCTCTTTGCAATTGGCTGCTGCCAAGGGGCCATGCTTGAGAAAATTA
GTTTTTATCATTTTAATCATCTAATCTTCATAAACCATTTAATGCAAAAACAAAGACTAC
TTAATGCACAGCGAGATAATTAATATTGAAAATAGACTCGGCGGGGGAACTGTAGTACCT
GCTGCCTTGCATTAGGTTCCAAGAATAATGACTTAGCTAGGAGCTTTAAGTATGTTTGTA
AGAACAATATAACCCATAACACCAACACTTCCATTTGCTTTTGATATATCCTATCAAGTA
ACTACATAGCTCAGCACTAAGGATAACATCACCAATGCCACGCTGAAGGCAAAAAAGCAA
TGATTTTCCTGGCCCAAAAGGAGAGGATTTACCTTTTTCCCCTCATCCCACCAGATCCTC
ATATGAGAAAGGATTTGCAACTGGGCTGTGTTGGGAGCAGCCTTGGACAGGGTCAGGCTG
TGTTTCCCAGGAGAAACCCTTTGCAGCAGGATGAGGAGCTCAGGCTGAGGCTCTCAGCAG
CCCTAAAGGTCAGTGGAGCTAGATATTCCTTCTCTCACAAAATAGCAAAGAGATGGCAAC
TAATCCTGCTAAACACATCTCCCCCTAAGCAATGTCATGTAACTCATTAATGCTGAGAAC
TAGGTGCTGCCAGCACAGTCTGAAAGGCCTCTGAAATGCCAAAAATAATGTGCACTTATT
GAGCACTTAGCATCTTCAAAGCACTATACGAATATTAACTAATTATTTAAGGAACTAATT
ACTGAGGGAAAGATGTTTATTGCTCTTCCTGAGCACGAAGGCCCATGGGAAGGCACTCAG
CTTTGGAGGACCGATGGCAGTGGTCCCCATCCTGACCAGTCCCACACCCACTCTTCACAA
AGGGCCATTTCCACGTGTACCCCATTCAATTTCTATGGCAGCCGAGTGTCCACAAATCTG
CATGACTAATAAGTGTGCATGAAAAAATTGCTATATGCTGCAATTACAGGGACTGCATGA
GGAATGCTCAGAGATGGGAGGTTAAAAAAACCCATACTGAAAATAGGAAATGGTGAGGAA
GAAATCAAACAAGAATACAGATTCATTTAATGCTCAGCGGGGGATGGATAAGGACAGCAA
AAAAAATTCAGAGTGAATTAATGCTGCCAGAGGATTTAAAGGAAATACGGAAGACGCTTA
TTGCATGAGTGTCGGGGGAATGAGAGAGAATGTCCATCAATTAGTAAATTAGGGTGGGTA
TGAAGCTAATGATTGCTAGAATCTATCTTTAATGAGACAGATGAAAGAAATGTGAACAAT
TTAGAAATGAGGAGAAGCCAATAAAATATCTCTTCTTAGTCAACATGTGAGAAAATACTT
GAGGGAAAAGAATCCTACGTGCAAATCAGCTGATATAGATGAGCCCAGGATAGGGGGGGA
AGTGGCAGAAATACCATACTGCCTGTGGCCTTCCCTCCTGAACTGTAAACAGAAGACGGA
GAGGTGACTAAAGAAAAGTGCATACAGACACTTAGCAGGAGAAATAAATGATCCCAAAAC
ACATCTTGCTGAAAACTCTACCTTTCTGAAATAAATCCATATTGCTTTGGAATGCAGCCA
GGTGAAACCTGGCCCATCCAAAGGTCCCACAGTTGTCCCCGGGTGGCTGCAGTCCCTCGT
GACAAAGGCCAACGCTGCCAGGAGCTCACTGCTCCTCAGTCTGTCAAGAGACCGCAGGCA
GGAGGTCCCTGTCCTGGCCAGGCACCGTGCCACTGCTGAGAGCCCTGGCAGGGAAGCGGG
CGCTTTGCAGATGGTGTTGAGCAAGGCGTGCTGCTGCAGGGCTTCCCAAGCTGTGCAGGG
TGACCTTGCTGCAGGACAAGGGCTGTGCTCTTAGCAGGTGGAGGGACCACAACCCTAGGA
CAGCCCTACAGGGATGCTGCGCCCCATCACAGTCTTGGCACTAATTATAATTAAGACAGA
ACTCCCAATTAGTAGAACCCCAGTGTAGGATGAACATAACAGTGACCCCAACACTCATTT
TGGAGGTGCCTACACACCCAGCTGCCATGGAGGCAATTCTGGCCACGGGTGTTCAGCAGC
CTCAGCAGCACAAAGCCCCAGACTGCATTGGTCTAGTGGGAATAAATCTCACCAGACAAA
CCTGATTGCTTTTTTGATAGAAACAGAAAATTAACGGATGAAGGGAATGCTGGAGCTGTA
ATATATTTGCATCTGAGTAGAGCATTTGATACCGTGCCTCATGAAATCTTTCTAGAAAAA
TTAATTTAAATCAGCTTGGAGATGAACATTGCCTTCTTCATTGAAAACAGGCTAGAAGGC
TACAAAGAGGGGTTAACAGAGAGCGACAAAGCAGAGAATAGAAGGTGAGGAATCCTTCAA
AGAGCAACAAAGCACAGTTTCTTAAAGGGATTTAAGGTCTTGCCTGTTTATATAGAAACA
GAGGAAAAGGCAACATGTTAGTAAGATATGATGATGAGATGACATTANNNNNNNNNNAAA
GAAAAGTGCATACAGACACTTAGCAGGAGAAATAAATGATCCCAAAACACATCTTGCTGA
AAACTCTACCTTTCTGAAATAAATCCATATTGCTTTGGAATGCAGCCAGGTGAAACCTGG
CCCATCCAAAGGTCCCACAGTTGTCCCCTGGTGGCTGCAGTCCCTCGTGACAAAGGCGAA
CGCTGCCAGGAGCTCACTGCTCCTCAGTCTGTCAAGAGACCGCAGGCAGGAGGTCCCTGT
CCTGGCCAGGCACCATGCCACTGCTGAGAGCCCTGGCAGGGAAGCGGGCGCTCTGCAGAT
GGTGTTGAGCAAGGCGTGCTGCTGCAGGGCTTCCCAAGCTGTGCAGGGTGACCTTGCTGC
AGGACAAGGGCTGTGCTCTTAGCAGGTGGAGGGACCACAACCCTGGGACAGCCCTACAGG
GATGCTGCGCCCCATCACAGTCTTGGCACTAATTGTAATTAAGACAGAACTCCCAATTAG
TAGAACCCCAGTGTAGGATGAACGTAACAGTGACCCCAACACTCATTTTGGAGGTGCCTA
CACACCCAGCTGCCATGGAGGCAATTCTGGCCACGGGTGTTCAGCAGCCTCAGCAGCACA
AAGCCCCAGACTGCATTGGTCTAGTGGGAATAAATCTCACCAGACAAACCTGATTGCTTT
TTTGATAGAAACAGAAAATTAACGGATGAAGGGAATGCTGGAGCTGTAATATATTTGCAT
CTGAGTAGAGCATTTGATACCGTGCCTCATGAAATCTTTCTAGAAAAATTAATTTAAATC
AGCTTGGAGATGAACATTGCCTTCTTCATTGAAAACAGGCTAGAAGGCTACAAAGAGGGG
TTAACAGAGAGCGACAAAGCAGAGAGTAGAAGGTGAGGAATCCTTCAAAGAGCAACAAAG
CACAGTTTCAGAAGTTTTATTTAAGGTCTTGCCTGTTTATATAGAAACAGAGGAGAAAGC
AACATGTTAGTAAGATATGATGATGAGATGACATTAGGAGGAAGTAAAAACCTCCACAAA
AGATCCATGGGCAGAAGCAGCTGGATAGGGGCATTACAAAATGAATTCAGGGTTGGTTAC
AGCACAGGAGAATTTGACCAGCTTTCCCCGCACTGGAACAGAAGAAACCAATCAGTTTTC
ATTGGCAGGAGGAAAGGAGATTCAAAACCTACGGGAACAAGTTGGGAATGAGACAGGGCA
TTGGGGAGGGCAGCGCATGTGGGGCAGCCCGGCTCCTGCCCACCTGGATGCTGCTCTGCT
GCTTCTGCACCTGGAACGCTGTGTTCAGTTCTGGGGAACTTATTAGCAAGGAGATATTGA
AAAATTGTAGTGAGTTCAGAGAAGAGCAACAAAAATTATCAAGGGGATGGAGAGACTCAT
TTATAAGGAAAGATTAAAGGAGCTAAATCAGTACTGGAAGAGCTGAATTCGTAATACACT
GTCACTCAGAGAAATGGCTATGGAGAGACATTATAGCCTAGTGCAGAAACACCAAACTGA
GGGGAAAATTCAGCAGCATGGAAGGGTGTAAAGGAAAGTATGAGGAGACCGAAGTGAGAA
AGAGGAAATGCAGACTGATGAGCCATAAACATTTCCTGGCAAGGAGGCCACATAGCCTCG
TCTGTATGAGGCTGCCGCTCACTGCGAGCTGTAGCGACAGCATCATTTCCTTCCCATAAT
TTCTAATTTCCTCTTGGGAGCTTTTGTTCAGAGGGAAGAGTTGGGATTCTGGTCTCCGGA
GTATTTTTTCCCTTGATTGTCTGAGTGCATTTAAGGTTGGCAGTACACTGGGAGCAGATA
CATGCACGCAGGTTTCCTCCTCTGGTTTGCATCTGTATTTCCCATTTAATTTCCCACACT
TGCAGTCACTTGTTGCTACTCTGCAGAAATTCCTCTCTATGTTCTTCAGCAAAGCTGCTC
GAGCTGACAGCAACAAGCTCAAGGCAGATATCCTTAATGCCCTGCCCTAGCTGATACCAG
TTATTCCTCAGGATTTCAATCTCCTAAGAAATGTGTAACTAATGCAACTCAGCACCTTGT
TGTTCTCATCTATTTTGTTTAACTTCATACACTGTATCGCTTTCACTTCTCAGATATTGA
CTAAGTCAATTCAATGCCTTGTTCTAATCAGAGCAGCACCGTTTGCATTGTTATACACGT
GTACCCATTATAACTGGGTTTTATCAAGTAGTTGGTGAGCTGTCTGTTCCAGAATTAGAC
AAGGTCTGCATGTTTTAGCTGAGATCAGCTCTCCTGTGCTCAGTCCCAGCTACGTGCTGC
TTACCAGTGATTTTCTGTGCATTTTTGAGTAGTCTGGTCCTGCTCCCCTCCTCACGACAG
TTAATTAAAGCAACTCATGTGAAGTAAACCAACTTCTGTGGGTGATTAAACAAAGGGAGA
GATGAGGAAGCGTATAACATCTACCTTGGATTTTAACCGTGCGCTTATCTGAAGAAAACA
TGGGAAAAAATGAAGTTAAACATCTCTGGGAGTACTTTTTGCCCCCACCCAAAAAGCAGT
TGACCAGAAGAAGGCAGAGGGGGGGAGCACAGACCCCACTCCTGTGCAGTGCCCACTTCT
GCCCAGGTCCTGGCAGCAGCCAAGTGTAAATCTGTGATCTTGGCACAGCGCCGGAGATGT
AGTCAGATGGCTCCGTGCAGTCATTTGCATTCTGCCTCCAGATGCTTTCATTTCTCTTGC
TTTGAGTAATATTTTTTCAACCTTGTCTTCTCATTAAAATTTCTTCTTCATTATAGTACA
TTTCAATATAATTTCCTCCCGAACTGAGCTCAGACTACAGCCTGACTAATAAGAATTGCA
TGATCTGCATTATTATGCACACATAACCCATTATAATTGAATCTTATTCCACTTTAATTG
CACGTGTTTACAAACACTGTATTCACTGCAACAGATTACGTGTTTTAGTTGATTGTGCCA
TTAATGATTGAAAAGCCAGTGGCATTTTGCATTAAGCCCACTTTTTGCTTGCATACCAAG
TGACAGGATAAAACTCTTCTGAAGAGCCATCACAGAGGTTTCTGATATTCTCTTCTTTTT
TTTTTTTGTAACTGTTGGATAGAGCTCTGCTTTAAACTGAAAGCCTCTTTGGAAACACAG
CACTTTGTATCATTGAAACTGTCTTCAGACATCCACAGTGTGACAGGATTTGGGTCAAAT
ACTGATATTTGGATGAATTTCATAGCATCATAGAATCATTAAGGTTGGAAAAGACCTCTA
AGATCACCCAGTCCGACTGTAAATCCCCCCCCACCCCACCATGCCCACTGACCACATCCC
TCAGTGCCACATCCACCCTTCACTTGAAAACCTCCAGAGATGGTGACTCCATCACCTCCC
TGGAAATTTGGAGGCCAGATTAATGTCAGCAAAAGCCCTTGCTGCCCTCAGCCCTTTGCA
TCAGCCAGGCCAGCCCGTGCTTTGGCACAATTAGAGGAAAGCTTTGCACCCAGAGCTCCC
TCTTTGCAGTGTGCTCACATGCCCCCTGACTGCCCGGCAGCTTTGTGGCCCGTGTGATAA
GGTCAGCAGATGCAAAATTGTTTAGGAAATGTCGCCCCTGAGACTTCAGATACTGAAGAG
AATTGGGAAATTTGGCAGCACGCTGTGCTGCTTTGGTGCAAGGTCAGTCAGATAAGGTCA
GTGGGGATGTTAAATCTAGCTGCTGCCTAGTTTGTCATCAGGTTTTGTAACAAGAACAAG
GGAGTCTGATAGACCAGAATCTCCAGAAGAAAGAAATAATTATTAAAACCAAACCTGTAT
TTTCACCAAGATTCATAGAAAATGTACTTTCACATTTTCTACACATTTACCCTTTGTAGA
ATGAACTGAGAGATACGTGCTGCTTCTGGGCTCTGCTCAGCTCCTTCATCACACGTTTAT
CCTGCTGCTCTTTAAGCATCTATGCAGGACATACCCTAAAAGCTGTCCTTCAGACACAGG
TAACACCTTGCTGCAGACCACCCTGCAGCAATCCCATTGCAAGCATCTTCCAAAGAGTCC
TTCAAACTGGGAAAGCTTTTTGCCACCACTGCATCACAGATCCAAGGCTTTCCCTGGAGC
TTCCCCTATTAGAGCAGGTCTCTAATTGGGAGCTGACTTCGTGGCTCCAAACATGCAGAT
TAGTTTATTAAATCTGATCATCATGTAATAAAAAACTACTACAGTTGTGAAGGAGAAGAA
AGGGTTTGTCCTAAGTGAAACAGGTTTTGGCAGAAATCAAAATGCAGCTGATGTGCTCAG
CATCTTCAGGATGCGTCTGTTTATGGCTTTGACAATAAATAATACATCACAGGCATTGAC
AAATGGAGCTTCACAAAAGCCCTGTGAAGTAAATCAGCAGTTGTTATCCAGGAGAGAGAG
GGAGACGGGGCATAAAAAGGTTAAGCATCTTGACCATGGGGGTACGGGACGCGTGATGCC
CATGTCTGTGCTGGTAGCCACCAGCCCTTTCTTTCCTGATTTTCTTCTGACTGTCAGCAG
CTGCTGGGAAGAGACACCAGTAATACATTAGGATACAAAGTTGTCAGGAGGATGTGAAGG
CGGGAGATAAATTAATGATTTTTATGTTCTGTTTATGGATTTACAGAGAAACTCGGGATT
TAATTTGGACAGTCTCGGTTCTGCCATGCCTTTTTGGTTTCATCTATTGGATTTCTGATA
ACTGCAAAGCCCNNNNNNNNNNCGTAATACACTGTCACTCAGAGAAATGGCTACCGTTAG
ACATTATAGCCTAGTGCAGAAACACCAAACTGAGGGGAAAATTCAGCAGCATGGAAGGGT
GTAAAGGAAAGTATGAGGAGACCGAAGTGAGAAAGAGGAAATGCAGACTGACGAGCCATA
AACATTTCCTGGCAAGGAGGCCACATAGCCTCGTCTGTATGAGGCTGCCGCTCACTGCGA
GCTGTAGCGACAGCATCATTTCCTTCCCATAATTTCTAATTTCCTCTTGGGAGCTTTTGT
TCAGAGGGAAGAGTTGGGATTCTGGTCTCCGGAGTATTTTTTCCCTTGATTGTCTGAGTG
CATTTAAGGTTGGCAGTACACTGGGAGCAGATACATGCACGCAGGTTTCCTCCTCTGGTT
TGCATCTGTATTTCCCATTTAATTTCCCACACTTGCAGTCACTTGTTGCTACTCTGCAGA
AATTCCTCTCTATGTTCTTCAGCAAAGCTGCTCGAGCTGACAGCAACAAGCTCAAGGCAG
ATATCCTTAATGCCCTGCCCTAGCTGATACCAGTTATTCCTCAGGATTTCAATCTCCTAA
GAAATGTGTAACTAATGCAACTCAGCACCTTGTTGTTCTCATCTATTTTGTTTAACTTCA
TACACTGTATTGCTTTCACTTCTCAGATATTGACTAAGTCAATTCAATGCCTTGTTCTAA
TCAGAGCAGCACCGTTTGCATTGTTATACACGTGTACCCATTATAACTGGGTTTTATCAA
GTAGTTGGTGAGCTGTCTGTTCCAGAATTAGACAAGGTCTGCATGTTTTAGCTGAGATCA
GCTCTCCTGTGCTCAGTCCCAGCTACGTGCTGCTTACCAGTGATTTTCTGTGCATTTTTG
AGTAGTCTGGTCCTGCTCCCCTCCTCACGACAGTTAATTAAAGCAACTCATGTGAAGTAA
ACCAACTTCTGTGGGTGATTAAACAAAGGGAAAGATGAGGAAGCGTATAACATCTACCTT
GGATTTTAACCGTGCGCTTATCTGAAGAAAACATGGAAAAAAATGAAGCTAAACATCTCT
GGGAGTACTGTTTGCCCCCACCCAAAGAGCAGTTGACCAGAAGAAGGCAGAGGGGGGGAG
CACAGACCCCACTCCTGTGCAGTGCCCACTTCTGCCCAGGTCCTGGCAGCGGCCAAGTGT
AAATCTGTGATCTTGGCACAGCGCCGGAGATGTAGTCAGATGGCTCCGTGCAGTCATTTG
CATTCTGCCTCCAGATGCTTTCATTTCTCTTGCTTTGAGTAATATTTTTTCAACCTTGTC
TTCTCATTAAAATTTCTTCTTCATTATAGTACATTTCAATATAATTTCCTCCCGAACTGA
GCTCAGACTACAGCCCGACTAATAAGAATTGCATGATCTGCATTATTATGCACACATAAC
CCATTATAATTGAATCTTATTCCACTTTAATTGCACGTGTTTACAAACACTGTATTCACT
GCAACAGATTACGTGTTTTAGTTGATTGTGCCATTAATGATTGAAAAGCCAGTGGCATTT
TGCATTAAGCCCACTTTTTGCTTGCATACCAAGTGACAGGATAAAACTCTTCTGAAGAGC
CATCACAGAGGTTTCTGATATTCTCTTCTTTTTTTTTGTAACTGTTGGATAGAGCTCTGC
TTTAAACTGAAAGCCTCTTTGGAAACACAGCACTTTGTATCATTGAAACTGTCTTCAGAC
ATCCACAGTGTGACAGGATTTGGGTCAAATACTGATATTTGGATGAATTTCATAGCATCA
TAGAATCATTAAGGTTGGAAAAGACCTCTAAGATCACCCAGTCCGACTGTAAATCCCCCC
CACCCCACCATGCCCACTGACCACATCCCTCAGTGCCACATCCACTCTTCACTTGAAAAC
CTCCAGAGATGGTGACTCCATCACCTCCCTGGGAATTTGGAGGCCAGATTAATGTCAGCA
AAAGCCCTTGCTGCCCTCAGCCCTTTGCATCAGCCAGGCCAGCCTGTGCTTTGGCACAAT
TAGAGGAAAGCTTTGCACCCAGAGCTCCCTCTTTGCAGTGTGCTCACATGCCCCCTGACT
GCCCGGCAGCTTTGTGGCCCGTGTGATAAGGTCAGCAGATACAAAATTGTTTAGGAAATG
TCGCCCCTGAGACTTCAGATACTGAAGAGAATTGGGAAATTTGGCAGCACGCTGTGCTGC
TTTGGTGCAAGGTCAGTCAGATAAGGTCAGTGGGGATGTTAAATCTAGCTGCTGCCTAGT
TTGTCATCAGGTTTTGTAACAGGAACAAGGGAGTCTGATAGACCAGAATCTCCAGAAGAA
AGAAATAATTATTAAAACCAAACCTGTATTTTCACCAAGATTCATAGAAAATGTACTTTC
ACATTTTCTACACATTTACCCTTTGTAGAATGAACTGAGAGATAAGTGCTGCTTCTGGGC
TCTGCTCAGCTCCTTCATCACACGTTTATCCTGCTGCTCTTTAAGCATCTATGCAGGACA
CCTAAAAGCTGTCCTTCAGACACAGGTAACACCTTGCTGCAGACCACCCTGCAGCAATCC
CATTGCAAGCATCTTCCAAAGAGTCCTTCAAACTGGGAAAGCTTTTTGCCACCACTGCAT
CACAGATCCAAGGCTTTCCCTGGAGCTTCCCCTATTAGAGCAGGTCTCTAATTGGGAGCT
GACATCGTGGCTCCAAACATGCAGATTAGTTTATTAAATCTGATCATCATGTAATAAAAA
ACTACTACAGTTGTGAAGGAGAAGAAAGGGTTTGTCCTAAGTGAAACAGGTTTTGGCAGA
AATCAAAATGCAGCTGATGTGCTCAGCATCTTCAGGATGCGTCTGTTTATGGCTTTGACA
ATAAATAATACATCACAGTCATTGACAAATGGAGCTTCACAAAAGCCCTGTGAAGTAAAT
CAGCAGTTGTTATCCAGGACAGAGAGGGAGACGGGGCATAAAAAGGTTAAGCATCTTGAC
CATGGGGGTACGGGACGCGTGATGCCCATGTCTGTGCTGGTAGCCACCAGCCCTTTCTTT
CCTGATTTTCTTCTGACTGTCAGCAGCTGCTGGGAAGAGACACCAGTAATACATTAGGAT
ACAAAGTTGTCAGGAGGATGTGAAGGCGGGAGATAAATTAATGATTTTTATGTTCTGTTT
ATGGATTTACAGAGAAACTCGGGATTTAATTTGGACAGTCTCGGTTCTGCCATGCCTTTT
TGGTTTCATCTATTGGATTTCTGATAACTGCAAAGCCCTCCGGTGGCAGAGGGGATTTGA
ATTGTTTTGGGGTGGAATTAAGCATTATAGCACGATGCTGTGTTTATTACAGGAAGGCTT
TTGTTTTGTGCTTATAGGGATTTGGGCAGTAGCTGTGCTCCTGTTATTAATTGTTGTGCA
TTATGAGTCACGGTAAACTTACTGCATTGTTTAATCTATCTTCTAGACATCATAAAATGT
TTAGAGGTTTCATCTATCTTAAAGTGTGAGATTAGGTCCATCTTTACACTGCTGTGTAAG
TAGGGCTGGCTGTAAGAGTATACATCAGCAGGCACGCAGGTAGTGTGGAGGGGATTTGCT
GGCTTTTGTTTACAGTGATTTACGCAGCTTGCTGTGAGTTACGAACGCTTTCGGCTGAAC
CAGTTTGACTCACACAGTCAGAACGCAGTAAAAGCAGGATCTCATCACTGCAGCTGCCTT
GCTCCTTCTTCCTTCCTTCCTTCCTTCCCTCCTTCCTCCCTTCCACACTCTCATTCCTGC
CTGCCTGCCATGTCCAGAGCTCCCGCCCTGCCTCTGGCCATGGCCACAGCACGCACTGGG
GGGATGTTTGCACTCAAGTCATGATATTTTTTTTCTAGGCTTTAAGATGCCAGCACACCC
TTCTGCAGTTATTCCAAGCCTGTAGTCAGGACCCAGCACTGATCAAATGCTTTGCTGTCC
TGTGATGAGAAGTGTGGCAGAAGTGGAACGTATTACTATCACTGCCATCCTTTGATATGC
AGTCCCTAGGGGAGCTGACATTTGAAGGGTTCTCTGTATACACTGAGGGCTGTTGTCAGC
CCGAGCAGCCAGGATGCAGGAGCGGAGGCTTGCAGGTACTTTGTGCCACGCACTGAGGAG
GGAAATCTTTTGTTTATGGAGAGCAGCTCTGCAGAGCTGGAAGGAGCCGTCCCTGTAGCA
CCAGGAGAAGAGTTGGTACAAGGTCAGAGCTTTTAGAAAGGGCAAAGACAAAACAAACCA
GGCGTGCATGCGCTCGTGTGTATTTGCATGCATGTGCATATGTAAGCAAGTCTGTGGATG
TAATTAACACCTAGCTTTCTGGAGAAATCTGGAGAATACAGTACACTGTTGCAGAATACA
TACATTCTTACCTTTGTGTGAATACAACTGCATTAACCTTAAAAAAGGAAGGAGGAGGGA
TTTAAAGCACTGCAATAAGGCTATGCTGAGCATGAGTCCCTTGCAAAATTCTTGCTAAAT
CAAACTCATTTTTAGTTAAATAAATTCATAAAGTCTTGCATCACACCAATGATTACCTTT
CATTACTGATAAATGGCCAAATATATTATCTTTGTTTTTAAGCTGGCAAAGAGATTTGCT
CTCAGCCTGAGACGCTGTCTGCCAAGCTTCAGGACTGAGGCAGATTGTTATGCTTGAAGC
TTTGTACACACACACACACACACAAATAAATAAAGAAGGGTTTGTTGCTGGCAAGTTGGC
ACAGTCTTAACTAGTGTTGAGCAGCAGGAGACTCTGGAAAGCATACCAGGCTTGGAGTCA
GTGAGGAAAAAGGGAAATTCTGCAAACAGGTACCGAAGTCTTGCCATAAATGGAACAAAT
TAAAAGGGAGAAGTGAGCAGAGGAAGTGCTTCAAAGGTAGGACAGCTTGTGGAAAGCAAA
GCGTGTGGGTAAGACCATCAGAAACCAGATTGCAAAGTGATTAATGAACTAGAGTTGAAT
TTTGGTCCTTGGGACCAGAAATCAATTGCATCCCAGCAGGAACGCTGGAGATCTGAGGGC
AGAAGTCAAGCCACACTGAAAAAAATCTGTGCTCAGAGCCCACACTTTCTATCCACCCTC
TCAAGCACCTCTTCTTCCAGCAAACACTGATGATTCGAACTTCCCAGCCAGGCTGCTTAA
CTTGGTTTTAGGTGGAGAAGGCAAGCAGAGGAGGAAAAAAGGAAGAGACGAGGGAGAAGA
GAAACAGCAGCACACAGAGCTCCAAGAAAATGTTTGGATGTACACCAAGAGAGATCCTGG
ACGTGAGGACAGTTCAGCTCCCAGCCCCAGGAATTCCCTGAAGCCCTGAGAATGCCCGCA
ATGCAAACCTGCTGGCCTTGCTGAGATGTGACATCGCAGCACAACTGTTTCCTGTCGCTG
CTATGCTGGGTGCTGCTAAGCTGCAGAGTGGTTGCTGCTTTAAGCTAATTCTCAGAACCA
AATGGAGGGGCTTTCAAGCACCAGAAATACCCAACGATTAGCTCAGCAGTGGCTAAAATA
AAAGAAGGAGCATGCGTGGAAGAATATTTGGCATATTTCCAGGTCTTAGCAAACACGAAA
CCCCATCAGTCTGAAGAAGCATTAGGAGTTTATGATGTGGAAATAACTGGCTGGTGTGTG
ACGCATTTCTAGCTTATGGTGAGCAATCTATTAGAAGAAAATGTTGTAGACGTTCTGGGG
CTGGGCTCAACCTCACTGCTGCAGGCCAAATGCCATGAACATGAGGCGAGTGTTTCAGAA
ACAGAACAGCCTACCATGTGCAAAGAGGGAAGAGATCAGGAAACATTAGACATAATTACT
CCTCAGCTATTTAATACTCAGATGAGGTGATGGGGAAAAGTCTTCTGTAATAGCTGAGTT
CAGGCAGCTGATATATGCTGTGGTGTCATCTTTGCTGGCTTCCTCTCATTCTGAGGCATC
TACCGGATGGACAGAAACCTTTTACAATTTGACCATTTGACTTGAAGCGAGCTCTCACAG
TAGAAGAGAATCTGCCCAAACAGCAAAAGGGAGTGAACTGTTTTCAGTGCATCTACTTCT
AACAGCAACAAAAAAGGCAGCTCAGTCATGTCCAGCAGCCAAGGTCAGCACGACCTTGGG
TTTGAGCAGCACCCCCTGCCCACTCCAGTGGAGTAGGGTAATTCTGGACTGCTGGGGATC
TCAAAGCACTCCACAGACACTGCCTGGCTTTACAAATATCTTCAGCGACAGAAAAATATT
TGCTATACAAATAAACAAACTGAAACACCAGGAAAAAAGTTGTTAAGTCAACAGAACAGT
CAGTGACTACAGAAACTGTGACTGCCAATTCCTCTTTTACCTACAGTCTCCTTGGGACCA
AGCCAAGCAGAAGTGTCAGCGTCCACATTCACCCATATTCCGCAGTGACAAGAGATGGCA
ATGAATCACCAGAGTAATCCCAAATGGTGTTCCCAATATCTGTGAATAACTAATGATCAA
TTTCCGAAGTGTTTCCTTTCTCTAGAGCAGTTCTTTCTTGGAAGAAAGCCTGCAGTCGGG
TCAGCAGAACAGTTTTCTTACTTCCATAACCCCGGGGGTGCAGGATCTGCCCCAGGACAT
CTGTACAGGGATGATGATTGCAGACCCAGCGTTGCACTTCAGATGCCCTGAGCTCCTGGC
ACTCATAGAAAGTGCCAGAAAATATGAGCCTGGAGTTATTCACACTGGAAAATGGGCCTG
GGTCTTTTTTTTCCCACTTTTAAGTACCCAGTTTCTGTCTTCTGGGTCTTTTCAATTCTT
CTATCTGCTATTTTTGTCAAAAGGCAAGATTGGTGCCCTTTCTTTGACACAATCTTTTCA
GTTCCTCTGAAAAAGAAAAGCTGCAGTGTCACTGACAAAGGACCACAGGAGCGATTCTGT
GACGCGCTCTCTGCTGGAGAAGTGCTGGTAGGTGTCACCCAGCACCTAAGGAAGGGATAT
TTGACACGAGCTCTTCACCTCTCAGAAACTGTATTTTCTGCAGTGATCACAAAGCTAGGC
TTATTTTCCCATCTACAACCTGTGACACACAGAAGCTTCCCAGAATCAAGTGCTTGCTCT
CCTGAAGTGCCAGGTACTTCTCAAACGCTGATATTACCTGGACTCTAGCTTACCCACTTT
TATTTCCATTTCAGACAGTACTGCACAGTACACTGCACGGCCTGAACTTGTTAAAAGAAA
GCATACAGCCACTTCCAGGAACAGTCAGTCCCCTTTGCTTCCTGAGTTAATTATGACAGC
AATTTGATGGACTCCATGAGTACCTTTATGCCCCGAAGACAGGACCTGCTGGGGGATGAG
CTGAAAACATGCTTGCTTAGATAAGAACAAGTATTTGAGTGGCATCCTTGTTGCTTCAGT
CACTCTTAAGAAAATGTGTCAAGAGGTACTTTCATGGGTACATGTCGTCTCAACCATGCT
GTTGCTCAGCTCACCTTTCTTACATGAGCTAAGGAGACACCTACTTTGTGCCAGCAGAAG
GAGAACTTTTCTCTGTGCTTCATAAGGCTTCTGTTACTCTGCTGGAGCCCTGCTACCCTT
TGGGATCATCACTGTGACATGGAACTAAGACCTCTACCAGCAGACATAAGCAAGCCTGCT
TGAAGCGCCAAGCCCCGAGATGTGCAGAGCATCAGCACTGCCCCAAGTGCTCTTTACATC
CCTGTGCCATGGTGGTGTGATCAGCAGGAGGCTGCAACCAGGCAAGCCACAGCCATGCAG
GCTTGGGTGCACAGGAGGCTGTGCCTACATACCCTGAGAGCACTGGCCTGCAAGCAGCAC
TGCAGCAGAGCATCAGCCATCTGCAGCAGTGTGTATCTTCTGCAGGTGCCTCAGCCCCGT
GATGCTGCCTGGCTCAGTGCTGCTCCCAAACCTGAGCAGCAGGAGCAGCAGCCGCTGGAG
GTCACTTAGCAAGAGCCCAAGGAACGAGAAGGGGGAAGGACTGCCAATGCTCCACCTTCT
GCTGCTGCTGTTTGCCTGAGAGTTGAAGCTCAGACCAGTTCTATTTTCAGGATTTAGATA
AAAACTCTGGGCACAGGTCATGAATCTTTCAGCTGCAAGGAAGCCTGACTCCTTTTTTTC
CTGCAGAGCAGGAGCAGAAGTGCAGCCAAGCTGCCTGGCTGGAGAACCCTGCATTGAGCA
AGCCTTCATCCAGGGACAGGAAGATGCTGACACTCACATACATGCACACTGGGGATATTC
ACACATGGACTCACAGAGCTGGCCTTCAGTTGGTGTTTTTGCACCACAGACAGGAGCAAA
GTTTCTCCTCCAAGCCCTCCTTCAAGTTCTCCTCAGCCCCTGCCCTGCAGGGTTTCACAG
AATTGCTGTGAATCAGAAGCCCTCATGGTATGATGAGAAAAGCAGTGGGCTGGGAGGGGG
TTCTGCGTCACCAAGCCCAGTCACAAGTCACCATGTCACAAGATCTCTTTCAACCAGCAG
TGAAGCTCTGTCTTGAAGCTAGTTTGTTTTTACCTCCACTTCTTTTTCAAAAGGACCAAT
CTGGTGCCTCATTCTTCTGATGGCTGGAAACCTCAGAATTTCCAGCCTAAGTATATCCAT
GACCCATTTATGCCTATTTGTTCCTGTGCCAATGCTGGCCTTGAGTTTAAATCTCTCTTC
TCACTCTCCACTGTTAACTCTGCATTTATAGACAGCAATCACCTCACTCCATGCCAAATA
AAGGCTGCGCCTGCTGCATTTCTCTGCAGCTGATCCTATTTTAGCACACCTTCTCTGAAT
GGGTGTGCCAGGACTGCCTGCTACTTCAGGTGGGGTCTCTTCAGCCCTGGTTCAGTGATG
CTCAATGCTGGATTTCACATCAATAACGCATGACGTGATTTCCATGGGGAATATAAACTC
CCGTGAGAATCATAAATGCCATCAACCTCTCGCAGCAATCCTAAAGGGAGTCCAGGGGCA
GCCACTGCATCCCAAACTTTCCCCAGTCCATTATATATTTTCCCTGAGCCATCAGAGACT
TTCAGCACAGTTCCACTAATCTCTGTTCCCTCCAGTTTGACCAATCTTTTCACTATGCCA
TGTACTGAAGTCCAGAGAGATTAGAGAGAAGTCCAGAGAGATTGGATCTAGTGCACTGCT
TTTATCAAGAAAATAAATTATCTTATCAAACAGAAGAATCAAATTCATGTGACCCAATAT
GCCTTTGCTAAACCTATGTTGCATTCTTTCCATCAAAAAGCAGTCATTTTCTTTCATAAA
GCTTTTTATAACATCGAGCTTGGACAAACAAGCCTTTAGTCATATTGAATATATATTTCT
CTTACAATATGCAAAGCAGGTATTATTCAGAGAGGCGATGGGATCCAAGCCCTGTCTGGA
GATAGATTCCCTACATATTGACTCCAGCAAAGACAGATCAAAATAGCAGCTAACCTCTAT
TACCTACTTTGCTGGTGGCTTTCTTCTTTTAAATGTTTGGAGTGTTCTGCATTTGTTGCT
TCAAAAGTGGTTTATAATCAAGCTTTTGCAGTGCCAAAGTACAGAATCAGGGTTGTAGGA
AACAGACTAAGTTCTAGAAAAGCAACGTAAGACCTGTATTCCCACACAACCAGTGGAAAC
AAAATACTACATACTTTCCCCTGGCAATTAGGGAATCTGTTCCCTAAAACATATCAGGGA
ATTGTAAAGTACCCAGAAACAGGTGATTAGAAATGAAAATAAATCAGAGAATATTAGATG
TGTTTTGCTTGGGTTTGCTCCAAAGGCTTCTGGATGGTGCAGCTAACAGGTTGTTAGGTG
TCCACAGCCTTCTGGCCGGGGATCTAATTCTTAAGCAGCTCTGTATCCTTTGGTCACTTC
TGGAAAAGGACATAGATCCGGGGACCTGATAGGTGCCTGTGTGCTGAGTTTATGTTAGCA
AGTTATTCAAATCCTTGTTTTCAGCAGCCAGGGCAGGATGCAGGAGGACTCAGGCCATTT
CAATCGCTCACGAGGCAGACCTCCAAGCCGTGTCGTACAGGAATGCAATATGGCATTTTA
CTACTTGTTTGTGCTACATGCAAACAGTAAAGTTGACGAGTTAATGAAAATTAAGAAAAA
TGAGGGCATTTCACGCGAGCTGTACTAGGATTGTTTCAAACAGCCCTGCATGGACAATTA
ATCTCCTGCTCCTATTACAAAAATGAAATGAATGGTCAGTGGCTGGAATTAGAGAAAGTA
ATGGAACTGAAATATGGTTATTAACAAAGACAGACCCTGAAAGAATACCAGAGTCCAGCT
GAAAGTTCAGCTAAATTTGAACCCAACTGCAGAGAAAAAACACACTTAATTTTTAATGTT
TCACAAAACATTTTTTATGAATCTAGAAAGGAAATTTTAGCAAATCTGATTATGCAAGAT
AAAAAGAAGCTCTTGTCATAATTAATCCAATTTAGAAATCAGATGCCAGCAAAGGGGGAA
ATTTCCTTCTCGTTTACATTCCTGTCAGCCCACTGAAATCAGAAGGGCTTCAGGAAAGTT
AAAGAATTCCTTTGTGAAACTGTATTGCCCAACAGTAAAGGAGCTGAGACATACATTTAG
GTGGCTCTCCCAACGTACTCAACATTATTGAGGGTCATTAAATGAATGAAAGATCTCTGG
AGCAAAATCCCACTTTGGGATTTAAGTTTTTAAGAGTAAAATGTTTGTCCGTCTAGAGTC
AGGAATTATAGCAGAGTAGAGAATATATCACATATATATCATACCAAATACTGAGATGCA
GAATCTTGTTCCTTTATTTCATTAAAGATGGCTATATTAAAATTAATGACGTGAAATATC
ATCTGAGTATCTCGAACTTTTCATACGGGCCAAGGAGTGTTCCAGTAGCTACAATACCAA
GGGGCTACTGAAATAAAGTGCACCAGTAATTGTGGACAGTGTCTTTTTGTTCAGTGTTTG
CACGGCTCTTGTCACAACAGTGCGGTCCCTGGCAGGAAACCCTGAAAGGACTGAGCTGTC
CAAAACAATTAATACCTGTGGTTGATTTATTCGTGGAAGAGGGAAGAATAAGCACATCTT
CAGTGTTGGGACTCAAAGCTGTGTTCCTCGTCTCGGTGTGTGGGAAAAGTGTTAACTTAC
TGCCAGTTCAGTAGCACCTATTGGCACCAGGTCGATGGTCCTCACATTATCCCAGGTTAG
GCATGGCCACATTCTGTTTTCATTAGTTTGCTGCACCAAAGGTTATTAGAAATATAAGCA
TGAAAACTAAATAAAGGAAATCCCATAACATCCAGCTGCTCTCACTGCAGTTGAGCATTA
TTTGAGGGAGTAAGGATTTTCTGGGATGGTTTTCCAGATTCTTTCTATTGTCTCACCACT
ATGACATAGGCAGTGGCTGTGGGCTAAGGCTGGGAGCCCTGCAATAGAAGCATAGGACTT
GGGTCCTGTTGGACAAATCCATAGGCAATGTATATTTTAAGCATTTAGCCCCTCACAACA
GTAGGGATGTGTTCCACAGCTTGCAGAGTGTCTTCTTTGCCTACCAAGGTTATTTGTAAG
AGTCCCAAAATAGAGCAAGTACAGGCACAAGAATTTAGAGAATCTCAAAACTTCCCAGAG
CAGAGGAAAGGTCAGGTTACAGGTGAATTGATGGACAAGTTGTTCCTTTTACTTTGTTCT
GTTTTTAATATTGCCTAAGTAGAGAAATGATGAAACATTACCTCAATAGGCATAATGAGT
GTAAAATAATTTCAAGCAGATGTAAATAAATAGTGTTAGGTAATTAAAAACTGAGATAAC
TCACTGGCTAAATTCCTCTGGAGTCCTCTTCACTGCAGCCTTTGATGGTACATTAATATT
TTATATGCAAGATTGAAAAACCTATCAGGGAGGATGGAAAGCAGATTTCTTTTATCAATG
GAAAAAGTGTGTTTATGCCAAAGGAGTACCCCTCTGGCCTGTGATAAAGGCAAAGCTTTA
TCATTCTACATTTTCTCTTAGAAAGAATCAGTCCCATGTCCTCAGCAGTTGTGATGGCAG
GGAATATGAGGCAGATTTCTGCAGGCACAGTAAGTTTTTCACATGTGGGAGATAACTTCA
TATACAGCCCATATATCTTTGGAGATATACATTTCAGACCAAACATTGACCACAGTGGTA
TAAATCTCGAATGACTCTACTGCAGTAAGCACAGTGAATTCCCAGTATTCACTCCTGATT
TACAGAGGACCACTGAGAGATTTGGACCCTTGGAGAATTTTTGATATCTACGTATCCACA
TATGTTTCAGTTTTCAGCCAAAGCTCAAAAAAAAAACACTTTGTAAAGCAGAGCAGTGCC
ATTATTTCTGCCTTACAGGTGGGGAAGCTGAGGCACAGCACTACAAAACAGCCCCTCCAC
AGAACAGCTCCCAGATCCCACGGCATTTACCCCTCTGCCCCCACACCACATCATTGCTCC
AATGAAAATGGCCTCATCCAACACAACAATCACTTTCCCTCCTGCATTGCATCTCCTCTC
CACGACTTGATCCTTAGCACCTGGAGTGCAGAGCTGAGCACACAGCACCAAGTCATCAAA
GGCACTAAAACAGAAACATTTCGCTGATGCAAAAGACCTTTCAAAAAGAGAGAGAATGAA
AATAGAAGCATGAGCTTCATCAGAGAAGTGACTATTCCACCAAAGCAAAGCAGCAGCTGA
ATAAAGAATAAAAGCAAGAAGAGATTAAAGGAGATACTTGAGTCCTGAAGAAAGGAGAGC
ATTGCATAGCAAATGATTTGCAGGGGGTGGAAAAAAAAGGTGAGGGATCAATTCTCCAGC
AATATTTTGATGAAGTTGCCAGAGAAGTAAAATTACTGTAGGAATAGGACAATGTGGATA
GAGAAAGCCAGCATGAGGTGGAAAAGACAGCTAGATGTCGTATATAAAATCAGAGAGCAT
CTAAGTGGCCTATTTGTTTTTTTCAGTGGAAGGTGATTAACGCAACGAATTATCCATCAC
AAAGCATGGAAATCGCAGCAGAGATGATTGGGACACTGCTTCTGGGAACGACTGATCCCC
TCTGATCATGGCATTCCAGGAGAGGAGTAAATTGGGAGAATTGCACGCAGAGCTTAGACC
AACATGTGCTGCAAATGTTTGAGCAGTAATCCATTGCTTAACAAATGGGAAAGCAGCAGG
CAGCAATTGCTTCTCAGCAGAACTGTTCAGAGCAGGAAAGCATCCCTGCCCAATGGCTGC
ACACAAAATCAGGCTCTGAGAGCACTGCTGCTGAGCCCCAAACAGAGCAGAGTAAAATCA
CCAGAGCATGAAATTCTGCTGGAATTACTCTCCACGCACCTTGGAGACTGGCCCCAGCAA
CTGGGTGTGCATCCTCAGATACATATTTTACTGCCCTTTAAGCAGTAAACATCCACCGGG
CCCAGCAAGCAGCATTGTGCAAGCAGCCTGTTTTGTTGGATTCTGTTTTGTTGCTGCTCA
AACTCACAGTCAATCTTCAGTGATTTACTGAGGAGGATTGGGCACACCAGAAATCATTTT
ATTTCATCATCTCTGCCAAAGGAATTCAATAGTTTACACTACCCGCCATTGTGAAAGATG
CTGTTCGAGTCTGAATGTCCCCTCCGGGTAATCATAAAAGGATGCCTGACTCGTATCTGA
GCAGAAAAAATAGCGAAGCCCCTGTCTGCACCAGCAGGAGAGGGGAAAAGGATTATTCCG
ATGTCTTTGCTGATAGCTGTCTCGGACATTTCCCATCTCTGCTGTTCCTCAGTACCATTG
AGGGCTATAGACATTATTACAACATGTGGAAGCTCTGATGTTTCTGACAATTAGCTGTGC
TTTATGGTATATTTGATCAGTGTAACATACAATGGGTAAATATTAATCTGGAGGCACAGG
GAGGCAGAAAGCAATGGAAGGGTTAAGCTGCCTTTATTTTTTGCCAGCAAGTATACATCC
TCTGTTCCCCATCCACCCCCGTAAAGTACAAAATGTAGCAGATGTTTGCGAACAGCTAGC
CTGATCTATCAGCCTTTACATAAATGAAGGCTGAGTTACTGAAGGAGAAGGCAGAATAAT
GTTTACAAGAGAAGAGCAAGAAGATTTCCGACACCTGGGCAACTTAATGATGGCAGATGG
CAAAAGCTGAAGGCAAAGAGAATCAGCAACGTGCACCAGCAGCTGTTGAACAAACGGGGA
GGAAGAGGGCCTCCTCCAAAACTGCGCGGGAAGGATTTAATGCCCGCAGTTGGGTAAGGG
TGAGAGCGTCAATATGCAGAGAGAGGAGCCCGTGCTTTAACTCCTCAGATAACTATTGTC
AGAAGTACCCAGTGGACTGTCAACCGAGGAGATTTTCACAGCAAGAAGCCATCTATTTGC
ATCAAACAGTGTCAGCCTGCAAGGCAGAGACTTCTGGGTCATTTAACAGTGCTCCAGATG
TAGTCATTTTCTCCGAGGCGAGCGGCTCAAAAAGAGCAATGTGAGAAAGAGCCAGTCGGC
ATGGAAAGGGGACAATCAAGCAGCATGTGGAAGTGATTAACCACTCTGTGCAAGGTAACT
CAGTTAATGGACAGAGCTGCAGGACACCTGGCTGTCCGTGGTGCTCAGCACAACAGAGAC
TGCAGGGCTGGAGCCAAACACAGGGCTGCAAAGCGATTTCTGGCTTTGCACTAGTGCTGT
ATTATGACCAGATTACGACTGGTCACCCGGCAGCCTGGCTGAGCGTGTGCGCTCCAAAGC
TGCAGCAGACACAGCGTTGACTGTTGTACCACAGGAAAGAGAACAGAGAGCATCTAGAGA
TGTAAATGAAGGCACTGACATCAACTGACTTTCTTAGTAATTCTTTCATGGAAAAGCCAG
GGGTGGGATTACAATGTGTAGCCAAGATCAACATGAGGATTTTATCTACCGCCATACTGG
ACTCACCCTTTCTATGGAATATCTGCCATCAGCAAAGCTCAGTTCTGACTTCAGGCTCCT
CAAAGCCCAAGAGTATCTAGATGTGCATGACAGAATTTGGCTTCTTTTACAGGATTATTC
TGACTAAAACTAACTTTACTGTCTAAAACTCCCTGAAAGGAGGTTATAGCAAGTCAGAGG
TTAACCTCTTTTCCCAGGTAACTAGTGATAGGATGAGGGGTAATGGCCTTAAGTTGCACT
AGAGAAAGTTCAGGTTGGATATTAGGAAAAAATTATTCTCTGAAAGAGTGGTGAGGTATT
GGCAGAGGCTGCCCAGGGAGTAAAGGAGTCACCATCCCTGGAGGTGTTCAAGAAACATGG
AGATGNNNNNNNNNNTCTCCTTGGTTGTTTCCTACACACACATCTATCAGGTAGATTTAA
GCCTTTTAAAATTGTTGCAATTCCTTTGCAAGCAATAGGCTTTCTCAGAGAGGGTTTGCT
GCAAACCACATCCATTGATATGCAGCTCCTGTTGCATGTCTGTAATATGCATGTAATATG
CATATCCTGTTGCATAGCCTGTAACAGTTGCACCTGTTGTCAGAGTGACTTTAACTTATG
ATAGAGGGTCTCCTTTGGGATCACCGTGGCAGGGAGGTTCAGGAGTTCTTTATTGACCAC
GCAAGGGGAGCTGAGAGCCATCCATTCTTTATGAGCCACCTTGCATACACAGGTGGGGAA
CAGTGCCCATAGATGGCAGTGATCCCCTGCTACAGCCTACCAGTAAACACTATTGTCTCC
ACTTCAGCACTGAAAGCTCTCAAATGGTTACCAACAAAGTCAGAACCCCCAGGTCTGTGT
GATTGCAGCAGGAATGTCTGATGCCTCTTGTACTGCTGTGCCATCCCACTCATAAACCAG
CGGCACAGTGAGCCCCTAAGTGAGACAGGTGTGCATTGTTCAGGACAAGGAGAACTTTTC
TTTCCTAACTTTTTTCTTCTCCCTTAAGGATAACTTTAGTGCTTAGGAAGTTGCTGAATA
GGAGGTAGAGGAATATTTATTTAAATGATCACAAAATTTGTCACTGTGCACAGTATATCC
ACTTTAATCCTAGGGTCATGGACAGAATGGTACCAAAAGTTCAGGCAGGTGCTGGTGAGA
AGCCGAGTGCCAAATGTTTCAGGCTGCCTCCAGCCTCTCTACCACTGCTGCTGGAGGTGC
AGCTGCACTGGTGGCTTTTCCTTTTGTCCACTAGGGACCACACTGGGACCAGCAACTCCG
GACTGACGGCAGATGCTAGCCAACGAGTTTTGATCTGTCCTCACCAGGCTGGTTATGAAG
TAGCAGCCAAGGAACAAAGAGCTCAGCAGGGCAGTAATATTTCTGACCTGGGATGTAGGG
ATGCACACACATGCACTGAAAACAGCAGTCTGGTAGCATCCTGTTACAACCCCTCTTCCA
CACACCACAAATACTACACGGTTTGTGTTTCTTCCATTCATTACTATCCTGCATTCTGGC
GACTTGCAAATTTAGGCTGTAAGACCCTCTCTGCAAATGGTATTTTACCTTTTGGGAAGC
ACCGTCTGCTTCTGTCCCGTGTAATTCCAGCAACTGGCAGTCCCTACACCCCCTTATTCT
CCTCCTGCCTCATGTGCCCCACGGAGCTCCGTGAGCTCTCAGCTCCCCACCTCCCAGCTC
AGCCCCACTCAGGTGCTGCTGCCCTCATTTTGCTGCTTGCATCGGTTTCAGGAGCTCCAG
TCCCTTCCTTCCGTTCCCCGGAGCAGCTTTCCCTTTAGTTTCCAAACAATGTGTGAAGCC
CAGTTCTGCAGGCACAGGAGCCTCAGTGAGTTTAAGGATGACTGAAGCTATTTCCTCTCC
TGGGNNNNNNNNNNAACTTTTCAGAGCAGGAAAGCATCCCTGCCCAATGGTTGCACACAA
AATCAGGCTCTGAGAGCACTGCTGCTGAGCCCCAAACAGAGCAGAGTAAAATCACCAGAG
CATGAAATTCTGCTGGAATTACTCTCCACGCACCTTGGAGACTGGCCCCAGCAACTGGGT
GTGCATCCTCAGATACATATTTTACTGCCCTTTAAGCAGTAAACATCCACCGGGCCCAGC
AAGCAGCATTGTGCAAGCAGCCTGTTTTGTTGGATTCTGTTTTGTTGCTGCTCAAACTCA
CAGTCAATCTTCAGTGATTTACTGAGGAGGATTGGGCACACCAGAAATCATTTTATTTCA
TCATCTCTGCCAAAGGAATTCAATAGTTTACACTACCCGCCATTGTGAAAGATGCTGTTC
GAGTCTGAATGTCCCCTCTGGGTAATCATAAAAGGATGCCTGACTCGTATCTGAGCAGAA
AAAATAGCGAAGCCCCTGTCTGCACCAGCAGGAGAGGGGAAAAGGATTATTCCGATGTCT
TTGCTGATAGCTGTCTCGGACATTTCCCATCTCTGCTGTTCCTCAGTACCATTGAGGGTT
ATAGACATTATTACAACATGTGAAAGCTTTGATGTTTCTGACAATTAGCTGTGCTTTATG
GTATGTTTGATCAGTGTAACATACAATGGGTAAATATTAATCTGGAGGCACAGGGAGGCA
GAAAGCAATGGAAGGGTTAAGCTGCCTTTATTTTTTGCCAGCAAGTATACATCCTCTGTT
CCCCATCCACCCCCGTAAAGTACAAAATGTAGCAGATGTTTGCGAACAGCTAGCCTGATC
TATCAGCCTTTACATAAATGAAGGCTGAGTTACTGAAGGAGAAGGCAGAATAATGTTTAC
AAGAGAAGAGCAAGAAGATTTCCGACACCTGGGCAACTTAATGATGGCAGATGGCAAAAG
CTGAAGGCAAAGAGAATCAGCAACGTGCACCAGCAGCTGTTGAACAAACGGGGAGGAAGA
GGGCCTCCTCCAAAACTGCGCGGGAAGGATTTAATGCCCGCAGTTGGGTAAGGGTGAGAG
CGTCAATATGCAGAGAGAGGAGCCCGTGCTTTAACTCCTCAGATAACTATCATCAGAAGT
ACCCAGTGGACTGTCAACCGAGGAGATTTTCACAGCAAGAAGCCATCTATTTGCATCAAA
CAGTGTCAGCCTGCAAGGCAGAGACTTCTGGGTCATTTAACAGTGCTCCAGATGTAGTCA
TTTTCTCCGAGGCGAGCGGCTCAAAAAGAGCAATGTGAGAAAGAGCCAGTCGGCATGGAA
AGGGGACAATCAAGCAGCATGTGGAAGTGATTAACCACTCTGTGAAAGGTAACTCAGTTA
ATGGACAGAGCTGCAGGACACCTGGCTGTCCGTGGTGCTCAGCACAACAGAGACTGCAGG
GCTGGAGCCAAACACAGGGCTGCAAAGCGATTTCTGGCTTTGCACTAGTGCTGTATTATG
ACCAGATTATGACTGGTCACCCGGCAGCCTGGCTGAGCGTGTGCACTCCAAAGCTGCAGC
AGACACAGCGTTGACTGTTGTACCACAGGAAAGAGAACAGAGAGCATCTAGAGATGTAAA
TGAAGGCACTGACATCAACTGACTTTCTTAGTAATTCTTTCATGGAAAAGCCAGGGGTGG
GATTACAATGTGTAGCCAAGATCAACATGAGGATTTTATCTCCCGCCATACTGGACTCAC
CCTTTCTATGGAATATCTGCCATCAGCAAAGCTCAGTTCTGACTTCAGGCTCCTCAAAGC
CCAAGAGTATCTAGATGTGCATGACAGAATTTGGCTTCTTTTACAGGATTATTCTGACTA
AAACTAACTTTACTGTCTAAAACTCCCTGAAAGGAGGTTATAGCAAGTCAGAGGTTAACC
TCTTTTCCCAGGTAACTAGTGATAGGATGAGGGGTAATGGCCTTAAGTTGCACTAGAGAA
AGTTCAGGTTGGATATTAGGAAAAAATTATTCTCTGAAAGAGTGGTGAGGTATTGGCAGA
GGCTGCCCAGGGAGCGATGGAGTCACCATCCCTGGAGGTGTTCAAGAAACATGGAGATGT
GGCACTGAGGTACATGGCCAGTGGGCAGTACTGGTGGTTGATGAACAATTGGACTAGATG
ATCTTAGAGGTCTTTTCCAGTCTTAATGATTCTATGATTCATTTATGCTGTAATTATACA
TTCTTAATGCACAGCGTTACCTGCTGTGCATGTTGCATCTGCAGCCCTGTCAGTCTAATG
CTGTGCTGACCCAGCATGGAAGAGCCATCATCATTGCTCCAATGTCTTCAGCACGTGGCT
CGCACCAAGTACCTATGCATTAACGAGTCTCCCTGCTGCTGTTTCAAATCCAGACATGTT
TTGAAGAGCACGCAGCAAGTGAGTAGAAAGAGTGCTGTCTGAGAGGTATGCAATTTCAAA
ACAAATTCAAAGTGTTCCTAGAGAATTTATCACCACAGGAGGAGAAAAGGTTATTGTATG
TGTAACCTGCAGCTCTAATTATATTGTGTACTTCCCTTGCGCAATTAGAAATGTGTAACA
GATAGTTACACTTCCTAGTTATGTTTCTATCAAATTCTTGTTATAATTAGGATGACTCAC
AATGAAATTATGCATTATTTGTTCCATTTGTTATATTGTTTGACTTAAAATCAGCATGCA
AACTACAAATCTCCTGAATTCTTCCTCTCCACCTCTCCTTGGTTGTTTCCTACACACACA
TCTATCAGGTAGACAAAAGCCTTTTTAAATTGTTGCAATTCCTTTGCAAGCAATAGGCTT
TCTCAGAGAGGGTTTGCTGCAGACCACAGCCATTGATATGCAGCTCCTGTTGCATGTCTG
TAATATGCATGTAATATGCATATCCTGTTGCATATCCTGTAACAGTTGCACCTGTTGTCA
GAGTGACTTTAACTTATGACAGAGGGTCTCCTTTGGGATCACCGTGGCAGGGAGGTTCAG
GAATTCTTTATTGACCACGCAAGGGGAGCTGAGAGCCATCCATTCTTTATGAGCCACCTT
GCATACACAGGTGGGGAACAGTGCCCATAGATGGCAGTGATCCCCTGCTACAGCCTACCA
GTAAACACTATTGTCTCCACTTCAGCACTGAAAGCTCTCAAATGGTTACCAACAAAGTCA
GAACGCCCAGGTCTGTGTGATTGCAGCAGGAATGTCTGATGCCTCTTGTACTGCTGTGCC
ATCCCACTCATAAACCAGCGGCACAGTGAGCCCCTAAGTGAGACAGGTGTGCATCGTTCA
GGACAAGGAGAACTTTTCTTTCCTAACTTTTTTCTTCTCCCTTAAGGATAACTTTAGTGC
TTAGGAAGTTGCAGAATAGGAGGTAGAGGAATATTTATTTAAATGATCACAAAATTTGTC
ACTGTGCACAGTATGTCCACTTTAATCCTAGGGTCATGGACAGAATGGTACCAAAAGTTC
AGGCAGGTGCTGGTGAGAAGCCGAGTGCCAAATGTTTCAGGCTGCCTCCAGCCTCTGTGC
CACTGCTGCTGGAGGTGCAGCTGCACTGGTGGCTTTTCCTTTTGTCCACTAGGGACCACA
CTGGGACCAGCAACTCCGGACTGACGGCAGATGCTAGCCAGCGAGTTTTGATCTGTCCTC
ACCAGGCTGGTTATGAAGTAGCAGCCAAGGAACAAAGAGCTCAGCAGGGCAGTAATATTT
CTGACCTGGGATGTAGGGATGCACACACGTGTACTGAAAACAGCTGTCTGGTAGCATCCT
GTTACAACCCCTCTTCCACACACCACAAATACCACACGGTTTGTGTTTCTTCCATTCATT
ACTATCCTGCATTCTGGCGACTTGCAAATTTAGGCTGTAAGACCCTCTCTGCAAATGGTA
TTTTACCTTTTGGGAAGCACAGTCTGCTTCTGTCCCGTGTAATTCCAGCAACTGGCACAG
TCCCTACATCCCCTTATTCCCCTCCTGCCTCATGTGCCCCACGGAGCTCCGTGAGCTCTC
AGCTCCCCACCTCCCAGCTCAGCCCCACTCAGGTGCTGCTGCCCTCATTTTGCTGCTTGC
ACCGGTTTCAGGAGCTCCAGTCCCTTCCTTCCGTTCCCCGGAGCAGCTTTCCCTTTAGTT
TCCAAACAATGTGTGAAGCCCAGTTCTGCAGGCACAGGAGCCTCAGTGAGTTTAAGGATG
ACTGAAGCTATTTCCTCTCCTGGGGAGGTTTAAAAGCCGCGGGGGGATGCGTGGGGTGAG
AGCGATCGCCGCGTTTCCAGCAGCCGCCCTCTCCCAGCGCTGAATCGCGGCAAGAGCAGT
GTGCCCAGCCTGGGTGAATAAACCCTCCCGAGAGCAATGCCTTAAAGCCCTGCAAACAGC
CTTAAGTGCGCTGGAGATAACTAATTTCAAGCATGGCTGTCTAGTGTGCCTGTCATTCCC
ATTGTCCTTCCAAACTATCTCAGACATTTTGAGCGGGGAGCACCCAGCTATGAGTTAGTA
GGGGTTGTGACACCGATGGTCCAAAGGGGTTGGAGCACCGGGAGGGGACGATGACAGCGC
TTAACAACTGGTGGCACTTTGGAGGATACGGCTGGAGCTCTGTTTATTAACAATTAGGCT
TCGCCTCGGAGGAAGATGTGACAGCTGTCGGAGGTAGGATTTGCATGCGAGACAAAGGGA
GCTGTTGCTGCTGGGTGCTCCGGGTTGTGCAGCCAGGTGGGGGCCGGGGGGGCCGGGCTG
TGGGGTGCGCTGCCGTCAGCACTGGGGTTTCTGGCAGAAACGTCTCGGGGACAAAGCGGC
TCCAGAGTCGTCCCCGCTGAGTGTGCACTCCCGTGAGCAGAATGCATAGAGGTCATGCGG
GAAACACTTCGCCCCTCACCTACCGAGCTGCTTCTCGGGTGGAGAGGGGAGGGTGCCCTA
AAATAAAAGGGGAAGGGGAAATGACAGATCTGTCAGCTGGAGGAGACTGCTGTTAACATG
GAAAATGTGTCTGGTGTGCCACTGCTGTCATTTGGAAAGGGAACAGTGAAAAAGGGATGG
ATTTTCCGGTGAGGAACTCCTTGGGTTATAACTTACTGCAAAAAAAGAAAGCACAAAACA
TAATGTGTCCATCCATTTTGCGTAATCAAAGCTTCCTCTGCACTGTTGACATTGTTTTGT
TGGATGAGAACTGTAGTTTCAGACAGGAGGAGGGAGGGCTCCCTGCTGTGCTGCTGCCAA
CTCCTGCCACCCCCCTCCATAAAACAGCGGTGCAGGGAGAGATGTGATCAGTGCTCTGCT
GAGTACCCGAAGGGCTGCAGCCAGGGCTGGGGACTGGAGAAATGCTCAGCAGTGTTACAG
GAACAGCCTCTGGACAAGGCTGGTTTCATCTCAACCAAAGTCCTGGAGGAGATATGCAAA
GTTGGGAGCCTCATGGAGTTTTTAGTGATGTGCCTGCTTGGCTTTGCTAGATCAAAAAAT
GTCCAAACCTCAGAGTCAGGTCTGCACAGCAGAACAGGGCAGTGAGGTCTGTGTGTGGCC
CTGCTTAGTGCTGGGCTGCAAGTTTATGTATTTGCATTTGTGTGTATCACCGGGATAAGT
AGCAGGAACTTAATGAACAAAAGCTTTATGTAGGTGTATATGCAGCATCAGTATTGTTTG
GGGTGTGTGATGTGAGTGTGATGTTCCCTGGGCTGATGAACTGTTTCTACTTGCGCATTA
AAGTTTCAAATTCCCAAACAACAGAGAGACTTCAGAGTGAGAGGTATTTAGCAACAATAA
AATGCTCTGCTTGCGGAAATGCTTCTCACAGGAGCTATTAAAAATGCACTTATAGGAGCT
GAGAGTCATGTCTTGCAGCAAGGGATATAGTAGCGCTCACTCTGCTAAGTATTAAAATGA
AGGCTGTGATATCATTTTAAACCTACTTCAGTGTGGGTGTCTACAGGCATACTTTACAAT
CCTGTTGTTAAATGCTCACAACTTAGAGAATTCTGGTAGATTAAGTGTTTTCATTACAGC
TTCATTAGAAAAAGGATTCCAATGTATCAGGGACTCACAGAGGAATCTGAATTTACTCAT
CCTAACAAATGTTCCCTTTAAGGAGAATTTCAGTGATTATAGCCAATTGTACATGGGTTA
TGGTGTCACTCATTTAATAATGATACACTGATGACAACTTAACAACAGAAGTGCCACATG
CCTTCAGTCACAGCAAATACAGTTTGTGCCAAAGAGAAGCAATATTGGCTTGGGAACAGC
GAGAATTCCCCCTAAGAAACACAACTTAAAAATATTCAGCATCCGAGCAACAACTTTTCA
GTCAAGCACATTGCTTTGCATTGCAGACTGGGGGAAAAATCACTTCAACCCATGCTATCT
AAACTGCTACATGGTACGAAATGATAATAGGGGAAAATTTCTCTCAAGAAAATGTTCCTA
GTAGTTTGCAATATGGATTAAAGAGATATTATGCAGAGATATTAAACCTGTGTCAGAAAC
AAGCAGAAGCAAAGCACCCATCTTCTCTTCTCCATCTCCCTTTTATCCAGAGGCTTTGGC
AATTTTACTTTTTTTACTTTCCACCCTTTGGGGCCTTGGGCAATCCCCAGCCTCACTGCG
CCATAGGCAGCAGTTCTAGACCTGTGGGACAGTGTACCAGTGAACATGTAGGCGGTGGTG
CTTAGGGAACGAGGCTGCACATAGAGTTCAAGAAAAGGGAAAACGCAAAGCAAACTTTTG
TTGCAGGAGCAGGTTCATATTTCAGGTGTTTTCGACTGTAAATAAGACATATTGCAAATC
CCATGATTCAAAACCAAATCTGCTTTCAGAACTATTCCAGACAAATTTGCCACTTACAAA
AACGTCTGCCAGTAGCAAATATCCATTTGTCTGAGAGCCTGTCAGAAGTGACTCCAAATC
TCTCCGTGCTCCCTTTGCTCCGCCAATGCACAGCAGATAATGAAGTAAGCTGCATCAGAT
TGATTCACTGTGCTGAGAAACAATTTCGCCGTTTTCTTCAAAAGCTGAACGAGTACTTTA
TGCTATGAATCTCACTTGTCCTTCTGCTTTATGAATCGCCTGTGGAGCTCATGCAATTTT
CTAATTTATTTATTTGATATTATTTGGGAATTTCATCAGTGAATAACACTTGGCTGGCAG
ATCTTTTGGGAATGGCAAATGCTTGCAAATTCATACTGTGTTGACTACCTTAGTCATGTG
GTGTTCCTCGGGTAGATGAAGTGAAGAGCAGATTTTACAACCAAGCGTACAATTTCATGT
TGGATTCCCATCACTATCTGAGCAGTCAGGTTTAAAGTTCTTGTCTTGCGAGGAGTCATA
CGAGCAACACATAAGCGCTGAAGGGCTCCCACCAGGCAGATGTGAGAGCCGGGTTAACAG
CTTTCAGATTCATATGAATATTCATGGCAAATGTTTGAATTCTTGCAGCTTCGCTAAAAG
GAACAGTCAGCATCATCCACTGTGCACAGCATGGGCCACTCTCTCGCAATGCTTGCAGAG
TGTGAACATTATGAGACAGGGTCTGGCACAGCATGAACAAGTAAATATGCCCTAACAATT
TTTAGCGATGAAGCTGGTGAGTGGAGGTCATTACCCCAAGGTTCCTGATCCCAGCAAGCA
CAGGCGAGGGCAGGACCCGGAGCTGTCCCCCCCTGCGGGTGCTGACTGCGGGGACAGGGG
TGACGTGGCTCAGTGCTGTCATGCAGGGCGCTGACGGCATGCCAGGGAGATGTGGAGGAG
CTGTGAAGCAGCAGACAGAAAGGAAACTAACTAACATCTGGTGTATGGCTGAAAAGCGGG
GAAAAGCAGTTGGGCGAAGAGTTTCTGTCAAGTGGTTTTCCTCAGATAGAAAAAAAGCAG
CTGTCAAAATACCAAGCTCTTTTGACTCAGAAAAAAATGAGGAGGAGAAAGTTATAGAAC
AGGGATGTGTTTGCCTTTTTGAACTAATTCTGCACTGTACTTATGTCAAATGGGAAACCT
CAGGTCTCTTATCAAGTGTTTGTATAGTCCAACTACTTCACTGCATGTAGAACAAGCCAG
GTGCCTGCTAAATGGACAGGACTGCTGTGCCAGCATTGAGCTGACCAGCAGTGTGACGCC
CTATTTTGTTGGCTCTTTCCACCCTTTCAGTGATTTTGAACCTCAATGATCCTACATATC
CCTGTTTATTTTAAAAGTAGAAACAAGCCTAAACAGCACACAGAAAACAAGCTACACACC
AACAGTCACCATGAGCAGTATCTGTGCATTTATGTTGTCAGGACACACACAGTGCCAGAT
TAGTGCTGCTTGAGGAGCGTAATAGAACTAGAAGAACTAGGGAAACCAAAAACAAAGCAA
ACACAGAGGATCTTTGCTATGAAAAAAAAAAAATGATTTCATGTAGTCTGGGGTGAAATT
CCAACTTAAAACTCCCTTTGCATAGTGCTAAAACTCCTGCTATATCTCTTTCCTCAAATA
CGGCTTTTGTTTTCTTAGTATAAAGTTGACCTATTGGCCACGGTTAGCCCGTATCTATGC
TTGTTCCAGGCAGAATAATTTTGCATAGACCATTTATAAAGAAGTAGTTCATTTTTAAAG
AGAAAACACAGAGAAATCCCAGCTTGTTCTGCTCTCATTGCTGGGTGCCAAGTTTGCATC
TCTGATGCTCCCACGGCAAGTTCTGCAGGGACACTCAGCAACAATCCTGGAGCTGTAACA
ACTTCTGCTAAGATCCCTGAAAGGTTAGAGGCAGCAACATGGCTGTCAGTGAACAGGAGT
TCCCCACTGTTCATTTATCATACATTTCTGTAGCTCTGCAGGAGTAACCTGTCAGCTCTG
AGACACTCAACGGTCTTTCAAAACTACTTCAGTAAACACACAAGTTCTTTAGGTAACCGT
TTGCATCAGAGCCTAGACAAAACCTCACCAAAACTTGCAGTCTTGCCTGCTGGCCCCTTG
GCACTGGCCTGCCTTCAAACTCCCCAAGGAACTGATACAAAAGCAACACAGAAGGCATCC
TTCAGGAGAAAGGGGGAAAACAGCTGGAGATGTTAGATGACCCTAAAGCCCTAAGGGGGG
TTATGACTAGATCCCTAGGTAGTGGATGCAATGGGCATGCAGCAGTTAGGACCAGCCCCA
GCTGCCCCCAGGTACCTCTCCATTTTGTCATTCAAGAACATTTAGTGTTCCTCCTGCTCT
GCATGCCACTGAGTTGCCCTACATCAATCACCACCAGAAGTATTTTGAAGACCAGAGGAG
ACAAAAGAGTATTTGTCCCATTTCCCCACTTCCCTGTCTGGATCAGAGATCGGAGTGAGA
CTGAAGTTTCTGTGTAAGCTCAACATGGTCCATCTCCCAATGTCTCTGTCCCAGCAGGAG
CCCCTGCATGGCACAGCCCTTTGTGCCTCCGAGGCCCAGTACCAGAGGAGGGCTGGGATA
ACATTGCTGCCTTAAAGAAGTATTGCAGAAAACATTCAGTATACTTGGCTGTACTTTACT
TGCAGGCAGGCTATTTTCTATCTCAGCAGAGTGGTACTCTTTCCTGACAGCCATTAGTTA
TTTGCAAATTTAGATGGGCCCTATAAACGTCAGGCTCCTGAGTGAATAAATAATATTTCA
GAGCAATAACTCGAAATAAGTCAAACTCAGAATGGTGAGAAGGCCACTAGTATGGTCCCT
CTGGGACACACTCCCTACCACTTCTAATTAATATCTGGTACTTAAAGCATCACAGTCTGT
GGTTAAATCAAAGTCAGAGGAAACAAAGGAATATAAAATCTGTTGAAGACCTGTGCCCGT
CTCCATCCATGGGAGCAGGCACAATCTTCAGAGCTGCTGCAAGACAGACTGACGCTGACC
TCAGAAGCTGTGGGTTTAGGAGCTCCAGAGACCCAGCAGTCAGGCCGCCCTTGTGTCACC
CCCTGTTCTTCTGCTGCCTCCCCCTTCCCACCCGTCTACTCCTCCTGGCAAACAAGATCA
GCTCACAAACGATCCAGGAAACTGTGCTTTGGTTTTGGGATGCCAGCTGGGACTCAGCAA
GTACCAGAGCTGGTGCAATAAAAGCAGGAGGAAAGCAGAGCCAGGAGTGAGATGTGGGGA
GCAGCAGCAGTCCTGGCACAGCACACTTTCTAGCTAAACACCCCCGAACTCCTCTGTCCT
AAGGACTCAATGAGGATGCTGCAGAAACAGGCTTCAGATAACCACATCTTGACCATAGCA
ACATATTGCAGAGCTCAACAGTTATAAAAGAACTGAAGAGCAAAAAAGCCCCAAGAATTT
GCCTGTGTTCTTTGACTGCTGAGGCCGTTCTATCTATTGATGAGCGGTTTTTGAGCTCGT
ATGTTGAATTCCAGAGCTGCTGTTGTGATGATAGAGCAGGAATCAATGGCTGTAAAAAAT
AGTCCTTGTAGAGCCACTGTAAGGATATCTGTTGTAATTTGGCCAAGTTTACTGATCCAG
GAAATGAGCGTTTCAGGTAGAGAGCCTGAGTGGAAAACATCAATGCAACTAGGCCATCTT
TCAATCCCTCCAACAAAGCACAGATACTTCAAGGAGCACTAATCCAGGCAGGGAACAAAG
AAAGTTCATTTGTAACCATAGCATTTTATTAACCAGAAGATCTTGTGGAATATGAGTGTC
CTAGCTTTTGAAAACCCATTTTAATGGAGTATTGGGACATAGCATAAACTTCTGAGAACT
TCTGTCTTCATTTACTTCCATATAAGACATTGATCTCGCTGACAACTCTGTTCTTTGAAA
GCTCTTCTGCTCTCCTAACTATGAATTGCATGAAACATGCATTTCCCCATCTTGCAAGGA
TCATCAGAGGAATTACTCTCTGGTTGTAAAGTCCAAGAAGTCCACAGGAAAATCTTTTTT
TAGTAGAGCTTAATTAAGACAATCCAACAATTTGTATGCAGCTGATATGGAGGGATTTTG
TCACAGGTAAACGAGTTTTGAAAAAAAAATGCTTTTATCTCTTCTTGCTTGCTGTTTTAG
TCATATTTTAAGTGGATTAGTATAATCTTTCCTCGGCCAAACTCCACAGCCAGTCTATTC
CTTCATTGTTCTAATTTTACAAAAAGAAAAAGACTGAAAGTAATTAATTAAAAATCTCTT
CAGAGGTCCATATGTGAGTGCACTTATTCACTAAGAACTCATAAAATAACTCCACATTTT
AAGAAAATTTATCTGGTGCATTAAGCGTGAACAGGATGTCTTTGTTAGGTGCACCCGCCT
TTAGAAGGTTCCCTAAATGAATATGCTTGTCATGCAAAGATGTCTGCAGTGACTCAGCTC
AGTTGGAGAGGATCCCCTTTCAAACTTGATTTGAGCTTCTAGGCAGGTTTCTTTTTCATT
TCTCCTGTGTGATGAAGAGGTTGATAGATTTCAAGCAAGGAGTCTTTCCCTGCTGGGACC
AGGCTGTCAAAAGCCATCACAGAACTTGCAAGATTCTGTTGTAACTCCACAGGTCATAAT
TCACCTCCAGTATTAACAGAGTTGAAAGAAAACTCCCAGTAATTGACAACAGGAGCTTTT
TTAGCAGTGTTACTCTGCCAGGCTGCAACATCATCATCTGCACAAACATGAACACTCACA
TGGGGAACAGTACTACCATACGCAGTGAAGTCCACTGACCCGAGCGAGTTTGAATAAGTA
AACATCAGTTTGTTCATCAGTTTGCACCCTGCAGTAGTGTATTCAGAAACTCTTAAGGTC
AATCAAAAAAGACTTATTCACATTTTATAAAATTTCTTTGTGTCTTATGATAAAAACTAA
ATTTCTTGAATTTAGGGTGAGGGAGAAGGTCTGGCAATTGGTATGCTTGATCTCAAAGCT
GTTCCCTTCCTTAATAGAAATCCAGCATATCCATGCTGAGTGCTGTGCCTTCCTTTCTTT
TGTGAATATTCGTTTCTGGAATCAATGCAGTAGACGTGGTTTAGTGAGCATGGTAATGAT
GGATCAACAGTTGGACAAGATGATCTTAGTGGTCTTCTCCAACCTTAATTATTCTATGAT
TCTGTCCTGCAAAGTACACTTTTCAGGAAGCTTAAATATGCCTGTAGAGGCTCATAGAAG
TGCTTAGCCTATTATTTGAGCAGCAAATCTCGAACAACAAATGGATTTCTGTACCATCTT
CCTCAGTGATTTCATCAATATCCTCTTCAGTCTTCATTAAACTGTTTGCTGTTTGCCTAC
TCTTTCTACTCTCTTCTGCTTACATGTATTTAAAAAGCCTCCCATATCATAGCCTGCTGA
TCACTAGCCAGATATCCAGATGGTACTTACGTACCACGTTGAAAGGTGCCCTAGAAATAG
CAGGAAGAGGGGAAAAAATATCATTGGAAGACTTCAGATGCTCTTTTAGATAAATAGCAA
TGGTAGAGCTAATTAAATGTTTCTTTCTTTAGAGAAGCTGTGGAAGTAGCACCAGTTCAG
TTCCATGTGAGAATGCACCTCTTGCTGTTAGATTTTAGCTTCCCCCAGATAGTTCATATG
TCTGCCCAACTTATTTGGAAGAAACCAGGCTTTTAACTGGGTTTGAAGGTTTCTGTCAGC
ACCCATCACTGTTCTACCTTAACACCACTCTTCTGTCAGCTAGTTCTGTGCAGACAAGTT
GTTTCTGTAAGAAGGATCAAACGTTGCTCACCTTAATTGTGTGAGAGTCCCTCTGGCAAT
AATCAGGCTAATTGCCTCAGTGAAGCCAGCTGGATTTGGCTTAAAATCAACCACCAAAAT
TATTAAAGCACAAGTGCACATGGTTCCTTTACAACCCCAAGACCCGCTCATTGAACACTA
TTTACATCTCACTCAAAAATACTCCTTTTATTCTCTCCTTTTTGCCAAGGAGAAAGATAG
AAAGTGTTTGGCGTTCGGGAACAGCCCAAATGAAAATTAAACTTCTCTAAGCAGTCCCAG
TTCACTGCCTCCACTTGTGCACAAATCTCCACATATCTCTAATCATTTTCACTGTCAGTC
TCTGCACTCTTTTTACATCTATTAGAGAATTTATGAGACAGAATGACGAGAAATGAAAAA
GGATTCTGAGGGGAGAGCACGCAATTGATTTATGTTAATAGCATTATAATAATATTTTCA
GTGGTTTATTTCTTTTTCATCTTGTACACAGCTAAATTGTTGATTACTTTTCTATTCCTC
TCCTGCTTATCAAACAGTCGCTTCCACTTGGGCTCCACGAATTCATTCTCAGGTCTGTCT
CCAAAGTGGTTAAAACATAATTAATTTTAAATCCCCCAACACATGAGAAGTTGAGATAAC
TCTTTCCAATCAATCTTACTAGCATTCATCAATGAGTTTCACCAACTGTCATGCTGCTCA
TACATTTCTCTATGCGAAGCTCCTCTGCCTTCAGTAGCTTTGGCATATTTAACAACTGTT
AATGCTAAAAAAATCACCAACCCTGTAATTTCTATTGGGCTATACCAGAAGCCTTAGAAG
TCCCCCAGATGTGCATGAATAAATATCATAGTCACCTGTGACAGCATCCTTAATGATTTT
TGCGTTTCTTCGCACTGATAACTTTCATCTCTTGTGCATATGTCAGAAATATAAAAAGGC
TAAGATGCACTGGGAGTTTATAAAGGCAATCAGAGAATAAATGTTATTGCAGAATCTTGC
CTTCATAACACATTCTGCTTTGAGAACTGTATTAGGTGTCAAACTGCTTTACCCTGGAGG
GATCAGAATATGGAAGTGTCCTTCAGAGATGTCAGCAAAAGATCCTGATGGAGGGCTGAT
GATGGCACTTGATAACCCAAAAGAAGGGATTATTCGGCACAGCGCCAGGGATAACCAGAA
ACCTATTCTATTCCTGTTTGACAACTAAAGATGAACAAACAGGTTTGGACAAAAAAAATC
AGCCTGATTCTTCTCTTAAAGTTGAGAAAATCAAATGCGAACACTTCATCAGAGGTCTGA
CAAAGCCACTTGCCCTTCTTCTATTCATTACAGCGTGACTGTACACTGCCTTATGCCGGC
TAGTCAGAGACAGAAATACAGTATCACAAATTTGGGATCTGCCAAAAGCTGAAAACACCA
GCAATAACAACACTTTGTCTTCAAAGAGTCCTGTCAAAATTAAAGAATGGATTTTCAAAA
CCCCTTGGCATGAAGAGCTCCTCCAGACTCCCATAGAAAATGGACAACAAGGCCATTTGT
CTTCAATTTTCAGTGTGCCCCTATGAAACAACTCACAGCCATCACATCTTTCCCACAAGT
TAGAAACAGTTTGTAACAGCACAGCATCACCTAACGCTGAAGGTCTCTTTTTTTTTTTTT
TTTCTTGTGATGAAACACAATTGTTACTGCTTTAAGCTGAGGCACAGGAGTGAGTCCCTG
GTACAGGATCTGGATGAGTACCCATGTGTTTGGTTTGTAAGACAGCACACAGAACGTACG
GCAATTGTTGTGCACCTTCATGCATGATGCAAAACACAAAGTAGTTATCAGACTAATTAT
ACCTAATTGGCATATTTATTATTAATGTGTCTGATGTGATGGCTGCTGAAAGCCTCAGGT
TGTGCCAGGTGGTAGACAAACACATGGCCATAAAGATAAATTAAATGTGTTAGAGGAGGC
ACACAAATGCAATGCTTGTATAAGGCATTGTATACCATTGGGATTCCCCACAGTGGGAGG
AAACAGCCCACTGCTGCCTCCCATGTGAGCACACAGGTTGCTTTGGAGGCAGGTCCTGGG
GAGCACCAAGGGGAACCTGCTGGGAAATGAACCCTGCAGGGCTGAGCCTGTGAGCATTTC
AGCAGTGCTGACATCCCTGATGCAGCCAGAGCCATCGCACCCAGCACTTTGTGCCCTCGG
CCCCAGCCTCTCTCTGCCCTTTTTCCTACTCCCCGAAGCAAGATCGCAAGTCCTAGTAGT
TGGACGGCTCTGGGTATAGCTTGTAAAGAAGAAATGAAAACCCAAGTGGATGCACATTTG
CTATGTACATTTTGCACCTGGATGTTAGTTTCTTTGCAGTGTCTCAGAGGGGCACAATGT
GGAGCAGGGCAGTAATTAGCTGTCTGAGTTTGACATGCCATTGGCATCATTCTGCTGGCT
GCTCTGTGCTCCCCAAACGCGCAATACCGACTGTGCAGAACCAGCAGTATGCCACATGTG
AATCCACACAGGCTCTGAACAAAATATAGTATGCAGGTACCAAAGCAACAACCTCTGACC
ACTTCTCATGGGCCCTTGCTCTAGCAGGCTGTTGGTCATCCTGTAGCTGTCAGTCATGCA
GCACTACCTATAGCCCAGGAGAGTGCCGAGCACGGAGCCTGCTTTACCTTTCTCAGGAAG
GATGAGGAAGGATCCCAGCTTTCCTTTCCTGAAGACCCTCATTCATATTTCTGAACAGTT
TAGTGTGGGCAGCAGAGAGTGATGAAAGATTGGGATAGCGGCAGCTGCAAATGAAGTGCC
ACAATGTGAGTACAGAAGGTTCATTTTGCAGCACTCTGAGGCTGCACAACAGCCGAGATC
CTGGGCAAGTGGGAGCAGAGCAGTCCTGGGCTGGGGAAGAGGAAGGTGGAGGGGCAGACA
GAGACCGCACACTCTCCTCACTCTTTCTGTAAGGCCATTGTTCGGAGGGGAAGGGCTGTA
TTTGCAGCATCTCTGGAACTGGGCCATCCGCTCTTCTCTCAGAGAGCTTGTAGCCAGCCA
TTAAATTGCACTGTATTATATCATAAATCCAGAAAAATGACATTTTCATTCATGAGGATT
CATAGTAACGACAAAAACAAGCCTCCCCCCTTTAAAGCAGTATCCGCCATTCAGATTCTC
AGATACAAATTTCCCAGGACGGCATTTTTTCCATTCCCTCTCACATATCATACCACGTGT
GATATTTCTGGCTTTCACCTGAACGTAACTAGGAAACATTGCTTATCCAAAGAGAGTTCC
TTTGCCCCCCTAACTCATCTTTTTCATCTATAGTATTTTATACTGAGACATGAAAAAACA
GTAACAAGTTATATATGGCAGCATCTCCCAGCTCCAGAGATTTCAGACGTGTCTTGCACC
GTGCTATCTTTCTTTGCTAAATCTAGATGAATAGGACAAAACATATGTTGCAGAGACATC
ACTTTATCATAAATTAAACCTGATTTCTTCATTCAGATTCTGGTAATATTGTGGAATTAC
TTCACCTTCTGCTATCTCCTGACTGCCTTTACTATCCATCCACACAATTTAAAAATCGAA
TAAGCAGGCTGTTATGTGTGAAAAGTAGCTTTTACCGCAAGAAAATGAAACATAAAAACA
AATGCTGAAACCAATAAACTTCAGAAAATGCAGAGCTGCAGCTGTCATCCTTATCGTCGG
GAGTGGCAGCATCACAGCTGAAAATCAAAATCCTCAAATTCAATCAAGGTTCCATGATTG
CACGGTGCCGGCACTTACTGTACAAGCCCACAGCAAGAGCAGATTCCTACCCAGCCAAGG
GCTGGTGTTTGGAAAAGGCAGGGGAAATGCTGTTTTCTTATTTTAAAGCAGATGAGCAAA
GCTTCCGAAAAATTATGTGCATTGTCCAAAAACATGGAGGAAGGCTAAATCAAAGTCAGC
GGTTTCCCAGGTCCCAGCACATTGGTTAAACCCTATTCAATATTTTCTACTCCCATATTT
TTTTAAGGGTACTGTTATTTTTGCCTTATCCCCTCAGGTAAGAGCTGCCACCTCTGCCTG
GGGACAACCTGGTCAGAAACCAAGCAACCTTTCACTGATAAACGCAGGATCATCTATACC
AAGGATGGTCTTATCATGACAGAGACTGAGCCCTGAAGCACAGATTCTTATTGCTGCTCC
AAAATCTCATTTATTAACATTAAATGCCATTACTCAAAGTTCTCACATTACCCACGCAAA
TGTCCACGCAGGAGCTGCGCTCCCACTCTGAGATGGCCACTTGCCTATTTAATTAGCACA
GTCCTTTGGGACTGGTCTTAGGGGATCGCACAAGCCAATAGGCCCGGCTGTTAACGAGAG
CATGCAAGTTACAGAGGAGGAGGGGAGCACGGAGTGCCTTTGACAGGCTTCAGTGTTTAC
AAGGGAGGTTTCCAGAGGAAGGTAAATAGCACTGAAACGCTGCCAGGATTGTTTCCCTGT
GTTTCAGAACAGTTTTCCTTTCACTGTTGCTGTGCCAAGTTTCAAATCTGCCTTGTGCCA
AACTTCATATGTAGAAACAAATATGCAGAAAATTCACTTCAAAGTTGGACTTAGGCTACC
AAGAGCAAACACCAAAAGAGAAATGAGCGTGTCCAAGCATTTGTGCTGCGGCTGCTGCTT
CTATGATCGCTTAAACAGGGAAGAGAATCAATAAAGCCAGATTTACTTTTATCCTCTCAC
AGCTAAACTCTCTGTTTTGTATAAATAGATACCTAACATACCTACAATTCAAGCCCCAAA
AGCAAAGACTAGCATTCATGGTAGGAGGAAAGGAAAACTTCATTGTGCTCCTACAGAAAC
AAAGCCCCTTCTCAAGGCTCGTTTTCCAACTGCCAGGAACTCACGTAGTGCTCAAGGTGG
GATCAGCAGCTTCAGGCAGCCGAAGGAGATACAGGAAAAGAAGTCTATGGGGAAATAACA
TTATTTTCAAATACAAGTGTAAAGTAGTTATCAGACCTGCAGGATCTGAAATAGCCTCAT
TATGCGAGAACAGAGGCAGGATACTGCTCTCTCAGGGCTGTCCCATCCAAGGGAAGGCAA
GCTTGGCTTCCAGCCACATTGCCCAGATTTCAGACAGCACAACTCTTCCCAAACCTCCTC
CTTTACAGCCCCAACACAAGACTAAGCTGTGTGCCATTCACACAATCAGAGCTCATTTGG
AGGCAGCCCAGTTTTCCAGATTTGCACAGCATTCACGGACATCGAGCCTTTTTATAAACA
GGTAATGAGCTTGGGTCAGCTGGGGGTAAGCCAGGATCCTTCCTCCTGCTCAGCACAGCT
CCCATTGCTACAAACTCATGCAGAGCCTGAAAGCAGCCTGGACAGGAGGGACACACACAA
GAGCCCAGAGCTGTTTTTTCTTACTTTACAAAGCAAACCACTAAATCAGTATTTTCACAA
AATTTTAAAGAACAACAGGGAAGGAAAATAATGATTTTTAATAACCTTTTTAAAAAATAT
ATATATTCTTTTTAATGTAGCTAGGGGTCCATTTTTTTCTAGGAGCAGTGAGGCAGGGTT
GGGCAGCACTTGAGGAGCCGGGGCCATTGGAGCCCTCCTCCCCTTTGGCCATGAAGCATC
TCATACTCGGATAGAGCACAAGGTTGAACACAGCACAAAGTGAGCACTTCCTGCCAAAGC
CATTGACGCTTCCTCACCCATGTGGAGGTCAATATGAGGCAGTTATGCCAGCAGGCTGTG
CTGCAAGGGTATTTTCCCATAAAAATAACTGCAAATACAGAATAGCTGAAAAATAGAGAA
ATGACAGCATGAAAGTGTCAGCTCAGAAGTCAATGGAAAAAAATGTAAATCACCATTCAT
TTGTAATGATGTGACTAGTCTCACTAAGAGGGACATTTAAAGTGAAACTACCTGGACAAG
GGCACAGAAAGGTCAGTGAATCCTTTCACTTGGAGCACTTCGTTATTCCTTAGGATGGGG
ACTGTTCCCTCGTTCCATGCAAGTCTGTATTAAGGGGGTCCCAGTCTTCAGCACAATTAA
GAGTCATTGAGCTTTCTTTTTCACAGTAGTTTTGATCTCATCTTGCTGGGAGAAATGCAG
TTGCTAACCCCACTTCTTCACAGTAATAATTTTTCCATTGGCTTTACAGAAGCTATCACT
TAATTTAGTGGCTTGCTCTTGGCACGATTTAAAAACATCATCTCAGTAATGTTGTTATCT
TCCTGCAATATTTCACAGATATTGTGAAACCAGTTTATACTGATATCGAACTTAGCATCT
GGATGACAGGACAATTGCAGGGAAATATTGCCAGAGATATAAGGCCATTATAAGATAAAT
AACGAGCTTTAACATTTAACGGGGTGTTTTCTTTAGAAGAGATCATAGTGATGTTCCTGT
CCACAAAAACCAGCACTTTCCATACAAAGGCAGAGGTAAAAGCATTCCTTCACGCAGGAT
ATAAATCCTAGTGAGTAGGTGAGCAACAGCTTTGCTCTGGGCTGAAGTTTTCCACAGGCT
TCTTGAATTATCCAATTTGCCCAAAGTGAGTGACTGGTGCTGGGAGTGTAGGATAGCTAA
TAAGGCATACTGGAGTCATTAAGGTTTATCATGTAAATCTCTATTTGAGTGCTTTTAAAA
TGCATATTACTTTCTTGATAAACTATGATGGCTCCTAAGGAGCTGTTAATATGAATTAGG
GCGTGTACTGTACATAGTTGAAAGCCTTATGAGGAGTAGTTATTCCACATGCAGGGTAAT
CAGCTTTTAAATTATATTAAATACTGCAGCTGTAACGTTCCCCTTGCCTCTCCCTGGGAG
CAGATTGCCTTTATAAAATATATATTTTTTTTTTTGCTAAATTTCATTTCCTCAGATAGC
AGCCTACCATTGAGTTGTGCAACCATGAGGTGACTGACAGAGGGCAAGGAGGGGAGGACG
AACACATTTCATCTCTGCCAGTTAAATATCCCCAGATGCTGTTGGGTAATATTTTTCCTA
GTGTCAAAAATGTGTTACTTTTGATCAGAAATTTCCTATGTATATGTGGAGGAGTGAGAG
ATCACCCAAGGCAAAAGGAGGTGAAACTGGGGAACCTGGAAATGAGATGGTCACTGGGAG
AATGGCAAGAGAGATCATCCTGGATCTTGTAATTACTGTGAGCAACGCACCATCTCCACA
AACCAGTTCTCACAGTGCCTACTGAGGCAAATAGACTGAACAAAAACCGCCTTAATACAG
GAAGGAGACCCAAGGACCCACCCTGCTTTGTTTTTCAGTTGAAAGGATCCCCAAGACCCT
CCTCTGCAAGGCATCTCTGCAGCTCTCTTCCCATACCCATGTGCCCTAATGCCCAAGAAT
ACGTCTGGGATGAAAGCAGCTCTTAGGCAGTGATGGGAGGGGACCATGGAGGATAGGATA
GCTGCAGGCACTCTAGGAGCAGGAGAGCTGTAAACTGCTGTAGCACTTGGTCAGCTAAAT
TAACTTAACCAGGGAGAAAAACCTCTCTGTGTCTAGAAAATGCTACTTTCTGATCATCAG
TTACAGTTTTTACTAGCTCTGGTAGCATCACAATGTGATACCAATTATACATTTGAAGAT
GACCTGCTGGCAAGAAGCTGTTGGCTTTCTGCACCTCTTTTTTGCTCATTAGAAGATTGT
AACAGGCAGCAAAGAGGGTTTCTTTATGAGTGATACCTGCAGCTTTCCAACAGCAGAATT
CTTTATTCATTGGTTATGTCTTCCTGCTGATAGCTCTGGCATTGAGCACACACAGTATAT
ACATACACATCTTCTAGACAAAGGAAGGACTAGGAGATCTCCCCATATTAGTTTTTTCTT
ATAATCAATGTACTTGCTTTAAGGACCAACTTCTACCTTGCCACTCTCTTGGCACAGAAG
TTGTCATAGTGAAAACAAAGTTTTCCTCACTTCTCTTTCTCTCGGATTGAAATTTCTGAG
GCAGCAAGGCTGGCAAACTAAGGCTCCTATAGATGTCAGCCTGAGCCATCCCTGTGTTCA
TGAGGAACCTGGGACAGGACAGACAGATGCAGTGTCAGATGGGCTCTGCTCTCCTCGCAG
GTGCAGGGATGGCTTAGGATGTGCTCCAGGCAGCAGGGCACCAAGCAGGGCAGCTGTCAG
GATGATGTTGCACTGCTGCTGTATGAGGCTCAGTGAGAAGTGCTGGGATCCTCACCGTTC
CTTACACAGTCAGGAGTAGTGTTATGGGGGATTGTAGGTATAGAGAAGGCAATAATTCAT
ATGCTGTCAGATGAAAATATATTGGGTATTCACTCCTGTAGGTGATGAGACATTATCAGA
GTTCATCCCTTTCTGCACAGTTTTCTCTCTACACAATTACACATGAAGGCCTTTGGTAGC
CAGGACGTGTTGACATTTCTTTTTTCAAATGGAGCAAGCATCTGAGCTGTTTTCTATTAG
CCTAGGCCTGGGAGGAGGTTTTGGCATGGGATGCTCCTGTTGCTGCCATATCCAATGCCT
CTAGCCATTGGCTTCATGCCCGGGCTCAACGCGAAGCAGTCTGTGTGAGACAGACAGTTG
TAGGCAAACAGATCGGGGTGCCGCAAAATTAACGCCTTGGTGTCGAGCAGTGCGTGAGAG
CTAAAATTACTCTGTGTGCCTGCAGCCAAATTGGGAGCTCACATTAGAAGGCTTTTCCTG
CTGTTCCTCACGCCAGCTCCAGGCCATCTCATCCCCAAATAAAGCCAGCAGCACTCAGCC
AAGCACTGGGGCGCTCTCAGTGTTGGGTTGTGGGGCCGTCTGAAATGAAGGTAGCAGACG
GCAGCACAGCCCTGAGGCTGCTGGTGAGTGCAGGAGTACTGACAGTCACTTCTCCAGCAT
TTTCCCACCTCATCTTCTAAATGTCTTCAGGCAGATCAGCAAGAGACTGTGAAAATATTT
GAGTCCAAGAGCAGTAGGATAGCTGGAGAGAGCAATGGAGGGAAGATTGCCTTGCAAAAC
ATAGGACACTAATCATTTAATATATGCATCTCTGCTAGAGACTGTCACTACTGTGTGTAA
TGGGCTGTGCTCTCCTGAGAGCCTTTTCTTTAAAGTATTTACAACAGGAGTGTAACTGTC
GAGGGACAGAGAGAGGCACATCCGTCTTTATCGCACCGTGACTGCTCAACAACCACCACA
GAGCGCTAAGGGGGCTGAACGCATGGCACAACCCATGTAGGCAATGGGCAGACATTAAGC
TTCATGCAGAAAAAGGTGCACACGACAAAACGTGGTGGGGAAGCACCGTGTTTTCTTTCT
CTGCAGCACTGCTGTGCCTTTCATTTAAAATAATTGACAGTTGGAGTTAAAATTACAAGC
AGGAAGGGCGTAGGAAAAGTTGATAATAGCCATGAGCTCAATCTATAGGGATTGATCGTG
CCAGTGATTGAGCTGTCTTCCATGAAACAGATAATGACAATGCCAAGCTTTACATTTACC
CTTCCAGTACCAGGAGTTTTCACCCAAGCTCCCTCCCAACCCTCTCTAGAACTGTCAGAA
AATCTGTCCATAGCACTAAAGACTTAATTTCCTTGATTACCAAAGCAATCCAACATGCTA
ATCAAGCAGACACAGAAATCTCTTGAGCAGGCAGTCACGGTGACCAGAGTCCCAGGAGGA
TTTTTGATGAGCCCATGAAACCAGGGAAGTTTTTCTCTCAGTCTCAGAGCTCCCAGAAAC
ACCCTCAGCGCACTAAGAAATTCTCCTGACAGTCTCGTGGGATCTGCTCACCACGACAGT
GCCCAGCAGCCCGCATCGATTTTGCTTTACTTCCAGAAGCACACACAGCAATGCAGGCTG
CTGGAGCTGTCTCTGAAAGGTTCTCTTTCAAGAGGACAAAATATATAGATACTGTACAAC
TCTCTGCCTCCAATCCTGCTCTCCTATCCCTAAGAAAAGTCTGATGTGATGAATCCACCT
GAAGAGTTTCAACCTAACTCGTTACCAATAAACTAACTAAGGTCTTTTTCTCTCAAACCA
AACATCAGCTGTTAAGCAATTATCAGTTATTTTGAACTACACCCCAAAATAAATCTCACA
CAGCCTGTTAAATTTTCCCTGAGGTTTCAAAGAACCTTGTTTAAAGCTGGAGCTCATCAG
AGTTGCATGTAGCCAGCCCGGATCAAGGTGCAACCCAACAGCAGTGACATCGGGGAGCCA
CACATGGTGGCACCTGGCTTAACCATGGCCATGCATGCTCCATTTGGGACCAGAGCTCAG
ACTGCTACCTACACTAAAAGCTACTTCTGCAACCATATATATCCCCTAGTACCAAGCAAC
ATGAACTGCAGCATTATGAAGCAAGGCAGGTTGAAGGTAGCACTGAATTTGAGCCAAGAA
TATGCTTCTTTTGCCTCCAAAACTGGAGTATAATCCCACTCTTTTATAATAGTCAGTACA
GGGAACTGTGGAAATCAGATTGCAGGGGGATGAGAAATTAATAAAAGTCCATGGCAAATT
AAGACCAAGCATCACTGTGAGAAAACCACCACCAGGATTAGCACTGGGGAGCTCCAGTCT
GACAATTGCAGGCAAAGTCTAAGCGAACCCTGGTGAGCGAGGCAGTCAGCAAGGAAGAGG
AAATTATTTCAGCTATATTTCTATTTTTAACATTTGTGTTTAAAACTAAATGCAATGAAG
ATCATCATGGCTCTTGCACTGAACTTCAGAGGTAATCCATGAGTTTCACACCTGTGTGGA
TCTACAAAAGGAGGATACATCTCCCGAGTGGAGTGAGGGTACTCCTTGGAAAGCCCTCTC
CTAGCTCTTTGGGTACAAGTCAGCCACAGGTTGTAATGTGCAAATGTAGATTAGGGAACC
TAGATTCTTTCTGCTGATGTTTAGGTCAGATTTTAGAGATTCACATCAGAAGTTATCACC
TACATGAAAATCCTTCCCCAGTTATTTTAGCCATCTTACATCAACCAAGTTAAGCAAATA
ATGCTACCATGCTACCATGAGAGAGGATTCACTCAGTGCAGCTCTCTACTAGCATGTCAT
TAGCAATAATGAATAATTAATAACATAGTTGTCTCAATGCCCCAGTCTCTTTGTCACCTT
CACAGAAAATAATTGAAATGATAGATTACAAATAAGATAAGTTGCCAGGCAGGTGGATGT
ACATAAACCAACAAAAATGCAAGTACAGAGAACGTACATGTGATGCAGAAGCCAAAAATC
TCTTGTGCTTTGCACTGCAGACCCCACACCTCCTGATATTGCACCATGCTCTGAAAGCCT
AGGGATGTGAGGAATCCGAAGAGCAAAGGCAAACGCCAGTCCTAGAAAGTGATATTTGAC
AGCCCTACCTTCATGAGAGCATCCTAACACTGCGAAGGCTGAGAGCTAGGAAGGAAAAAT
AAAGGTTTGAAGGCTACAGAGATGCCTGAGTCCACAAGTACAACCATCTTGATATTCCTA
AGAATGTCCAGCTTCATGTTTGAGTAAAATCATCCATGTATCTGCTAATAGCTGGAATTA
CCTGGCCAGGCTCATGGCCAAAGATATCAGTTCAAAGCCTTCCTAAGAACAGCCTGAATG
GAGAATTAAAGTGATTAGACACCTCTCACTTCTCTACACAAGCACAGTTTCCCAGCACTT
TTCATGCCCACCTGAATAACACAACCTTCTCCCAAAACACAAACAAGCAGAAAGTGTCAT
TTCTGAGTGACCTGGTGGAGTTGCATGGAAAGCTTTCCAGCTACCATTTGAGAAACTGCA
GGCATTACATTTAAGTAAAGAATCCAGCAGCCTGAATATTTATGAACAAACTCAGAATGA
CTCTGGAGTTATTTAGACTTGGTGAGCAAAGTGACTGTTTGCAATCTGGAACATCTCCAT
CCTTTCCATGCAGATGCTTTAAGAAACCATTTCCCAGATCTCTTGATGGTGCAATAAAAG
TGTCCCTAGAGGCTAAGAGCAAATGCTCAATTCTTCCAGCTGCTTATGAGCAGTGTGAAG
CCAACAACTCCCCAGTACAACCTAATGGTCACACAGGTCTATCTTCCCAACCTACAGCAT
TACAAGCCATGAAGAACTGGGGCAACAAGTGACTACATCCCCTTGCCCTGCTGGCACATT
CCTGCTGCTTCCTTTGGTTCAGCACTGCATTGGTTTGACTTCTTACCCTTTTCATCTTTG
GAAAATTAGTAGAAGATTGACAATGATGGGAAGAACAAAAAGAAAAAAACAAAGAATCCG
AGTGCTTTCATCTCAACAGTCTGCTCACATGGGGGAGCCAATTAATTCCTCTGAAGCTAT
CCTGATGTTGAGACTGAGCATCTTCATATAGACTTTCCACACTCCTTAAGGGAAGAGGAG
CAGTAGGACACTGTTGTAACTTAAAGGCTGGGAAACACCAAGAAGCACTGCACATCTGAG
CTAAAAATGAGCTCCTTCGGTAACAATCAGAGCAGACCTATTCTTCGCAGATCTGGAGAT
TAGGAAACAACAGGTCTATGCTGAAAGTCCAGTTTGGCTCCTAGGGCATTTATCTATTTT
CTACTCATGGCATTCATTAGCATTGGCACGGAGCTGATCCTTGTACCTAATTTTCCATTA
ATGGGTCAAACAGAAGCAATTTTTAACAAATCTGTTGAAGCATCTGAACAGATGAAAGAA
AAATCACATCAGGGCTTGAATCAGTCCTGTCAGAGGCATGCTGGAGCTGGCACCTGCGTA
CGCATATCCTGCTGTCACATCACATTATACAGCTCTGTTTGGCAATGATACAGTTTCTAT
TCATCTTCAGCAAAAGCATCTCCTTCTAACTTCAGCTCACTGCTGCACCTGAAAACTAAC
CCCATAACCCTATGAACAATTCAGCTTGCCACCCACATGGTGGTACTGGTGGAACAAAAG
CCACACATCTGGGAGTAGAGGATGGGACAGCTTCAGCAAGTTCCCACAGTTAGCTCAGCT
TCAGTCAGTCGTGAAATTTCACCTCTGTTTTCATTGCTTACTCCACTCCCTTCCCCATTA
CATTTGTAATTGCCAGAGAGAAGCTCATCATTAGGTTTCTCCATTGTTTCCAACTCATCC
CTGGGGCTCCAGGCAGTGAAGGGGAACGCGTGGAAGTCCCCGTGCATTAACACCGGGTTT
GTCAACAGCAGTGCTGCCCCAGCTCCTAAATCAATGATGCTCCTACAGAGTGGAGGAAGC
TGTAAGCCTTGCGTGAGCACCTTTAAACCTGCACAGGCTATTCAGGACCTAATTTTTACA
TGTTCCCATGAAAACAACAACTGCCTTTTAGAGGCATTACGGAGTCAGTAAGAAATTTAC
ATTAGTCTCTCATCATCATCTTCCCGCGTCTGATATTCAATCTCCCCTTTCCCACAGCTG
AGGGTGTCAGCCCTTCCTCTTGGTGACAGCACACCTAACAGTTACAGCTGAAAGTGGCAG
GGAAAATCTTGAATGAAAAACAGCAAGTTTTGGATATCAGACTCTCCCTTCCACCAGTGA
AGTCCAGCATACTGGAAACAACTAAGTTATGGGGCACTGCTGGTTCCCCAAATGCAATTA
TAAAGCATAGGTCATCTGTAAGCGTCCAGTGAATAAAACCAACTCCAACGCTGGTGAGCA
TCATAAAACTGTGGGAAACCATCCTCTGTGTTTTCCCAGGTATTTTCCACTGTTCAAGAC
CACCTACAGGCACTCTTGTCACCGGAGGCTTGGTGAGGATTTAGGCACAAAGCTTAGTTT
TGCTGACCTTCCAGCTAGGGCTGCAATATGGCACATACTGTTAAGTTTAAAAGTTCTCCT
CCATACTTGAATGTTATTATTTTAAAATCAATGATTTATTGTCCACCTACATGGACAACT
GTGGTCAGCATGCATGATAGGCCTGGAAGCGCACAATTACTATTTAACTCAGCTGATTTC
AAGGAGATCTTTCATTTTGTTTTGTTTTCCAGAAAAAAATGGCAAAGGGTTATTTCTGTT
GGAAAGAGACAGCTCAGTAATATCAAAAGTGAAATGTCCTAAATCAAAGTCTCAGAACGT
ATTATTTCACGCACTAGCTACTGAGTGATGAATTAATAATAGAATCTCAAATACATCTTC
CATCAATATGCTTCTTCAGATACCATCAGCATTTAATTAGCATAAATTATATGACATGAG
GAAGATTCAAATGGTCACCAAAAGCAGTGTATCTTATATGATACTGAAATATTGCAATTT
TTGCAAGGCAGTAATTTTTCTTCTTCCTAGAAATTAGTCACAAATCAGGTATTTTCACAG
TACATTTAGAACTGCACATCTCTCCTAAGTTGCTGAGGATGTGAGATTGGGTCTTTGGCT
TTGTTTCAGGTCTTCTTCTAAATTTTATGCCAAGCAATAGCATTCATATAAAGAAAATAG
TGGCAGTATATAGCTGCAGAGGGACTTTCAGCAGTTCCCATAACCTTTACAGCAGCAGGG
CATCAGAAAACCACACAAGCTGTTTCTCATTTAACTATCTTAATAGGTCAAGAAAAAATA
GTTATGACTGCTCTAGGAAGCACGGACATTTGCTTTTGTCTCATAACAATACAAAAGGTT
GTACTGCTCTGTCTACAAAAGGTTGCAAAGAAGTCAGACTGAATCCAGGAATGAGGAAGT
TTAAGTATGCAATTGAAATGTCAGCCAAATGACCAGAATGATGAAGAGCAAAAGAACAGC
TGTAGTCCCCCAGTGGGCTGAATAGCATCCAAGTGCTCAGTTGCAAAAGGAAGGGAACAA
GTGCAGAAGGTAAGAGGGAAAGGCAAGGACATGCAGGCTACAAATGGAGAAATAAGGATA
TTCTGTGTGCCTTTCTTAAGATAGAAGAAGGAGATGCCTTCTAAGCCTTAGCTTAGAACA
AATAACTTAAAAGCTGGCTGAGTTAAACCAACAACAAAAAATCTTTAAGTATTACATGAA
AGGCATATTTTGCTATTATTTTTTATGTCTCATGCTCTTATTTGAAGTGTATTCTTTTGT
CTTTAAATTTGTTCAGTGAAAAATTTGATTCTGAAGTGACTTGGCAAGCCAAGATATTTT
ATCCCTCTAGGAGTGCTTACTCTGTAGATTAGGACAAGTGTTTGTGAAGAAGTGTCCAGC
TCCCCAGTCTGCTCCATAAAGAAAGGGAGTGGAGCATACTGGCACCAATGCTACTGGGGA
GGTGGCAGAGGCACACATAGGTCTGAAGAAATTTCTTCCAGAGGCAGTTAGTAACTACAA
AAGCTTTCTCATATCCGGTAGAGAGCAGATCCTTGCTCCAAAACCTTTGGTGAGTTCATA
GCAGGGCGCTGACTCTCCTTCACATCACATGAAGGGGAAAGCATAGCAATATAAATAAAC
AGAGCTAATATACTCCAAGTAGTGGGGAGAAGATGAGCCTTGCATTCAAGCACATTGTTC
TAGTCCATATAATCCACTCCAAATTAGTTAATATAATGCTCACTATCCAATCACTCTACT
ATTGTTACGAGTTGCCATATAGCACTAAGCACCACGCAATCCTGCTGCAAGCAGCTGTTC
ATTCTCCAAAGAGTTCACAAGAGACCAAATAAGCAAAGGAAAAACAATAATAGCACAAAG
TGTCCAATGTCGCAGAGCAGTTTGGTAACAGTGCAGGAATAGAGCCCATGTACTTCTTGC
CCTTGCAAATGTCTCTGAAACATACCTTTGGACGTTTGGCTTCCTTGGATTTAAGATGCA
TGCTTTCAGATGATAGGCTTATGCTAAATCTTCAGTATTAATGACTGAAGTTTACACAGG
TATTACACAGGTCTATGAAGGACAGCAAATAAATCAGAAAGCATGTAACATTGCCTGAAA
TACTGTAGTTTGTTCTTAACCAACAAATAATTTGTGTCACCATAGAAGGATCAAGAATTC
ACCCACTAAAAGAGATATTGCCCATTTTCAAAGCACGCCTCATTCATGCATATAGTCAAA
ATAATTGTATCTGTGAAGTCCATCTCAATTTGGAGCACAAGTCTTGTTTGGGTTTTTCCA
TTAAAGCAAATTGCTTGCGGCTGCCTAACTGGGGAATCAATATATTCTTATCTGCATTCA
CTTCCATCTCATCCTTCTTCATACCCAGAATTGGACAGCACAAGAACAGTCCTTCAAAAG
TAGTAACAATGGCCCGTAGTCACCTGAAGATATGATTTAAACATGGAAGATGGAGATATG
ACCCCTTCTTCTCAACTGCGTATGAACATCACTTTTGTGTGTAAATTCACAGCCCCAGGT
ACCACCAGCAGCAGGACTAACAGCACCAACAGGAGCCTTGGGGCAGTCCTGGCATTTCTA
TAGCACTGACTAGGATTTCCAGAAGAACAGTGAAGTGTCTGTATCTGATTAGAACTGAGT
TGGACTCCCAACCTCTTGGGTAATTTTCAAATAGGGCAGAATTAGTCACAAAAGCATTTG
CTTTTTTTTTTTTTCCTCCTTTTCCTTTCCCCTTTGCTTTCATGTTTTTCATTACAGAAG
GACGAAGCGATACCCGTGCTATGACAAGCAGTCAGAGCTAAGCTGAAACACAGCTCCTGC
TACGATCCCTCATTCAGCAGCTCATTTCCCTTTCTCATCCCAGTCTCGAGAGGCTTATTA
ATAACAACTAGGGAGACAGACCTTTTCCATCTCTGAATTGACGAGTAAATTTTCCCTAGA
ACGTATTTCTGAGATTTCTTCTGCAGCTATCTCCCTCCGTGCCCCAATCCAAGATGAGTG
GTATTTCCAGAAATTAAGTTAGCTCCGCTAACTGTGTTATACACTCTATTTTTGACAAAC
CACCCTTCATTGCCTTAATGTTCTCATTATGGTTGATACACTGCATCACTGTTCATTTAT
TATCGCATTTTAACTCAAGTTCAGATTGTATATCACTGGTGGAGCTCCCTAGGATAAAGG
GCAATGAATACTTTAATTGCCTGATAAATTATTAAGGACACTCCTTTAATTGGGTAATGT
GGTGTTTACATCTTTGAAGCAAATACTTATGGAATCTACACGGGTGCAGATTTGTGCTAA
GCACACAGCTACCAGCCTCCATCTCCCCTCAAGGATAACAGTTTTATCAGGCTATTAAAA
TAAACACCACACAGGATAAATCGTAGCAGATGCCGTGCAAGATCTGCAGCTGGAACGAAG
ACACAAACCTCCAAAGTCAAAGGAGGTGCATTGACTTGCATCAGACGAGGGACTGTGCAT
CTGTGGCCAATGGATTTCATTCAAAGTGAGGCAAAACGGCCAAGGACCTACATTTTGCAT
TGCTTTAGCTAACCTAGTTCATTTGAACTGAAATGGGTCACAGTGTACCCACACAAGGAG
TTCAGCAGCAAACCCAACTTCAGAAGAGCACAGGGAAAATGCAGCTGGGGAAAGCAAGTA
CTCATTGTGTTAAACAGAGCCTGGCACAGCAGAAACCTGGGCTTTCGGCTGCTCTCGCAA
CCATTTCAGAAATAAAACATCCCCTGGAAAGGCACAGCCACTTCCAGCCCATGGGGAAAA
GATGGGAGCAGGAGGGAGAGGCAGTCCCCTGCCCGAGACCCAGCTGCTCCCAGCTTTCCC
TTCTCCGAGCATCTCTGTACTTAGAAACTGAGCTTCCTTGAAGTTCTGCCATGTCCCTGC
TTTCCTGAGCTGTGTGGATGTGAAGATATTTGTCACATTCTTTCCAGCCATATGCTATGC
TTCTTGCTTATTAAAAAAGAGAGAAGGGAGCAGACTGTCTAGGAAGGAGCTTTGTGTTGC
TTAGAAATAGTCACGAAACAGACTTTTCAGGGGAAGTTAGCATTTCAAAGGTGTTGCACA
TCTATTTATTATCAGCTTTTGGTGACACACTGTGTCTGAACTCAGACCCCGCATCCAGCA
GAGAAGCAAAACACTATTAATGCCTGCTTTGTGAGTGCCCGTTCTGTTCATTCCAGGGGC
TTTTGGCACAGCAAGGGGTAGGCAGGGCTGCACCCAGACAGGGCCAGCTGGGAAATGGGT
TACATCATCACTGAGCAGGCACAATAGGGAAGCCTTCCTGCAGTCCTCTGCTATAGCCCT
GACTTCCTTCTCTCCCCCGAGAAAATGTTGCTTTTTTTCCACTCTAATGGCGCAATACAG
TGCCACTTAGATTCCCTTTTATTTAAGGCTCCATTCTCCACAGCCAAAGGACACAAACAC
AGTCTGGGTACGACATATATGCATATGCACACACAGACACTTTATATATCTACGCATGTG
ACTTTTCTTAAGAAAAGATGAGTCTTGAGTGTCTTTGCCTGTTAAGAAGTCACCGTACTT
CACTGCAGCAGGAATTCACCCCATGTCAAGTCATAGGACCCTACTACCGCACAGCGTTAT
CCAAGTTTGCCCCTCATCCTTTTCCCATTGCACAGGGGTGAGAACATGATTAAGCCTTAC
AGATAGTGGAGCTCTCTGCCCTTTCAAGGGCTACAGGGAAAAGTGCAGTCACAAACGTCC
TGCTTACTGCCTGAGAATATCAATAATGAAGTCAAATTAGGTGAAATCCCAGCTGATGCC
TCCTTACAAAAGCAGAGTTCAAAACAGTACATCCAGAAAAACATCTAATTCAATGCTCAG
ATCTTAAGAAAATCAATCCCTGTGAACATGCACCCAAATGAAAACAAGTGTAGATAGAGA
AATTCCTCAGGTTAATGCATCCAAACAAATTAATGCACAAAATCCCGTGGACTGATTTCC
TGGAGCTCCAGCTCCAGATTGGCTCTTCAGCTCGACGCTAATCATCTGAATCTACAAGAC
CTGGGAATGGGGATCTGCTTGCAGTTTTTTGCCTCTCCTTTTCCAGATCTGCTCCCCTTG
GTCCTTCCCCTGTATCTCACATTCCAAATGAGCAGAAAAATACTTCCCCACTCAATTTAG
CATTTCGGCTTCACCATGCCACACCAACAGGTGGTGGAAAGAACTGCACCCTCACTTACA
GATGCATTTCCCCTCATCCACTGATAACCTTTTGAACCACATCTCAAAAAGGCTGCTTTG
CCAGTCAGAACATCATTGTCTTGCTGAATCTGCTGTAATCACAGGAGAGCTAAGCAGTGT
TACACTGACATTGCCATTAATGGGTGCAAAGACACTGTGTTCAGCTCAATAACCATTATG
CTTTTGTACAGTTAAAGTTTGCCTCCAGCGCTCATGCTATTGGGATAGAGTACAGTGCAG
GGAAAGCAACAACACAAAGCAGTGCTCTCCTGGGTGGGCAGGAGGAAACCCTTCTCCCCA
AGGATGACAGAAAGCACTGTGGCCACTGGCTGATGGCACAGGACCCAGCCGTACTTGGCC
TCCCTCCTAGCAGCATTTTGCTGATCTAACCCATGTCATGTCCCATGCCAGCTGGCAAAA
CTATTTGATTCTGCTTCTGGATGCCTGTGTGCAGCTCCCAAAGCTTCTGACCTGCTCTAT
AATGCTACTGCTCTCACCTCAAGATCAACTTTACCACCATTCCCTGCATCAGTTCTTTAC
CATGTAAAATAAACAAGAGCACAGCGAGTGTGCCTCTGGCTGCCCCATTGTTCATTACAG
AAGGTCCCTCACAATGAAGTGCAGCAGTAGTCTGTGTGGCACTGCATGGATACACAACAG
TAAACCCCCAGAGCTGGGATCAGATTGTCTCTTGGGGTCATTCCTGCACATGGAACATGT
GTACACAGACTAATTTATTCCAGCATGCCCAAGGTACATTCAAAAACCACAGCCATCTGT
TATGTATCATAACAGAGGGAACATCTCCTACAAACGGGCTCCAGGACAAACTGCTGAGCA
GAAGGACAGACATGCAGCCAGGGCTGAGCAGTGATGGTGCACGTTGGGCTGTTTGCTGTC
CATGCATAAGTCTGCAAGTACAGAACATTCAAAATGGAAATCCAGCTAGGATGGAAGAGA
TGCCATGGCATTTCCCACACCCATCACAGACCTGCTGGCATCTTTCTCAGCTGCAACCTC
AAAGCCTCATACTGCTGTAAAGTGGCATAAAAGAAAGGGAGTGCATAAAAACAGTGCTCA
AGTCATAACTGCTTTTTAATGCTGTGGCTGGCAAGAACAAAGGCTAAAAAAAATAATATA
GAGTTTAATTTGCAGCACTATATGAACTACTACAAACAGACAGTGGAAAATATCTTCCTA
TTTTCTTCCCCTTACCTCAAGTGTTCCTTATCTGCCTGTGCTGAGGTGACCATCTATCAC
AGCCCATCCCATGTGCCAGAAGACAGGCATGCTGCATCTGATTACACTGCTTTATCTTCA
CTTGGGCTTTAGGAGCCATTCCCACTTTGATTATGCTAATCTGATAACATTATTTCTAAG
CAAGATGCTACAGCAGAGGGACCACGAGCTGCTTAGTGGAGGCCAAACCAAATGCAATTG
GATATGCAGCTTCTGTCTTTCAGGTGCAGATTTCAAAGGGTGTAAGTGCATCCTGCCTTT
CCAAAAAAGGGAAAGGCAAATTTGAACCTACAGAAAAAAATTAAAAGAGACGATGCATAT
ACACGATGTTGTGCAAAATGAGTATGGGAGCAGGGAGGAAAGCACACCAACACACAGCCC
TTTAGTATACACCCAGAAATGTTCTCTTGCACACAGATAAATGGCTCCAGATGCTGCAGT
TGAGCAGCTTGCAGTGTCAGCAATAAAAGCAAGAACAATGAGGGAATCATCCCTTGATAT
CTATATTGCAACCACAAGCATCAGTGCACTCAGGCTCTGCTTCTTTGGCATCAGAGCTGC
TGAGTCAGGAAGAGTAGTGTGGTTGTGCGTTCAAGCACAACACTGTACCCCAAAGCCCAG
TAAGGTTCCCTGGTGCAAACTCTTCCAGTAGCAGCCACACTCATTTTAGGAGACCAATGT
TTCCACTTGTTGAGCATCTAGTGTCTCTTGTGGAGATTAGCAAATACTGACATTTCCAGT
CTGATGGCTAGGGAAGACCATAGAGAAAAAACTCTGTTGAGGTTGATCTGAAAAGCACAA
TTTTCATGTAAATGATGAAACTAGCACTTTATTTCAAGTCATTTTAAAATAGTAAAATCT
AGCTTTTTAAAACTTAGGCACGTTTTTGAACCAGAAAACCATTTCAGAGCAGTCCAAGAG
TTTAATTTTAAAAGTACTGAAACAGCATTTTGTTCACTTCAAAACAAAGGAAGGGGATGA
CAGCTTCAGAAGCCTTCCTCCTTTCTCCAGCCAGAACGATTCACAGATCCATTTGTTCAT
GGACCAAGTGGATAATTTTGTAGCAAATAATCCTTGATTGGTCAATTTACCTTCAGCTGC
AATTATTTGTTGTCACCCAGATGTATATTGCAAGGGAATGACAGTCTCTGGCTCTCGAGC
AAACAGGAATAGGGAATGCCAGCAGTATTGGTGGTAGGTGGACAACTGGACTAGATGATC
TTAGAGGTCTTTTTCAACCTGAGTGATTCTATGATTCAGCTCTTCCCACAGAGCAGCAGG
ACCCACCAGCCTGCAGCTCCAGCCACACCACACAAACACTTGGGTTACATGAGCTATGGA
GGCAATTAGGTCAGACCAAAAGCTAAGACCTGAGCTTGAGCATCCCTAAGGATGTAGTTC
TGCTACTTTTAAGTTATTCAACTCAAGCAGAGGAGTCTTAGATTGCCACAAATAAATTCA
GCAGTGAAGTGGTTCAGCAACATCCCCACAACACAGCAGCACCATGCTTGAGCAACCTGT
TACCTGTCCTTCCCCTTCCTGAGCTTCTGCACAAAAACACAGACATAGAAGTGTTGGCAA
CAGAAGACTGTCATCTACTCTGCCTGCAGGGAAATCTGGTATAAATTATACTTTTCCTTA
ATTACTTGATCCTACCTAATCCTCTAGCAGGCAATGCTGACCTTGATAGTCCAAATCTAG
GTGCCTTAGCCTGCAGAGCCTCTTTGTGCTGTTTCCAAGTATTTGCAGAGCATTTCCAGC
CCCAAGGTGCTCTGGCTCCTTTATGCCACAGCTCAGCAGCAAACCCCAGTGCTCCCGGAA
CCAGGGACCTGTCACACTGCCCAAAGGTGCTTGAGTGCTCCAAAAAGGACAAAAAATAGT
GGAGATATTCCCCAGCCTACAAGGCTAGAGAGGTTTACAGCCTCCTGAATGTAGAATTTC
AGAGGCTTAGGCCTGCTGGACTTCCCCAACCAAAGCAATGCCTGTGGAGCATAAAGCCGC
AGCACAAAGAGGCAGCACTGTGGATATGCCCAAGCAAGTTCAAGGGATATCAGAACTATG
ACACATAGAAATTGATTTTTCACTCTAAGCTCAATGGCTACTTATCTCCAATAGCAAAAT
TAACATTCAATTAGATTTGCTAAATAATTCATGGCAATACATTTGATGTGGTAGTGAATC
CCAGCAGTGAATCATCAGCATTTTGCATTATTGTGCTGGCAGAAACCAGGATTATTTCTT
AAAAGACAACATCTCTCGTTGCCACCATCCACACCCAGATTCTTCTGGGGCTCGAAGCTT
CCTCATTTCATATCGCCTAGGGCTAAATTTGAAGGGATAAAAGGAACTGCTGCTATTGAA
TTTTTTTTATTTTGGAGCAATTTAACCATACACAGCAGCTTGATTTGCTGGTATTTTTTT
TCCCCAGCATTGAAACACATTTGGAGCTCTGCAAATCTTTTGTAATGAAGCAATGCAGAA
CCACTGTTTAGTCATGCAAATGAAATGAGAGTTAACTGAAAAGCATTCTGGGGAGCATAA
ACTCTTTGCCAAAATTCAAAGCAAAAATTTCTATTGTCAATCAAAATGCATAAACGTTTC
CAAATTGGCTTTTGTGCGTGTGCACTGTTGGGAAAAGGACAAGCAAGACAGAGCAAACAT
TCCCTGCAGTCTCGGAGATAACCAGCACACCAAGTAGTTCGGAGGGAGGCAAATAGTATT
TCTACAGAGCTTCTGAAAATACATGGAATTATTACTACAAGTTGAGAAGGAAGAAAATAG
CTTTCCATCCACCATAAAAGCACCCCAACCTCCACTGAATCCATCCTTTTCCAATATGAC
ACATGAAATCAGAATCAGAGTGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCATTTTAGCCTGTGCTTCCACAGCAGCTT
TTACAACATTAGATATAATGACCAGGTATTCAGCTGGTATAAACTACTTCAGCTTTATTT
TCTCCACTCACAGTAAGAGCCAGTTCACATCATCCAAGGACTTCTCCAAAGTCTGATACA
GCTCTGACTGATACAGAGCTCTAGCTCAGCTATACAACATTTATTCAGTTTTCAGTTTCT
TCCTTTCAGATTTTCACAAATGCTAACCAACTCATCGAGAGGTTTCAGTTCAGGTATTAG
GAAAAACTTCTTTTCTAAAGAGTGGCAATGCGTTGGCACAGGCTGCCCAGGGAGTGGTGC
AGTCACCGTCCTGGAGGTGCTCCAAAACTGTGGAGATGTGGCACTGAGGGTTGTGGTCAA
TGGGCAATATTGGTGGCAGGCGAATGGCTGGACTAGATGATCTGAGGTCTTTTCCAACCT
TAATGATTCTATGATAATATTTTCTCTGCTACAGACACTGGAGTTTGGTGACATCTAAGG
TCAGCAGCAGAGCATTTAAAAGAATTTTAAAGCAAACAAACCTCCCACCACCTGTCAGAG
GGCTCACACAGTGGACTTGGATCCTACACGTAGTAGGGCACTCCTGGCACCAGGCAAAGG
CTTTTTCCAAACTCCTCACTTGTCCCAGCATGTAAGGTACACATCCTACATTAGATAGTG
GCAGCTTCACACCTAGCTGAGAAAACAAGGTCATTGTCATCATGATAGCACACAGGTATC
ACAGCTGTGGACTCAGCCCCAGGCTGTGGGTGCCTCAGTGAGACAGACCACAGTGCTCAA
GAGATGCACAGCTGGCTGGCAGCTCAGCATCCCTGGTGATGAATGAGCCTGCTGTATGAA
GCTATCTGCAAGAAATACAAAGCATGGTTTCTCTTTTAGACCTCGCTTAGGTGCAGGGCT
ACACCTGGCTGTGAAGACCAGAAGAAATCAGATTCAAAAGTTTTTTGAAGAGGAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTGCAGCATGC
CTATCACATCCTAAATGGAGAGCCAGCAGCATCTGTCATAAGAGTCTGAACAGCAGAGGC
TGAGACTCCCACGGAGGCAACCTCTTTTATGTCCTAAGTAAGCTGATGAACTAGTAGCAG
AGGTATTAGCAAGACAGGAAAGCCTGCAGAACACTCAAATGTGGTGCCAGAACCCACATG
CCACTGAATAGCTCTGTTGTTGTGTGAGCTAAAAGGCTGTTTCCCCCATTAGACTGAGAG
TGACAGCACTGACAAGATTTATCAGAGAACATTTACCCTGGACTCAATGAAAAATTGCCT
CAGTAAAAATGCTGCCAGCTCTGCTGACGTCTATTATCTTTATTAGAAAGGCCTCTCTGA
TAACCAAATTCATTAAGACCTCTAAGCAAATCATTTCATATAAACTTCTGCATGTTAATT
CAGCACAGACAGATGCAATGGGAGCTTTGGTAAAAAAAAAATCATTAATCAGGGCTACAT
TTATCAGCAGGTGAGCAAAGAGAAAGGTTTCAAGTTCTCTGCAAAGCCCATTTTAAAGTG
CTATGGTGTGCTATTAACTCAAGCACCTGTGCTGCCACTTGGGTTTGTATTTAGTCCTCC
TCAGTCCTAATGAGTTCAATGCTGCATTCCCAGGGTTATGGCATTGCCCCCAGGGTGCAG
TAATTCCTATTTTTCAATGTTCGTGTTTTAACTGACTGAAATGTCTATACATGTTCCAAG
TTGGATGTAGAAACAAAAAGCAAGAAACTTTACTGATGGAAAGTCAGTGAAATAGGATGG
AGGCACAGCACTGCCCTGAAGCCACGAGGCTGGTTCAGCCCCCTGCAATACAGCACATAC
TGCTGGTTCCACTGGGCTCCCACAGCAGCTTATTCTATAGTCCAAGGAAACCTCCAAAAC
TGAGGTTGCATGCAAATTCAGTAGTATCCTCTGGTGCACCAGGATGGAGCTGATTCTGAC
GAGGTACACCGGAATCTCCATTACATGGCATAGGGTCAGAGAACAAGGGTGCCATGTTTT
ACTATCCTCCAGCCCTTCAAAAGCCCTAACAAGCAGCATTAAACAAAGGCTAAGACACAA
TTTTCACTCTGTTTCTGACAACTTGCTAGAAAAAAAAAAAGGCAGAATTTCCCCACAGTG
GTCTCTGAAAGATTAGGCTCATTACTGTTAACACTGTGTTAGAAGTGGACATTAATTAAT
GCTGAATTGCAAAGGAATTCCAGCAGTACAACATATTTCACCCCTGCTGCTACAGCAATG
AACTCATTATGAATGAAGAAATTAAAAACATATATCAGAAGGGAAAGTTAATGATTTTCC
ACTTCTTATTTAGTGTGGGCAAAATACACTAGTGGACTAGAACGAAAGAGGAAGAATGTA
TCTCAGATTCATTTACAGGATAAGATCACAGCCCAAAGCACGTTATTTGCTGGGAATGAA
GTGTTTATCAAGTGATTTCAAAGCTGCACATGGTGACCTTGAGCCAAGCACTTTGCGTCA
CCCAGAACGCCTTCTATCTGCATAGAAGAGCTGCACTCACCTCCTGGCCCCTGGGCAGGA
GGGCTGAGAAGCCACCAAGTGAGGTGGTATCAGCCAGTGTAGGGAGAACATGGGCTGGAG
GAAGCGCTAGCGGTGAGGCCAGAGCTGCTCAAGCAGATGAAACCACTGTACAGCCATTCT
GTCCAAGCTGCACTCGTGCTATTAGCTGGGGGGGGGGCAGGTTTGTGTAACCACCCTTAA
ACACAAATGCCAAAGTCACCACTGCAGTAAATCAGGGATGCTCCAAGGATACCTGGGAGG
GGCTCAGCTCCATAGGCAGGCCCAGCCCAAGGACACCAGGTCTTTCCTTCAGCATCACCT
GTTCCTAAGACACCTACCACCTCACAAATTAACCCAGCTGACACTCAGTGAGGCACATCT
GCAGCTGCAGTGAACCTTTCCTGCAGGTTCCCATCTCAGATATTTATTTCAGTAATTCTT
GCTTTCATCTCTTCTCGGTTTTACTACTTCCATTAGTCTTTTTGACTTGAACTGAATCAT
TTTCTTTCACATTATTTCCACCATTGCTCTGCCTGTACCCAATATATGTGTCAGAGACAG
CAAAAATCCACAAAGCTCAGCTAAGCCCGTGTTGTCATGTAAATAACAGCAGTATATCCT
CCCGTTCAAAGAAAATGAGGTGCATTAAGGTAGCAATATATGATTTTCTGTTTTTTTTTG
TATAATTATGCACTGAATTTAAAAAGAGATGTCACACAGGCAATCTTTATAGTCATGATA
GACAATCTAAGAAAACAAAGGAAAATAATTTTAATAAAATATATTGCCCTAAGCAAGAAA
TAGGCTTTGTGTTTCATACATGAGATGAGATAGTCGTGATGTAAATGGAACGGTGACCTT
GCTGCAGAGTGTTCATTACTTAACACCGCAACAAGCAAATTAATGGATTTTGGAATAGAA
CAAATAACAGTAATAATCATTTTGCTCCTTGGCATTTGTTTGCTGACAGCTAGATTTAGC
AGCAAGTGTTTTGTATTATTATTTATAAAAGGGATTGCAAACAATTCCACACGACCTTAA
AGACATCAGAGAATCATAGGTACAGTGAAGAAATGTTACAGGATTAATCAAGGTTTGGCG
AGTGCTTATAAATCAGGCAGTGACATCTGGAAACAAAACTGGCTGCTAGAAGAGTGTAGG
CTTTATGTTAGGACATGTTGGATTACCACATCCATACATTTGAAACCCTACATAGGAAGG
CTGTGATTGTGGTTACTGTGGTAATTACAGGTGAACGTTCATATGCGTTGTGCATACACT
AAATTGTGTGACAATCTCATGATGTTGTTTAAGGGAACTGTAGCCATCCTACAAAGCATT
GCATTGTCAGGTCTGGAGGTGTTCATGAACTGTGGAAACGTGGCCCTGAGGGACACAGTT
AGGAGGCATGGTGAAGGTGCGTTGGCCATTGGACTAGATGATCTTAGTGGTCTTTTCCAA
CCTTAATGATTTTATGATTGCCCTCTGCAGGCAGTTCCTCCCTTGCTGAATGATATNNNN
NNNNNNGATAATTTTGTAGCAAATAATCCTTGATTGGTCAATTTACCTTCAGCTGCAATT
ATTTGTTGTCACCCAGATGTATATTGCAAGGGAATGACAGTCTCTGGCTCTCGAGCAAAC
AGGAATAGGGAATGCCAGCAGTATTGGTGGTAGGTGGACAACTGGACTAGATGATCTTAG
AGGTCTTTTTCAACCTGAGTGATTCTATGATTCAGCTCTTCCCACAGAGCAGCAGGACCC
ACCAGCCTGCAGCTCCAGCCACACCACACAAACACTTGGGTTACATGAGCTACGGAGGCA
ATTAGGTCAGACCAAAAGCTAAGACCTGAGCTTGAGCATCCCTAAGGATGTAGTTCTGCT
ACTTTTAAGTTATTCAACTCAAGCAGAGGAGTCTTAGATTGCCACAAATAAATTCAGCAG
TGAAGTGGTTCAGCAACATCCCCACAACACAGCAGCACCGTGCTTGAGCAACCTGTTACC
TGTCCTTCCCCTTCCTGCGCTTCTGCACAGAAACACAGACATAGAAGTGTTGGCAACAGA
AGACTGTCATCTACTCCGCCTGCAGGGAAATCTGGTATAAATTATCCTTTTCCTTAATTA
CTTGATCCTGCCTAATCCTCTAGCAGGCAATGCTGACCTTGATAGTCCAAATCTAGGTGC
CTTAGCCTGCAGAGCCTCTTTGTGCTGGTTCCAAGTATTTGCAGAGCATTTCCAGCCCCA
AGGTGCTCTGGCTCCTTTATGCCACAGCTCAGCAGCAAACCCCAGTGCTCCCGGAACCAG
GGACCTGTCACACTGCCCAAAGGTGCTTGAGTGCTCCAAAAAGGACAAAAAATAGTGGAG
ATATTCCCCAGCCTACAAGGCTAGAGAGGTTTACAGCCTCCTGAATGTAGAATTTCAGAG
GCTTAGGCCTGCTGGACTTCCCCAACCAAAGCAATGCCTGTGGAGCATAAAGCCGCAGCA
CAAAGAGGCAGCACTGTGCATATGCCCAAGCAAGTTCAAGGGATATCAGAACTATGACAC
ATAGAAATTGATTTTTCACTCTAAGCTCAATGGCTACTTATCTCCAATAGCAAAATTAAC
ATTCAATTAGATTTGCTAAATAATTCATGGCAATACATTTGATGTGGTAGTGAATCCCAG
CAGTGAATCATCAGCATTTTGCATTATTGTGCTGGCAGAAACCAGGATTATTTCTTAAAA
GACAACATCTCTCATTGCCACCATCCACACCCAGATTCTTCTGGGGCTTGAAGCTTCCTC
ATTTCATATCGCCTAGGGCTAAATTTGAAGGGATAAAAGGAACTGCTGCTATTGAAATTT
TTTTATTTTGGAGCAATTTAACCATACACAGCAGCTTGATTTGCTGGTATTTTTTTCCCC
AGCATTGAAACACATTTGGAGCTCTGCAAATCTTTTGTAATGAAGCAATGCAGAACCACT
GTTTAGTCATGCAAATGAAATGAGAGTTAACTGAAAAGCATTCTGGGGAGCATAAACTCT
TTGCCAAAATTCAAAGCAAAAATTTCTATTGTCAATCAAAATGCATAAACGTTTCCAAAT
TGGCTTTTGTGCGTGTGCACTGTTGGGAAAAGGACAAGCAAGACAGAGCAAACATTCCCT
GCAGTCTCGGAGATAACCAGCACACCAAGTAGTTCAGAGGGAGGCAAATAGTGTTTCTAC
AGAGCTTCTGAAAATACATGGAATTATTACTACAAGTTGAGAAGGAAGAAAATAGCTTTC
CATCCACCATAAAAGCACCCCAAACTCCACTGAATCCATCCTTTTCCAATATGACACATG
AAATCAGAATCAGAGTGGACCCTCAAAGAGCAAGGCTTTGGTAGGCAAACCACAGCATTC
ACCATTTTGCTCTTTCCTCCCAACAGTTGAGGGAAGCAGAGGGGCCCTGGTGTCTGCACA
AAGGACACTTCCATGCATGGCTGCCCACACCATCCTGTCCCCTTTGAGCCGAAGCATTTC
ACAAGCAGTGCTCAGGGGGCTGTAGATAAAATTGAGCTCTCTCTAACTCTGCTCTTAGAG
ATTACTTGAGATTCCTGTATTGCTGAAGGATCAAAGATGAATAGCCATTTTAGCCTGTGC
TTCCACAGCAGCTTTTACAACATTAGATATAATGACCAGGTATTCAGCTGGTATAAACTA
CTTCAGCTTTATTTTCTCCACTCACAGTAAGAGCCAGTTCACATCATCCAAGGACTTCTC
CAAAGTCTGATACAGCTCTGACTGATACAGAGCTCTAGCTCAGCTATACAACATTTATTC
AGTTTTCAGTTTCTTCCTTTCAGATTTTCACAAATGCTAACCAACTCATCGAGAGGTTTC
AGTTCAGGTATTAGGAAAAACTTCTTTTCTAAAGAGTGGCAATGCGTTGGCACAGGCTGC
CCAGGGAGTGGTGCAGTCACCGTCCTGGAGGTGCTCCAAAACTGTGGAGATGTGGCACTG
AGGGATGTGGTCAATGGGCAGTATCGGTGGCAGGCGAATGGCTGGACTAGATGATCTGAG
AGGTCTTTTCCAACCTTAACGATTCTATGATAATATTTTCTCTGCTACAGACGCTGGAGT
TTGGTGGCATGTAAGGTCAGCGGCAGAGCATTTAAAAGAATTTTAAAACAAACAAACCTC
CCACCACCTGGCAGAGGGCTCACACAGCGGACTTGGATCCTACACGTAGTAGGGCACTCC
TGGCACCAGGCAAAGGCTTTTTCCAAACTCCTCACTTGTCCCAGCATGTAAGGTACACAT
CCTACATTAGATAGTGGCAGCTTCACACCTAGCTGAGAAAACAAGGTCATTGTCATCATG
ATAGCACACAGGTATCACAGCTGTGGACTCAGCCCCAGGCTGTGGGTGCCTCAGTGAGAC
AGACCACAGTGCTCAAGAGATGCACAGCTGGCTGGCAGCTCAGCATCCCTGGTGATGAAT
GAGCCTGCTGTATGAAGCTATCTGCAAGAAATACAAAGCATGGTTTCTCTTTTAGACCTC
GCTTAGGTGCAGGGCTACACCTGGCTGTGAAGACCAGAAGAAATCAGATTCAAAAGTTTT
TTTGAAGAGGAAAGAAAGACAGAAAACAGACTGTACAGGTGCATTAAGAACAAAGCATGA
ATTCTGCTTATGCTTCTATGACAAGGCAGCCAGGTGAAGTGCAGCATGCCTATCACATCC
TAAATGGAGAGCCAGCAGCATCTGTCATAAGAGTCTGAACAGCAGAGGCTGAGACTCCCA
CGGAGGCAACCTCTTTTATGTCCTAAGTAAGTTGATGAACTAGTAGCAGAGGTATTAGCA
AGACAGGAAAGCCTGCAGAACACTCAAATGTGGTGCCAGAACCCACATGCCACTGAATAG
CTCTGTTGTTGTGTGAGCTAAAAGGCTGTTTCCCCCATTAGACTGAGAGTGACAGCACTG
ACAAGATTTATCAGAGAACATTTACCCTGGACTCAATGAAAAATTGCCTCAGTAAAAATG
CTGCCAGCTCTGCTGACGTCTATTATCTTTATTAGAAAGGCCTCTCTGATAACCAAATTC
ATTAAGACCTCTAAGCAAATCATTTCATATAAACTTCTGCATGTTAATTCAGCACAGACA
GATGCAATGGGAGCTTTGGTAAAAAAAAATCATTAATCAGGGCTACATTTATCAGCAGGT
GAGCAAAGAGAAAGGTTTCAAGTTCTCTGCAAAGCCCATTTTAAAGTGCTATGGTGTGCT
ATTAACTCAAGCACCTGTGCTGCCACTTGGGTTTGTATTTAGTCCTCCTCAGTACTAATG
AGTTCAATGCTGCATTCCGAGGGTTATGGCATTGCCCCCAGGGTGCAGTAATTCCTATTT
TTCAATGTTCGTGTTTTAACTGACTGAAATGTCTATACATGTTCCAAGTTGGATGTAGAA
ACAAAAAGCAAGAAACTTTACTGATGGAAAGTCAGTGAAATAGGATGGAGGCACAGCACT
GCCCTGAAGCCACGAGGCTGGTTCAGCCCCCTGCAATACAGCACATACTGCTGGTTCCAC
TGGGCTCCCACAGCAGCTTATTCTATAGTCCAAGGAAACCTCCAAAACTGAGGTTGCATG
CAAATTCAGTAGTATCCTCTGGTGCACCAGGATGGAGCTGATTCTGACGAGGTACACCGG
AATCTCCATTACATGGCATAGGGTCAGAGAACAAGGGTGCCATGTTTTACTATCCTCCAG
CCCTTCAAAAGCCCTAACAAGCAGCTTTAAACAAAGGCTAAGACACAATTTTCACTCTGT
TTCTGACAACTTGCTAGAAAAAAAAAAAGGCAGAATTTCCCCACAGTGGTCTCTGAAAGA
TTAGGCTCATTACTGTTAACACTGTGTTAGAAGTGGACATTAATTAATGCTGAATTGCAA
AGGAATTCCAGCAGTACAACATATTTCACCCCTGCTGCTACAGCAATGAACTCATTATGA
ATGAAGAAATTAAAAACATATATCAGAAGAGAAAGTTAATGATTTTCCACTTCTTATTTA
GTGTGGGCAAAATACACTAGTGGACTAGAACGAAAGAGGAAGAATGTATCTCAGATTCAT
TTACAGGATAAGATCACAGCCCAAAGCACGTTATTTGCTGGGAATGAAGTGTTTATCAAG
TGATTTCAAAGCTGCACATGGTGACCTTGAGCCAAGCACTTTGCGTCACCCAGAACGCCT
TCTATCTGCATAGAAGAGCTGCACTCACCTCCTGGCCCCTGGGCAGGAGGGCTGAGAAGC
CACCAAGTGAGGTGGTATCAGCCAGCGTAGGGAGAACATGGCCTGGAGGAAGTGCTAGCC
GTGAGGCCAGAGCTGCTCAAGCAGATGAAGCCACTGTACAGCCATTCTGTCCAAGCTGCA
CTCGTGCTACTAGCTGGGGGGGGCAGGTTTGTGTAACCACCCTTAAACACAAATGCCAAA
GTCACCACTGCAGTAAATCAGGGATGCTCCAAGGATACCTGGGAGGGGCTCAGCTCCATA
GGCAGACCCAGCCCAAGGACACCAGGTCTTTCCTTCAGCATCACCTGTTCCTAAGACACC
TACCACCTCACAAATTAACCCAGCTGACACTCAGTGAGGCACATCTGCAGCTGCAGTGAA
CCTTTCCTGCAGGTTCCCATCTCAGATATTTATTTCAGTAATTCTTGCTTTCATCTCTTC
TCGGTTTTACTACTTCCATTAGTCTTTTTGACTTGAACTGAATCATTTTCTTTCACATTA
TTTCCACCATTGCTCTGCCTGTACCCAATATATGTGTCAGAGACAGCAAAAATCCACAAA
GCTCAGCTAAGCCCGTGTTGTCATGTAAATAACAGCAGTATATCCTCCCGTTCAAAGAAA
ATGAGGTGCATTAAGGTAGCAATATATGATTTTCTGTTTTTTTTTGTATAATTATGCACT
GAATTTAAAAAGAGATGTCACACTTGAAATCTTTATAGTCATGATAGACAATCCAAGAAA
ACAAATGAAAATAATTTTAATAAAATATATTGCCCTAAGCAAGAAATAGGCTTTGTGTTT
CATACATGAGATGAGATAGTTGTGATGTAAATGGAACGGTGACCTTGCTGCGGAGTGTTC
ATTACTTAACACCTCAACAAGCAAATTAATGGATTTTGGAATAGAACAAATAACAGTAAT
AATCATTTTGCTCCTTGGCATTTGTTTGCTGACAGCTAGATTTAGCAGCAAGTGTTTTGT
ATTATTATTTATAAAAGGGATTGCAAACAATTCCACACGACCTTAAAGACATCAGAGAAT
CATAGGTACAGTGAAGAAGTGTTACAGGATTAATCAAGGTTTGGTGAGTGCTTATAAATC
AGGCAGTGACATCTGGAAACAAAACTGGCTGCTAGAAGAGTGTAGGCTTTATGTTAGGAC
ATGTTGGATTACCACATCCATACATTTGAAACCCTACATAGGAAGGCTGTGATTGTGGTT
ACTGTGGTAATTACAGGTGAACGTTCATATGCGTTGTGCATACACTAAATTGTGTGACAA
TCTCATGATGTTGTTTAAGGGAACTGTAGCCATCCTACAAAGCATTGCATTGTCAGGTCT
GGAGGTGTTCATGAACTGTGGAAACGTGGCCCTGAGGGACACAGTTAGGAGGCATGGTGA
AGGTGCGTTGGCCATTGGACTAGATGATCTTAGTGGTCTTTTCCAACCTTAATGATTTTA
TGATTGCCCTCTGCAGGCAGTTCCTCCCTTGCTGAATGATATTTGAACCACCCCCTCCAC
GAGGTCACAATTCACTTCTCAGCCCTCCTGGCCTGCACTGGGGCTGGGACAGTATCTGGG
ATCCACCCTCAGCACTGGCAATGGGACCTGGGGAGCAGCAGTGCCTTCACCTCGCACAGT
ACCCCTAAACACCAGCATCTCCAGCAGCTTATGGACATCATTCATGCTCCCCACTCAAGC
CAGTGGGTGAAAACGTCCTGCAGGAGTGACTGCTGGTCCTGGAGAGGCTGCTGGGCTCAG
TGATGTGTTGTGCTCCAGCTGAGCGTCACACTGCCAACAATTAAGTAGGGGAGTAGAAAA
CACTGTATGTGGCTCTACCCAGTTAAACCTGCACAGAGCATAAGGGAACTGTAGTATAGC
ACCCTGCAACGGAGCAAGTGTTCTACATGGAGTTTTTCCAACAAAGATCACAAATTAGCT
TCCAAAACACCTCAGTGTGGTTCAAACAGTAAAGCCATTAGGCACGTCTGTGCAATAAAA
ACCTCTCTGCAAATGGAAGCCCCCTGGCACATACACCTTCAAAACACTGTTGGAATGTTA
AACCATGATAATTGCTTTGTAACATAAGCAATTTCCTGATGAGTGTGAACACCACAGAGC
ACACATCACTGCAGCCATACCTCCAGCTCTGGCTTCAACCCCCTCCCCGAGCACGGAACC
CTTTGATTGCAGCACACAAACACAGGTCATGGTGCAATTGATTGCATATGTTAAAGCAAC
TTCATTTAATGGCCAAACTGCTCTGCAGCAAATTGTGCAAGGCTGTAAGAGGGAGAAGCC
CTCTGCTACTGTGGCAGAACAGTGCTGGGCACAGAGAAATGCACGGGGAAGGGCTGGGCC
AGGGCTGCAGGTATCACTCCTGCCCCTTCCTGTTATCACCTGTGCACAGCCCACAGACCT
CCAGCAGCATTGCAGCTTGTTCATCATCACCTGTTGAGAGCACTGCAACTCTCTGTACTT
TCATTTCCTCAGTTACACTGATTATCACATTAACAATTCCCGGTGCTACAGAAACAGACT
AAAAATAATAAGCCTGTATCTTTCCCAATACAAATGAAGCCCGTTTGTACTACTGAGAGA
GTGGAGAGCTCATTGTTTTGCAGTAACAAAGCTTTTATCTTAAGAGATCTAATTCATAAA
AATTACTTGCTGTGGTTGTGCAGAACAGTGCCACAGTTCCCACGCTGGTGCCCTCCACCA
GAGCGTGCCCTGTTAATGCTGCCCCCTCTGCTTCTCCTCCCTCCTACCAACAGACACCAG
CACTGAGATCTGACAGCATCACAGCTTTGCTCTTTCCTTTAAGCTCTACAAAGAAAGCAA
AAAGGTGGGAAGGAGGCGGAGGAGAGGCTTCCCCCTGTATTTCACTTTGGGCCAGGTAAT
AAACCAGGGACGCAGCAGGATGCCCACCCTCCTGTGTCACTTCAGCCATGTGGGAGCAGG
GCAAATAGGTGTCATCCTCAGCCCAGGGGCTCCCCCACTATGGGAGCCAGCCCTTTATTA
CCATCACTTAGACTATCTGCAAGAACTTCAATTAGCTAGAAAGAGGTCACGTTCCTGACA
TGGATTAATTGCATTGGAAATGAGCTTGATTGCCTGAACCCTCATTTATCAGCAGCTGCT
CACTGCAGCCCAGATTACTCAGCAAATTGAGCTTTGAGCACTTGAGGCTGTGCTGGTAGG
GGCAGTGCATTCATAGCCAAGATTTCAGACAAATCTGAGCATGGCCAGAATAGAGGGCAT
GATCCTGGGGCACTTCTGCCCAGACACGAGAAACGCCACAGAAACAAAGGAGTTTGTTTT
GAGTCCTGACTTACCCTGTAAAAGGAACAGGAGGCAGTTTGTTGGCACCCATTAGGACTG
CCTTCCTGCACAGTCACTCTGTCCTGGGAGAAAGATTCCCAGCGAGGACAGGGCAGTCCC
TTCCCACCTGTGCCACAGCATGGAGAGGCTGCTTCCTACACACATCAGTGCAGCTGTGCA
CACAAGGCACGTGGTTCTGTATGAGGTATCTACATGGTATAGCTCCTCTTTCTGCTCTCA
CTGTATTTCATCTTTAAATTGGGAGAGATGTTTGTAACAAATCAGAGAGGAACAGCGAGT
TTCCAAGGAGATCCACTGATGAATCAGACTGACTGGTATAAGGTCTAGACGGGTTGGAGC
TTCTTAATTCATGAGACCTCACGTAACAAACGGAGGGAAAAAGATTGTATCTCAACTGCA
GACCATGCATTCCCTCTGCCAGGAAAAGCAGCTTTTATTCCTGCTATAGGAGCAAACAGC
AAGTGCACCGAGTGGGAGAGCAGTGCGAGGTGAGCGAGCAGCTCCAGCACATGCCTGGCT
CAGAAAAGCAAACACCATCCAAGGGCAGAGTGGTCCGGATGGAGGTGACAGAGAGGAGGA
CTGAAAAGCCCCCAGTGTCACACAGGGAAGGATACACAGAGTTCAGCAAGCACAGGAGCA
GAAGCCACACAGCAGCTCCATCACAGCCCTGGCATTTCTGAGAGAAAAGGTGGAACCACA
AGAAGATATCAGGGCAGGAACAGAGCTGCCCCACCACCAGACTCTGCTGCAAACTGGATT
TTCTGCCCAATTCCTGCAGTTTTCTTCCAAGGAAGAAGTGAGAGCAAAGGCATTGCCTGC
AGTGAGCACCATGCCCTGGGGGCACGTGAGGAGCCCAGGCAGAGTGGGTGGAAAGAGGAA
CACCTGTAAATGTGGGGGTACTGAGGAGCATTGGGAAGTAACACACGGGCAGAAGAAACT
CTGCTTCTCAAGGCTGTATTCATTCAGACATTCTGCTCAGCTGCTTCCTTCTGATGGATT
GATGGTGAGAAATCACTGAACGCTGGTGTTACCTCTACTGAAATACAAAGTATTCCAAAC
AACCCAGGAACAGCAAGAGCAGGGAGAAGTAACTGGATACACACCAAGAGCTCCATGGAA
GCCTCCTGCTCACCAGGGGTGGAAATCGCAGGAGCACAGAGATGACGGGGAAAATCCTCC
AACCACATTGATATCTGCACTTTAGGCACTGCTGCTGGCAAGGTAAAGCTGGGCACAGCA
GGGTGACTGCTGTGGGGCATCAGAGGTTGGGACCGCACCAGGCAGGCAGGCTACTGGGCA
GAGACACATGGGGGTGGTTAAAGCTAGAGTGGACTCAGGCTTGGTTGCTAAGTGAGGCTC
CCAAAAGGATTTCCTGGAGCCCTTTTGTCTGCCAGGCAAAGACAGCAGCCAGGCTGGTCA
GGGGACTGAAGGATGTTTATATGCAAACTAGTTCCAGAGCTGCTTCAAGATATAAATTGC
ACTTTTTCCAGTTGAGGAAGTTGCTGCTGGTAGCATTTACGGTGTAGTTAAAGGTTTGTG
GTAATATTTTAGCGATGCATGTTGTAACACTTGCTAGAAAACACTCTGGGCCTCTCACAT
AGAAATCAAAATACTCCTGAATGCACTGAGGCTGGTAGCAGCACACCAGATAGTGTGTGT
AGCACCAGCAACCGTGACCATTGCTTTACCCTCAAGCTGGTCAGAGAATGGGGACTGAAT
GTGGACTGGGGACTGCACAGGGCTGGAGGAGCAGCTGCCTCTGTGTATGTGGGTGGTGAG
CAGGAGGCTGACAAGCACTTTGGTGATGGCTCTGGAGTTGAAATCTTTGCAAACAATGTT
AGATACGCTAACATAATATGTAAAAACCTAGAGTAAGGTACCACTGAGCTGTGGTCCCTC
TGTACTAAACCAGTGTTGGAATGGAAGAAATTGTTAGACACACAGCTAAAATACAAACTG
ATGTCGCTTGCTCTGCACCCCTGCATGCATATGCTTTTGCATGGCCTTTCTGAAATCAGA
AATTCTCTGCACACTTATCCACTGTTGCCAAGTACCAAATGCAGACACTAGGNNNNNNNN
NNGATTCCAGGGGTCCATGATTCCCCAGAAGTGATCCATAGGGGGTACACCCTTTTTTTC
TCACCCCAATTCAGTCCCCTTTTTGGATATAGAAGCTCTGCAGTGCCTCTTGGGTTCATA
TCTTATTTAAATGCAACAAGCGTCCTCCCTTGTGCAGGGGTGAGCCATGAGGCCCATTAA
TTGGGGCACACCAACCACTTTCAGCAACATTGCCTCTTAATGGAGGGGAGGCAGCACAGC
AGCAGCCACTCTATGGACCATTAACTCACTGCCAGGTAGCCTGACCCCAGACTTTAATGT
GCATTTAAGCTAGAGGTCTACAGCAGAGAGATTACAGTGCAATAGCAGAAATGCAATTCT
ACAGGAATTATTTTAGTGCCAGTTGAACTCTGTGGCAGAACTCCCTCTGGCTCCCACATG
GCCACAGGCTGACTTGTTTGTGCCCACTCACAGGTCAATGCTGCCGGGTGTAGTGTTTGG
CTGCTTTCAGTAGGCATCTCACCAGAAATTAAGCAAGATGCAAAGCACAGAGTTAAAAAG
TAAGTTGATATTTAGATAAAGGTTATGCTTAATACTGAACTACAGATATTTCCCAGTGCA
GCCAGACTGTAACCCTGGTGCTTCAAGCACACACTGATGTTCTGGGCTGGGTCCCAATCC
AGCTGACTTTACCCAGCACTGTGCTCAAGCTTTGTGCCACTTTGTGCTCAGAAGTATCCC
AGCCACGCTGCAGGGGTGCAGGAGGAATCACAGCCAAGTTTCTATCCAGTTCCTGTCCAT
TGAACTCCCCATTTGCTCAGCAGAGCCATGCCCATTGCTAGAAGAGGCCAGCTGCACTCC
CAGCTGTAAGGTGATCTCGTTCACTTGTATGTGAACAACAGAGGTTTCCTGCTCTTGCAG
AGATCTAAAAATCACCTCTAATTAGAGCTCTGGAAGATCCCACTGTTCTCAGCAATTAGC
TTCCTTACTGGGCTTGTTTGAATTGAACAGCAGCCCTCCACACTGGAGATGAGGCAAGCT
TTGAAAACTGCCTTTTTCCCCCCCCCCCACTCTGCTTCTAATTCTCAGCTCTACTGCTGG
TGTAGAAGTGCTGAGAGGGAGAGAAAATGTCTTGTGTGATGGAAGAATGAATAAAAGTCT
CAAATAGAATGAACCCAGTCATGAGCATGTGGGTAGGGCATGGCTGGGTTTATTCTGCTT
AAAACTGAAGTCTGCCTATGCAAGTGTTCAGCTTAATTAGTTCTGAGCAATGCTGTGTGG
TGTTGACAAGCACTGGAAGTTTCAGCTGCAGGGAGAGGAATGGAGCATCCATCCCACTGC
TGCTGACAGGTCTGCAGGCCCCTGCTATTTGCAGGCCAACAGGAGGAGACACAGGTTGCT
CCTGGACAGAATTTGCTATCAGCACAGGGGCTCAGTGTGGGAGGACCAGAACTTTTTCTT
TCCCCATCTCCAGCCCATCCCTCCCACTCACAGCTATGCTGCTGTGTCCCACAGCTCTGC
CATCCCCCCATCTCTCTGCCCCCACCACATTGCTCTTGTGTTAACCCTACACAAGCTCCA
GAGCTTCAGCACCTCCCAGCCAGCCTTCAGCTGAGATATTAAAGCCATCGAATACCACTT
ATCCAGTTAGCACAGGAGTTCCACCACTTAAAGATAATTGCATTTCTCCCTAGTTACTGA
TAAAACAGACTCTTCTTAATCATTAAGATATGGCCTGATGAGATATTAACAGCCCCGTAA
GTGAAATAACATACAACACCAAAAGCTAAGTGTTCTCAGATGCCTGCATTAATCATCCTA
TATCTCTACAGTAGCATTCACCAAAGCTCTCCATCACTGCCCAGTCTTAAAGCCACAGGA
CACCTCTGCCCTCAGTGCAGCTCTGCCTTTCTGCCCACAGGAAGGTTATTGCTTGCTTTT
ACATATCAGTGGGAAAGCCAGAAGTCTGGAAATTTTGACTCGTTTTGTTTCACTGCACAG
GAAGAACTTTGCTGATGTCAATTCTTCACAGTGATTATAAGATTGATACTTTTAAATACT
TTTTTTTTTTTTTTACCCCTTAAGCAATTTCTTCAAAGTACGCATCCACTCCTGATCTGA
CTAATGGGCTAAAACTGTACTCTTGATATTTTTGGAATTGATTGCAACCTCCTGATCCAT
GAAAATAAGCACCAAGCCCAGCAAACAAGCACACAGGTGCTGTTGATACAGCAATCACTG
CTCAGCTCTGAGCCTGCAGTTACAGCCCAGCACAGACCCACCACTCCTCCACACAGAACA
AGTGCCAGCTCCCTCCCACTCAGGCATTAAGGATGTGACCAGACACCAGGGAGTCACCTC
TGTGTCACCATCAAGTTCTTAAGCCCCATGAGAAACAGTACAGCTTCACCCTAATTGCGT
AAGCATGCAGCTTGTGCAAGCTGCACTCTGCATGAGATGGTTTATGCAGACCCACACTCC
AAGATTTGAAGGAGCCTTTAAAGCTGTTCATCTCTCAACCATATCAGTCTCCTCTGCATA
CAAAAGATGTTTGGAAGCTCCTTTCTCCTTTCATGGAGAAATACCACAAACCTGAAGGTT
GAGATTTCCATTCGCAACTCAAAACAATGGCCAATAACAGATTCAGCCTTCAAATAACCA
GAAAGATTCTGACCTGCACAATGGACCAGTGATAGAAAGAAGGTTTATTTCTCTCACACA
GGTTTGTACCTCTCCAAAACAAACAAAATTGGCTTCATTGGAGTTGCATTAAATAAGTCA
CTGCTATAGTTTTTCTCAGAACTCATCCAGCAATGTCATTACACCTGCTGTCTGGTACCA
TAAACACCTGCTCCAATGTGAGAAAGCTGATTAACACACACACACACACACTTGTGTAAG
TAGAGAAGGTAGCTTTCTAGCTTGAACCTCCCACTGAGACTACCTAGGTGCTCAGGTTGA
GCAAGTGACATCCTTAATGCCTTCTAGACAATCCTGGACACACAGCATTGGTGTAAGGAA
GATTTGTCTGCTTGGAGAGGGAGGTACTGAGAAAGGAAAGGCAAGCCCCACACCCCATCC
AGATCACAAGCAGTACACAGTAGTGCTCTCCACTGTAGGGCCACAGCCAAGCTATTGCCA
CTTCAGAAAACTGGCTGCAATCCAGCCCTCAAAATTGGTGTCAATGGCACATTGTTAGGT
GTGCTGAGGTTACAGAAACACAGAATATCATTCATTACTGCTGTCAGTTTTGTAGGACAA
GCATCAGCATAAGACAGTCAGCTTCAAGCACAACCAGGGACAAGCCTCCAGGTAGTTCAG
ATCCCTATTTCACACCTTACCCAAGCTGGCTTTTTCCTCCACACATTAATTAAAGCCTGT
GGCTATGCCTTGCCCACCCTATGCCTCAGTAACTAGACTCACATCCCCTCCCACCAGGCA
TATGGCCCCCACCGCTCATCCTGTGCCACCATGCAACTAAAGCTGTGCTTCCCCATGTTC
CAGACCCCTTGCAGCCCACCTGCCCTTTCTTCTTGTCAAGCCCTCACCACCCTCAAGCTG
CACCCCCAACAGTGCCTCCCCGCAGCTACAGGATCACTGTTGCTCTGCCTCATGCTGCTG
TGCTGCTCTCCCATCTGGCATGGGCTCATTGCAGGCAGCACCAAGCAGCCTCCTTCAGGC
AAGGTCTTGTTGCTAACAGTGGAATTTTCCAAATATTGACTCATTTTAGCTTAAATAACA
CCATTCTGTTTTTATTGCCTATAAAGCTGGCTTTGTTTTACCTTCTACAATACTTCTAAA
GCAACTTGGCTGCATCAAAGATAACTTGCACATAACAGTAGCAGAACCAGGCTGCATTTT
GTACATTCCAACAGCTGAACTGAGCCCCTGATCTGCTCCTGTCAAGCACCAAGAGATATA
AATCAATAGATGGGTTTCTGCACTCCACTTCTATAGCCACATTCCTACACAAGGAGGAAA
GCACACACATTGAGCTTTGCTGAGCTTTAAGGTAAACACACAAAAAGCAGCACCTTGGCA
CAACAAAACATATGCTTTTTCACCCAGAAGGCTACAATAACTAAGGGCACAAAACACAAA
GAAGCATCGCTTAGATAGAAAGAGAATAGCTTGATACTTCTGACACCGTACCTTGGATGC
ACGTTTCTTCCTCCATGTCAAATTGTTCCTCACTCTGCTAGGCAACACCTCCCAGAGCTG
CCTTCTTCAGAATACCTCAGCAGGGAACTCCACAAACCAGCCACCAAAGCTCCTGGGTGA
GCTATTTATCTGCTCCCAATCTGGCCTTGATGGTGGGCACCTGGAGCCAGCATCCACCAG
CAGCTCCAGGCCTGATTGCTCTCACTTGCCATCTTCAGCATGTTGTAACTTGTAACTTCA
GCAAGTTGTGTGTTAAGAACTGTATCTATCCAATGAAATTAACACAGCAAAAATTAAAAG
TTTGCTCTGACAGCTCCTAGCAATGTTGGGTTTCAACGTTAGGATACATAACATTAAAAA
TGGCGTGATGACACAACAGTCAACATCAGTGCTTCCTCTGATGATACAGCTGCACGCTGA
GCTACCAGACCACCCCAACTTTCTGAGTGCCACCACAATGAGCAGCTTGGGAGAGCTGTG
CATTGTACCACTGGTAACAGCAGGCTTTGGTCTGCAGCCAGGTTGGTTGAAAAAGAAGGA
GGTAATGGCTGTTGGCCTCCACCAGGCCAGCTATTTGTGTTTACAGACAGAAAGGTAACA
GCACATGAATGTGATACCTATGTGGCAATTATATATATCCTCTACATCCTCATGCACCTT
GCCCCTGAGAAGTCACCAAAGTAGCAGCTCTTGTTCCATCTCTTTAGGTTTGTTTCAGTT
TTTTTGAGTGTTGATTTTGTTTCAGCGAGTTTGATATAGGGCTAGGCGTTTTTAGGCTAC
CAACATTTTGAACATAGAGGTCTATAGGAAGGCTTTTGACTGACTGTGAGCAGACTTGGC
AATCAGTCCTGCTCCTTGAAATTCCATTCAGGCCTTGGAGCTGGGCCGTAGCAGATGCTA
TTACTGACCCTGGTGTTTTCCTTTGGCAGCTTCACAGGCCCCTTAGTTCAGTGTTGCCCT
GGAATAAACCTGGAATGGATCCCATGGAGCTGATAAAGTTTCAGCTGAAACAAACGTTAG
ATCAAGAATTGAGCATTAAATGACTTATGTAATTCTGCATGACTTCAGTGTCTTTTCATT
ATGCTTTCAGATTTTAAGATTTTCAGTCCGGCATTAATAGAAGAAAGTACATAAGGATTG
GGACCTGTGTTACAGGCAGGTCCCTGGGCTGAGAAGTCTTGCCGTGTGCTCTGCCCAGCT
CTGCAGTCAGGACACAGAGATGTGATTTAGCAGTGGCTTGCAACAAAGGCTGCAGACAAC
TTCAAAACAAGGGTCCTCCCTACTCCAGCTTGGTCTGAATGGCCTGCCAAGAATGTGTTG
GATTCATCAACAATTATTCTTGCATTTACCGTATTCCCTGACTGCCTTGTGTGTAAATAT
TGTTTTATTTTAGTCAATGTCTTCCATATACCTTTTGCCTTCAATATTGTACGCCATGCC
AAGAAGATTGCGATATGTATGTTAGGTGCTTCCGTTTTCTCATATAAGCTGCCATTTTTC
CAAATATCAAAATATTCCTGGGACCCTATATAAATGCCTCCTGAATGTAGAAGAATGAGA
TTTAATATTGCTTCTCACTGGTCTAGTGGGAGATTTGTTTGTTTTTGGAGTAAAATCATC
GCTGTTGCAATTTGTCATCCAGACAAGGTAACAAGCTTCCTATGGAGTGGATGGCAAGCA
TCACTGTAAAACCTCACTAGGTGAGCTGCACTACTGCTTCCAGGTGTAGTTGCTGCAAGA
TGTGCTCCCAGGCTTGGCATATTTGGCCTCAGGATCCGCAGTTATGCTTCAAACTCTCTC
TCAGTCCAAAGCCTGAGTTGATACAACCAATGACGTCTGCTCATGAGGCTACAGTAGTCC
AATATTACCTGCAAACGGAATGCAATTCCATCCGGTGAGCCTTAGCTCAGAGCATGGGTA
CACTTATCTGTTGCTGCCAGCAGTGAGGCAGCAGGGTGCCTGAGATGAGTGTCCACAGCA
CCCACGCCCATGGGCCTTCATGCCCTGCTTGTTTCTGTATCCAGATAAAATTTCATCAAT
CATTTTAAGGGAGAAGAAGAGTGTAGGTGTTAAATGCACAACAATGCCACGAGCTGCACG
CAGGCAATTCTGCATGATTTGATAGCAGCCTCATGGAAACACCACTGTTGTGGGATTGGT
TATATTTCTTGGACCAATCAGCAAGATGAGGGTTAATCTTAGAGATATCAGCCACATATT
CTCAGCCAAAAGCATGTAGAAATGGTTTATTTCAGATCCATCCAGCAACCACAATACACA
GAGTAGCTTTGGCCGCAAGGATTCAAAGCCTATTCCTCAAAACCCTTCCTAAAATCTAAC
CTGAAAGCCTGAAATGAACATTTGACCTTTTATCCACAGATTATCTTTGTAAGTATTTCC
GATAAAGAAGACTGATTTCTGAATTAGGACTTACTGAAGATTAGCAGCTTGGCATTCAAG
CATCAGTGACTTTGAGTGAATTTTCCCATCCTCTCCCTTAACTAGAAATTAGGTCCCATC
ACTTGGCCCCAGGGCCAGTGCTCTGACAGGCCAAGAGGCAGCATGTGGCAATGTTGGAAG
GGAATCAGAGCATTCATGCACTGCTTGGTCAGGGACTGCAGGTGACTGTGGGAGCAGGAA
AACTCATTGGAGCAAAAGCTCCTGACTTACCAGTGCTCCAGCACCAGCGCCACATGTTCT
GGTTGCCTCCAAAGCAGCCAAATGGCTGAACCCAAAAAGCAATACAAAATTACTTGCAAT
CTCCTCTCTCTAAGTGCTCTGTCTCTAAGGAGAACTTGATTTGTTTCCAGACTGCCTTGA
AAAGACCCTTCACCTAACTCTGACCTCAAATCCTTGTGCTCCAGACAGGGCGGGGAGATT
GTTCCTTAGGACATCAACATTTGTTAATTGTCTTAAAGAGATTACGCAAATCGCCTAAAC
AAGTATCGACCTAGATTTTGGATTAAGTGTGGGTGCTAAAATGACCTTGTTGGTGAAATC
AGCATGATCTAACCTCACAAATTGGAGAGGGAAGCCTTGGATCTAATTGTGACTCAGNNN
NNNNNNNATGCACGTTTCTTCCTCCATGTCAAATTGTTCCTCTTTCTGCTAGGCAACACC
TCCCAGAGCTGCCTTCTTCAGAATACCTCAGCAGGGAACTCCACAAACCAGCCACCAAAG
CTCCTGGGTGAGCTATTTATCTGCTCCCAATCTGGCCTTGATGGTGGGCACCTGGAGCCA
GCATCCACCAGCAGCTCCAGGCCTGATTGCTCTCACTTGCCATCTTCAGCATGTTGTAAC
TTGTAACTTCAGCAAGTTGTGTGTTAAGAACTGTATCTATCCAATGAAATTAACACAGCA
AAAATTAAAAGTTTGCTCTGACAGCCCCTAGCAATGTTGGGTTTCAGCGTTAGGATACAT
GACATTAAAAATGGCGTGATGACACAACAGTCAACATCAGTGCTTCCTCTGATGATACAG
CTGCACCCTGAGCTACCAGACCACCCCAACTTTCTGAGTGCCACCACAATGAGCAGCTTG
GGAGAGCTGTGCATTGTACCACTGGTAACAGCAGGCTTTGGTCTGCAGCCAGGTTGGTTG
AAAAAGAAGGAGGTAATGGCTGTTGGCCTCCACCAGGCCAGCTATTTGTGTTTACAGACA
GAAAGGTAACAGCACATGAATGTGATACCTATGTGGCAATTATATATATCCTCTACATCC
TCATGCACCTTGCCTCTGAGAAGTCACCAAAGTAGCAGCTCTTGTTCCATCTCTTTAGGT
TTGTTTCAGTTTTTTTGAGTGTTGATTTTGTTTCAGCGAGTTTGATATAGGGCTAGGCAT
TTTTAGGCTACCAACATTTTGAACATAGAGGTCTATAGGAAGGCTTTTGACTGACTGTGA
GCAGACTTGGCAATCAGTTCTGCTCCTTGAAATTCCATTCAGGCCTTGGAGCTGGGCCGT
AGCAGATGCTATTACTGACCCTGGTGTTTTCCTTTGGCAGCTTCACAGGCCCCTTAGTTC
AGTGTTGCCCTGGAATAAACCTGGAATGGATCCCATGGAGCTGATAAAGTTTCAGCTGAA
ACAAACGTTAGATCAAGAATTGAGCATTAAATGACTTATGTAATCCTGCATGACTTCAGT
GTCTTTTCATTATGCTTTCAGATTTTAAGATTTTCAGTCCGGCATTAATAGAAGAAAGTA
CGTAAGGATTGGGACCTGTGTTACAGGCAGGTCCCTGGGCTGAGAAGTCTTGCCGTGTGC
TCTGCCCAGCTCTGCAGTCAGGACACAGAGATGTGATTTAGCAGTGGTTTGCAACAAAGG
CTGCAGACAACTTCAAAACAAGGGTCCTCCCTACTCCAGCTTGGTCTGAATGGCCTGCCA
AGAATGTGTTGGATTCATCAACAATTATTCTTGCATTTACCGTATTCCCTGACTGCCTTG
TGTGTAAATATTGTTTTATTTTAGTCAATGTCTTCCATATACCTTTTGCCTTCAATATTG
TACGCCATGCCAAGAAGATTGCGATATGTATGTTAGGTGCTTCCGTTTTCTCATATAAGC
TGCCATTTTTCCAAATATCAAAATATTCCTGGGACCCTATATAAATGCCTCCTGAATGTA
GAAGAATGAGATTTAATATTGCTTCTCACTGGTCTAGTGGGAGATTTGTTTGTTTTTGGA
GTAAAATCATCGCTGTTGCAATTTGTCAGCCAGACAAGGTAACAAGCTTCCTATGGAGCG
GATGGCAAGCATCACTGTAAAACCTCACTAGGTGAGCTGCACTACTGCTTCCAGGTGTAG
TTGCTGCAAGATGTGCTCCCAGGCTTGGCATATTTGGCCTCAGGATCCGCAGTTATGCTT
CAAACTCTCTCTCAGTCCAAAGCCTGAGTTGATACAACCAGTGACATCTGCTCATGAGGC
TACAGTAGTCCAATATTACCTGCAAACGGAATGCAATTCCATCCGGTGAACCTTAGCTCA
GAGCATGGGTACACTTATCTGTTGCTGCCAGCAGTGAGGCAGCAGGGTGCCTGAGATGAG
TGTCCACAGCACCCATGCCCATGGGCCTTCATGTCCTGCTTGTTTCTGTATCCAGATAAA
ATTTCATCAATCATTTTAAGGGAGAAGAAGAGTGTAGGTGTTAAATGCACAACAATGCCA
CGAGCTGCACGCAGGCAATTCTGCATGACTTGATAGCAGCCTCATGGAAACACCACTGTT
GTGGGATTAGTTATTTTTCTTGGACCAATCAGCAAGATGAGGGTTAATCTTAGGAGATAA
TCAGCCACATATTCTCAGCCAAAAGCATGTAGAAATGGTTTGTTTCAGATCCACCCAGCA
ACCACAATACACAGAGTAGCTCTGGCCGCAAGGATTCAAAGCCTATTCCTCAAAACCCTT
CCTAAAATCTAACCTGAAAGCCTGAAATGAACATTTGACCTTTTATCCACAGATTATCTT
TGTAAGTATTTCCGATAAAGAAGACTGATTTCTGAATTAGGACTTACTGAAGATTAGCAG
CTTGGCATTCAAGCATCAGTGACTTTGAGTGAATTTTCCCATCCTCTCCCTTAACTAGAA
ATTAGGTCCCATCACTTGGCCCCAGGGCCAGTGCTCTGACAGGCCAAGAGGCAGCATGTG
GCAATGTTGGAAGGGAATCAGAGCATTCATGCACTGCTTGGTCAGGGACTGCAGGTGACT
GTGGGAGCAGGAAAACTCATTGGAGCAAAAGCTCCTGACTTACCAGTGCTCCAGCACCAG
CGCCACATGTGCTGGTTGCCTCCAAAGCAGCCAAATGGCTGAACCCAAAAAGCAATACTA
AATTACTTGCAATCTCCTCTCTGTAAGTGCTCTGTCTCTAAGGAGAACTTGATTTGTTTC
CAGAGTGCCTTGAAAAGACCCTTCACCTAACTCTGACCTCAAATCCTTGTGCTCCAGACA
GGGCGGGGAGATTGTTCCTTAGGACATCAACATTTGTTAATTGTCTTAAAGAGATTACGC
AAATCGCCTAAACAAGTATCGACCTAGATTTTGGATTAAGTGTGGGTGCTAAAATGACCT
TGTTGGTGAAATCAGCATGATCTAACCTCACAAATTGGAGAGGGAAGCCTTGGATCTAAT
TGTGACTCAGTAGGTACGATCACGGTGAGTAGTTGGACTGCCCCATACCTGTTTCCCTAT
CTCTAACACCCTTGCAGTGTTCCTTGAGATCCAGTACAATAAAATGTCAGGTCTGAGTCT
TTCAGGAACAGACAAAACAGTGACAAAATCATCAGGGTGATTCACAACCTGCTGTTTCCT
TTTACTAACGCTTATTGCTTTCTCCATCTTTGAGCTTTCCGGCTCATATCGGTGTCAGCA
CCCCAGCTCCTGCGTTAATGAACATAACATTGTTTGGGGGTGGATTTAGCTTAGTGAATT
TGCCAGGGAGCTCAGCACAGCTGCTGAGCACGTTGTGCACCTCAGGGTCCCCCACAGCTG
TTCCCTGCCTGCTGCCATAGGGTGACATTCCTGCTGTGCAGCCAATAGCCAGAGTCACTT
GTCCTGCCAGTACCTGCAGTTTTCTTTGCGTCTCGCTTAGGTTTCAGAAGTAATTAACTC
TGGAAGGACAGATTTGGGTTTAGGCTGTTACAGATGCTTTCAGCAAGGTTTACATTGAGT
GTGTTTGTCCTTGTGTTGTGGCCAGGAGAGAAGCCCAGAAATTGTATCCGTGATGAGCGC
TTCACAAGAGGGAGATCATTAAGTCAGAACCATAATGCTTCTTCAGGGGTTGTTCTTGTT
GCTGTTCCGTAACACCAGCAGATTTCCCTGCAAAATCCCTAGTGTCTATAGTGGAAACAA
CTTCAGATCCAGTAAGAATTCATGGACTGTTTTCGAAGGAAAAAAAATTGTTGGAGGCAA
AGCCAGTGATGACTGGAGTGCTTAAATCTACTCTCAAATCACTTTGCTCAAAATCCAGTT
TAATTTACTCATTTGCTAATCCCAATTTTCCAGTTTTGTTTTTACAAATATAACTCGTGG
AAACATGTTAAATTTCTGCAGCTAGCTGGAGAACTTAGGGCTTCACAACTCTTGGCTCTG
CTTCTCCCTGTGTGTAATACTGGATTTCCACTCTGCTCAGAAATGTATTAGATGCACTCC
CTGTTCCCTCCCTGAACACTGTGCTCCATTCCACTCTCCCTGTTGTTTGTTATGGCAAAG
TTATCCCAGTTCTACTTCACTGGAACAGGTTGCCCGAGAAGGTGGTGAGGTCACCACCCC
TGGAGGCGTTCAAGAAGCATGGAGATGTGGCACTGAATAATGTGGTCAGTGGGACTGGTG
GGGGTGTGTTTGTTGTTGGACTTGGAGATCTCAGCGGTCTTTTTCAGCCTTGATTCTATG
ATTCTTCCACTGAATTTCAAGTATACCCCATGGAGGAATATAGCTTTTCTCAAAGATTTC
TTCAAATGCTATTATTAATGAATTAATGTGTTTTTAGAAATAATTTTATCACTCTCATGT
GCTTACATAGAAATAGCAACTAATTATGATGTGACAAAATATCAGGCATAGTGCAGTCTG
TGCAGTCAGGGCTAGGGAACTGCGCTTTATATCCTCCTTATTTCTGATCCCAGTTGGGCT
CGCAGGGACAGAGGGTCCATGAGGACCCCAGGCTGGGAGCACATCTCCAGGTTGCTTTTG
TGCACTGCAGTCCTGGCTCCCTTCCCTCCACAGCTGCCTCCATTGCTCCCCCTGGGGCTG
TATTTCTATATGCAGGCATACGGAGAAAAGCCTTTTTAATCCGGTGTCTTACAGACTCAA
AGTAGGGATACTTTTCATTTTGAATAAAATATGAATATTAAGCTCTTTGGGCAGGGACTT
TGTCTTCTAGTGTCTCTACAAAGCACTCAGTACACTGCCAGCATTACAAATGTAAATACT
ACAAATAATATAATACAGTTTGGAGCTCAGAGATCTGTTTCATTGGAAAAGGGCCCACAG
AGCCTCCCTGCATGCTGCAATAGAAAAGGCTCAGGTATGAGGAAACGCTTACGGCCAAGA
ACTTCTTTTCATTTAAGTTTCCCAGTAACTCAAGAGGGTCTTCCTGGTTTGATCCCAGCA
GTAAAACAGGGACACTCTGCCCAGGAGACAATAAGTTTAGCACGGAGCCACACTCATTTG
AGAAGTGGGTGAGAGCTGTTTAATTCTGCAGAGCAACACTGTGCAATAATTCAAGACAGA
AAGCCAGCGTGAGATCCCTAACCAGCTTGAAGGCAAACAGGTAGAAAGGACTTAAGAAAA
AAAAACCGTGTAGAAAAGAATGTATTATTAAATGAAAAAGTAATTTAACTGAATAATGAT
GTTCTCATACCACACAGCAAATCTAATATCAACTCTGCAAATCTAATAGGATCTCTGCAA
AAGCAGAGAAGTTCAATCTGAAGTGCGCTCTTCTGAGGCTGAGGCTGATGTCCATTAAGT
ACAACAGAAATATTACTTCAGCTTCAAGACAAGCTGGACCAGGCCTCCACTGCATTTGGA
CTGTGAGTGGCTGTTACTGTCTCCGTGGAATATTCCACTCACACTCACCACAGAGATTAG
AGCAACTTCTAATTTCCACAACAATATAAAGTCTCAGTTTGCGTTGCACTTGAATGCAGA
ACACAGGAGGCAGTACTGTGCTCGCACCAGAGCCTTTTCCTGCATTAAGCAAGACACAAA
TAGGCACAGAAGAGTCACAAGTGGATGGGAGGCAACCATTAGACTTTCCTAAGTGAGGCG
TAATCAATAGACAGACCCTTCCACCGTGGTAACAAATAGCGCATCCTCCAAGGGATCCTC
CAGCCAACAGGAGACATACTGCCCATCTTGCAATGATTATGCCATTGTATTGCCAGCCGT
TGTATTTCTCATTATGCTAATGGCCAAATCATTGTGCTTCAGCCACTTCTTTACTGTGTA
CATCAGCTGGAAATTATCACCTTCATTACCCATAGCTCCTAAAGGTGTCATGCCATAATC
CATGTGGAATTGAATCCACGTGGAAAAGGCTGGCCATACAACGGTCTTCCACACAAAGAA
CCTGCTGTGCACCAAGCTATCTCAGTCTATCACTTTTTGCAGGTCCCAGCAACATCTCCC
ATTTGAGCATTCCATTAACTTTTTCACCCTTTATTTCTTAAAAAAGCCCAGAGGTAATCT
TAATCCCCCTTATCTTGCAGCACTATTATCTTACTGTGTTTCTGCTGGCTTCACACAGAG
ATTTTGTGGAACTGTGTTTTCTTATTTAGCCCAAAATAGGCCTACAGAATGACAGAGCAA
ACAGGTCTTTTTTGAGCAAGCTAGAAATAAAAATGAAATTCTTGTTTTGTGCCTAGTTTC
AATTCAGTATCAGTTTAAAGGACGTAGGGTTGTTTGTTGGTTTTTTTTTTTTTTCCTCTT
GCAGCTTAAGAGAAGGGAGCATTTACCATTTGAGATGGGAGACAGACTCCTGTCAGATTA
TTCCTTTTAGATCCCAAGGGATTAACTGAGTCCCTTGGAGGTGCCCACAGTCCTCCTTGT
CTGCTGGGACCCATAATTAACAAGGCCTGTAAATATCCCAACCCTGTCAGCTCTGCAAAG
AACTTTGTCATGACAGGTAGTGTCAGTTCCCTTCATGAGCTCAGGGAGTCTGTAAAGTAA
AAAGGTGTAAGACTGGTAATTGCCAAATAGAACTGTCCATGGTCCATGAAGAAACGGCAC
AAAATCCACTTATTTTTAAGTGGAGTTGAAGTCATTCTATGAATCACACATTTGTAAAGG
ATGGATATATTAATAAATTCCATACAGAGGCTTTCAAGTTTGAAGCAAGCCTCTCAATCT
ACTGCTTCAGAAAACACAGTCCAAAAGCTATTGATCTGTTTATAGAGATAAGCACCTAAC
AGATTTATCAGAATCAATGCAAACACTCAGAAAAAAAGACTCAATATAAATAATTATAAA
TAAGTAAAGACCTAGGAAATAGAAATGTGCAATTTAAAACTAATTGAAATGCTGACCCAG
AGAATAGGTGCTTATATTCATTTCTGCAAATGCAGTACCAGGAAAGGGGAAGAGTGTGCT
AAAAGTGGATAATTTCAGAGATGACAGACAAGATGAGCAGCATCCAGCTCTAAGGAGGAG
AGCAGGAGCTAGAAAGCAGTGGAAGCAGAATAAGATTTTTTATTTGATTTTTCTTATAGA
ACTTTCAAATGAATTTGTAAAATTAAAGGTCTGAGCACTATTGAAATCAAGTCAGGAGAG
AGAACAGCAGCAGCATGAGTATCCACATACATCTGTTTGGCAGGTTCAAGCAGTACAGTT
CTGCACCCACCTCCTTTTTCCTGAGGTGCAGAAAAGTTTTGACACAGACCCTGTTTGTTG
GTTTGATGCGCCGCTTATCATATGCCTTGTTGTCTCTAACACTGGGATGGCAAGGGATGA
GGTAGCACAGCACGAGAGGCAGTAGGTTGGGCTGGCCACCACCACTCGTACTTCGAAGTT
CCCATCAGCCAGTACATCAATCTAGTATTTGGACTAATGGCCACCTGATAGGCCTTGGGT
CATGCCTACCCCCCATTGTAGTGAGGCGACCTTTCTTGAAAATATTATTCCAATTATTCT
TTAAGGCCTGATGAAGACCAAGAGGCCCCCCCCCAGGTGTTGGTACTGGATGTAGCAGCA
ATAAGAGGCCAGCCCCAAACCTGAGCAACTCTCAACATGTGCTAGCTTTGTTTCAAGTGT
GGCCCAGCCAAAACACATCAAGACAGGTTCAGACCAAGAGCTACCTAACCCATTTCAGAG
CATTACATCTTACCCTTGAAAGTAAATCTCAGTCATGAGAAGAGCCACGCATCACCTGGC
TTTAAATATGGAACTGAAATAGCCCAGTATTCAGAGGAGAAAAGGTCATAAGACATGCAC
GATTTCATCTCAGCCTTATTAGTGTACTTGAAAATGTAATTTTTTTCAAAATCTTAACAA
TTATTATCATTTAAGTGGTGGGGGGGGGGAAAGCAACTCCATTTGAACCTGAGAGGCTGG
GTCCTTCAGGAGAAGTTCACAAAGTTCTGTCAGCAAGATTTAGCTTCTCACAAAATAATG
AAAATGGCCCCACTGCAGTCTCAATGCAGTAAGACAGACATATATCTTATGTTCTGTTTC
TATGAAGAGCTGATGTGAATCAGCATTGTTTGTACCTGATTTGGCTCAGCCCAGAAATCA
GGCGCCTCCTTTCCCTATAGGCAGCCTAAGCACACTTGGAGTGTGAGCAAGCAGGGGGTT
GGCTTCCACCTGAACCTCAGAGCTCTATTGATACAACCATGTAGCCATGGGCACTGTGCA
CAAAAGGCAAGCATCTGCAGTGGTCACAGAGGTCACAGGACAGTTGTTTTGCTGATATGA
CTTGGGTGGAAATGCACTGGCTTGCACCAACCCAGTCAGTAGACGGATCAGCCCCATGTG
GTGTTGAGGAAAATAGAGCGGGGGACAGAGAAAGAAAGAGCTAGACAAATAGGAAAGGAG
AGGAAGATCAGAAAGTGACCTAAGGTTATTGAGCACAAAATTGTAAAGAACAGCACAAAA
GTACTTTCACAAAGTAAATTATGGAGTAGAAGAGCCAGCACAGGTGACAGTGGGAAATGA
CTTGGGGCTGAGGTTTGACCAGCTCCAAAAGCTGCCTCTAGGAACCCAGAGTGGTGCATG
ACATCCCACAGGTCAGCCCCAGCACCCTCACAGCTCAGTGCATATCCACCCTTACCTTCT
GTTTCTCACACCCATCCACAAGAACCCACCAGCAGTTATCAGCAAGGGCCCAGCACCGAA
TGGAGTGGACCTGGACACTTCTCTTTAAATACCTTCCAGGAGGGAGAACCAGAGGGAAGG
TCACAGGCTGATGTCGTTCAGCTCCACGGAAATCCAGAGAGACTTCAGGACCTCTGCTAA
AGGAATTCCATGCTGGAAGGAGTAGAGCACCACTGAGCTTCATGCATGGTCCAAAGCACA
CTAGAGAGGGGGAGAGAGAGGAAAAGAAAGGGTAAAATTTTAAGAAATATTTTGATAAAA
AACAAAAATACTGTCAGAAAGTTAATCAGAAGTCTAGATTTAGGCAGATCTGTTCTCATT
TAACCTTCAGCAAGAGATCAGGTCTCAGCCTTTCTATTTTTGGAAACAGCTGATGAATGC
GGTGTAACAAGGTATTAATAAACATCTGCCCAGCTCTTAGATTAGTATGGGGAAGAATTA
ATGGAGGTCTTAGCATGTTCATATTTTCTGATTATGTCAGATGACTTTATTTATAGAAAT
AATGGGAGGAATGGAAATCGTCACTGACACCCTGTCAATATGCTTAATGAAATCCAATTG
TTTAATTGCATTACGCTTGGCTAAGGAGTCATATCAATAAAAGGCCCTTCTTAGAGCAGT
TCAATGGTCAGTATGTACTTCATGTAAGAAAGCTATGAAGACTAATATTTTTTCAATGAA
CCATTGGGAAGAAAGTCCTGTCTGCCATACCTATTCCCACGCCTCTCACCCTGAGAGGGA
CATGGCTGTTGTCCCCCTGGGGCAAAGCATTCTGGCAGGCAAAGTGAAGCCTTCTGTCCC
TCATGTAGCCATTCAGCTTTCATACTTTACCATCACCCTTCTAGAGAGCCCTTGCTTTTA
GTCCTGAAACACCCAAAATAATAAAATACACCCAGGCTGAAGCCTATGCTATATTTTGGT
GTTCACCACCAATGGCTAAACCAACTCATGCCTCAGCTCCTCCTCATGCCATTCCCTCCT
GTCTGCTTTGGTGAAGTATCACCAGTGCTTCTGTGGGAACAACATCACACCATTCCACTG
AGATAAATAAAGCATAATTTGAGGGCTTGATATGTTTATGCCTCCTCAGAGAAGAGGAAA
GGCCTATAAAACTCCCTTTGAAGGAGTCATGGCTGTTCAGATCGTTTGCAGCTTGTTAGG
TAAAGCCCGAAGCCAGTTTTTATCAGCAGGTGCCAGCATCAGTGGAGAGCTGCTGGGGTT
TAAGCAGGCTTTGGACGCACTGTGGCTGTTTCTCAAGGTTCTAAAATACATTTCATAATG
CTCAGTTCAAACAGGCAGCTGGGGAAGTTTAGGTCTTTTCTCCCAGAAGTATGTGGGGGA
AAAAAAATAAAGCTACAATTATGGTGACAGATGGTTTGTTACACACAGCAGGGCACTGCT
AGTAATTTTGCTCCTTGCACATTAAAGGAGATCAGGACTCATACTGAAAAGTCAGGAAAG
TCCTGTAGTTCTGTCCTGTTCTTCCAAGAAAACTAAAAACAATTCCTAACCCAATCCAGT
CTTCCAAAGCTATCGGTCTGAATTAATGAAAGCAGAGCAAGAAAATGTTACTATTCCTAT
TAATTAGAGACAGGTTTGTGCAATAACGAGAATTCATATCCCTACTGTGCTGCATAAGTA
CCTATAATTCAGCTGCTCCACTCTCAATTGCAGCATGTTCTTCACACTGTTTTACAAATT
AGCAAACCTGAAATCAGCAGCCGCATGTAGTATGATGACATTTAGTTTAACTATGGGGAC
TCTGAAATCCACAGGCGGTCTTCCAGTTCTGCTTTTCACCTTGATTGCATTACAACATCC
ACATTAACTACTCCTAGATCAGCTGTGTTTTTCATGGAAGTCACAGTGCAGATGCCACAG
GAAATACTCTGATATTTATTGCAATTGCCGATACTCCTCTAAGTACTGCTGGGGCAGTAT
TTGGAATGATGCTCTGTGGAAGGTGACCAATGACAGGGCAGTCCTGGAGCCAGCCTGACC
TTCCAGCTCAGCTGACTGCTTTGTGTTTACTGTAAATGATGCAGAGTGAGAACAGTTAGG
AAATATTTCTTCTCCAAAAGAGTGCTCAGGTGCTAGAACAGGCTGCCCAGGGAAGAGGTG
GAAACACCATCCCTGGCAGTGTTCAAGAACCATGGAGATGTAGTACACAGAGCATGGTTA
GGGGGCAGTATTGGCAGTAGGTAGATGGTTGGACTAGGTGATCTTAGTGGTCTTCTCCAA
CCATATGGCAAACAGGCATATAGGTATTGGACCAGAGAGATTGCTGCATTACAAGGGAGA
AATGAAATAAAGATCTTACCCATGGCCTGGGCTCGCAGAAGAGCTCCAAGAGGAAGGATC
TCCACATAGAGATCCTTCTTCCTTGAGAGTCAGCCCTTAAATGGTGTCTAGGAGGGCTGC
AGCCAGCCCCTTCCGGTCACTCAGGTGAAAATGCATTCACCTGTGCCCCTGCAGCTGACT
CAGCGCTCACCTCAGGTGGTCAATCAGAGGTTCAGGCCGTGATTCAACAGTTCCCATACA
CCAACCTTAGTGATTCTGTTTCTAGCACGCACATAGATATCATTGCTCAGTGGCCAGTGC
TCAGTGCTTGTATACCTCAGGAAATTAATTCTGAGCATCAAAACCTGCAGAACCAGAACC
AGGTGTATTCCTACATTTTAACACCGGTGGTGTATCCTATGGTAGGGCTGATGGCAGCAA
TGGTTTGGATGAGCATTTCTGCCACACTGTTGACCTTCACAGCAGGGCCAGCCTGGAACC
AGAAAACTCCAGAAGGAGCTGGCTACCAAAAACACATTGCTCCAGCAACAGTGAGTGAAG
TGAGAGCTTTGAATGCAATAGTGAAGAAAAATATTCCTCAGGGTGTAAATGGAAGATGGG
AAAGTTGTGGGCAACGATCTCTCCAATTCTGCTCCAGCTTTCTAAACTCCAGATTAAATA
GATACTTCTTTTCTCTGCACCCAAGGGAGAGGGACTGAATTGCAAGTTCCCAGTTGGCAA
ATGGGTTTGATAGCAAAGCTCCTGCTGCGAGCTCAGAACCTCCCACCAGCAGACAGATCT
CATTGGGGAGCACTCTGGCAGCCAAAGTACTCAAGTAGCCATGTTTTCCTACAGCTGTGA
GGTGTCGATGGCAGACCACTTTTGATGGTAACGTTCTCATAGCACATGGCTCCACCAGGA
TATTAAAATATGTATGTATAATTAAAAAATCTTCCCTTATATACAGAGTAAAAGGTTGAT
TTTCCTTGTCCTAATACAACTATCACTTACAGAGCTGCTGCTGTTACCTTTTAAGCAGAT
ATTTGAGCAGAAGGGTGATAAAATGCTTGACTTTGATTGAACATTTGACTTGAATTTCCA
CTGTGGCAAAAGGTAGAAATACAAACACTATGAAGGAATCACAAACTTACTACAGGACAA
AATGTTCCACATCAATTTTTGAATCCTTACAGACACTGAGAATCTCTTCTTTGGCTTGCA
TGAAGGTCAAAACTGAGTTTTTGAGCATTCTTTCAGCAAGGATTCTGGAACCTCCTTCCA
GTTTAAGGAGTTATTCCACAAAAACTTCCAGTGTTAGTCCAGCTGGGGCTTGGACCGAGG
TTGTGGTCCCAAAAGAGCAACACAAACTGAAGAAATGTGTTTACTCTGGTACTGACAAGT
TCTCTGCCATTGCCCTACTCCTGGATTCCTTCTGCATTCAGCTCCTGACCTCACTGATGT
AAATAGGAGGAGAATCAAGTACCCAGTCTCTTCTGAAGTACATACCAAAGAGCACTGAAA
TGATAGACTTCATTAAGCTTGTACACCAGCTTTCAAAAAAATAAAAACATTGAGATGGAA
AATTCACAACAGTATTTCCAATGTAAGAGAGAGGAGCAGTTGGGAGTGAGAGTTACGTCT
TATGAAGTAAAACTGCAGTCCACATTACAACAGCCTCTGAAGACATTTGCTGTAATTGGA
TTACTACTATCAAATTAATACAGGAGAAAAGCCCTCTGAACACATTAGGAGGGAGATGAT
CAGCTTTTATTTACTTCCTATGCTGTATTACAGTGAGGCACACCAGTACTGCAGCAGGGC
CAGCTGCAGCACAGGCATCTTTGCTTAAACTCACCTACATAGTTTGATGAATTCAAATAC
AAGCTTTTAGGAACAAGCAGAATCTGTAGAGAACCCATTTATGAGAAACACTTTGGATGA
AACATACCTTAGCTGCATTCTTGGTCATGAGTTCCAAAAAATAAAAATAAATTAAAAAAA
AAAAAAATTGGTGCTGTGCTACTGTGATGTATCCCACAGAGTATGGGAATGACCTGCAAG
ATTTCAAGGCCTGTTTGAAAATGCAGCTTTTCTTCATTTTGATTTGAATGCAATCCATTT
GATCACTGGGCCTCAGGGATTCTTGGGAGAGACAAAGGCAGGAAATTTAATAAAATCTTC
AAAAAGGGTGAAAATTAAGAGGTAATTTTGAATTTTGAAGTAGGGAAAGCAGATATATTC
TGCACATCTTCATTCACAGCGTCTGTTTCCTTCAGCAGGGGCTCAGCGAAGGCCTTCAGG
TGTTTGGGGGAAGCTGGGTGAGGCCTGGCCGAGTGATGGAGGCCCCACAGAAGAAAACCA
GGGGATAATACCAGCTGCATGGCACTCTGGGCAGGCCTCTAGCATGCCTTGGATACACGC
TTAACAGCCGGAAACTGATTTTAATTTCCTGTGTGACATTTGGCCTGTTAGGACAGTGAA
TTTCTCTTGATCCTGATAGCTCCTGTCACTCAGCAGCTGTTGTGTGTCTGCTGAGTGGTG
TCAGTGGCACAGCCCAGAGCAAAACCCACAGAGCATGGGGATGACCAAACCCGAAGATGT
GTTCCTCAGCTTGGAAGCATCTCCCAGGACAGATGTGCTCATCTATGTGCCATCTCTTGA
CCATGAGCAATGTGTGCCTACAGCAGACAATCTCCTTGGTCTGTGAAGTGCAGCCTACCA
CACCAGAAAGAAGCACTGTACTAAGGTGCCATTGAAAAAGGAAACATTCCCCATGCCCTT
AGGGAAACGAAGCACAGAAGCCCCATTATCGCTGACAGAAGTTTTGCCTCTAATTCCCCA
TCTGCTCTTCTGAATGTTAACCTACAGTGTTGGCACATAAGCTTAAATGACAGAGATTCC
AAATAGAAAGCAACAAATATTAGTCAGCCAGGCTGGCAATGTCTGCAGAAATGTGATGTG
AGCGCTCATGTTTCAGGGGAGGGAAATGATAGAAGGGATAACATTATGTTAGACTGGTTG
AGAGGAAATATTATCATTATAGATGGAAGTAATGAGTCAAAATCAGATTTATTAATTTTT
TTTTTATCTTTAATCCTTAAGGAATTCTGCACAGCTCCTCCTTATTGTTATTTGTGTTTA
GCAGCTATGTAAAATAGCAAACAAGGCAAGAAATTTTAGAAGAGAGTAGTAATGTGATGC
ATAGTGTTAACTGGCTGGTTTTGGAAATACCCATTTATCTTGGTTAAATAAAAGCTTATC
TCAAGTACTAAACCAAGTAATCATGATTAGGGAGAGAAAAAGACGTTCACCTCCTTAGAA
ACTCAATACTCTTCAACATTAATAGCACTGCAGTGACATTGCTCGAAGCTGGACGCTTGC
TGTAATTAATATAGATTATTGCCATATGAGGAATGGAAGCATCTGTGCCTGATCTTGCCA
TTGTTTTCACTTCTAGACCAAAATACATTGGGCTTTTGTTTCGGGGACGTGGCCCTTTCA
CTGTTCAGAGCACTGCTGGCCTCGGAGGACTGCAGAGATTTTGTTCTCTTTGTTGTTTCA
AAACTGCATAGAGGGCACAGGCACATTGTTCCCTCTTGTAGAGACTTTGCTTTTGTTCTT
TCTCATCATCTTTTTTTCCTGACTCTCAAGAAAAATTGGTTTTATGCTAAAAAGTATATT
ACAAGAGCACATCTATACAGAGATTCATAAGCTCTCAAGCTATTGGTGTTTTAAGGAGGC
TATGTCTGCATTTGTACCATCCAGCATATCATGCTCTGAACTCACCCATAAAGCAGGTGA
TTTGGTTCTTACAGTGATTTTTACCCAACAGACTGGTGCAGCACTGTACCAAACACAGCT
CATCAGCCTCATCTCAGTAGTCATTTGACTCAATTCACTCCACCAGATTTCCTGTCCACT
TCATTCCACTACTTCTGTAGATTTCGTAACTACTTTTGTGGAATATGTAGGCATTCCTAC
TCTCTCTTTTTTGAGCACATTGTTATTACCTTATATGTTACGTTCCCTGTCTTTCTAATC
CTCTGCCTTATTGTACCCCATTTCATTTCTAACTTTCTCTCAGTCTTTTTCCTCAGGCTG
GATTTGGTCTGTGAAAATGAATCCATCAGAAATACTTCCCTCCTCTTATTCTGGAAATTG
TTCTCTGGGCCATGCACCTTTCCTGTAAAAATCAGGATTTTGCATCATTTTTTCCACTTA
GACAGGAAGTTTCTGTCTAACAAAGGACCTGGAGACCCCTACCAGTGGGCAAAGCAAACA
AAACAGAAGTTCAGCAGTACATGGAGATGTAGCTATATCGTCCATGACTTAGATGCCACA
GCCAATAGGCAGCTTCCTGTATAGAACTGCGCTTTAAAAAATAAAGACATAAAGTGAAAA
TTATATGAAATTAATGCATGAAAAATTATTTCCAGTATTCTTCTATGGCATTAGCATAGT
GAGGTATGTGTTCTGAAAAGATGAGAAATCACCACACAGTATTTATCCTGCAAAATTTAC
CCTTTTGTACTAAGAAAATCAGGAAGGATGCTTGTGAGATCAGAACTGGGGTTTTGGCTT
TGCCACTGAGATGCTTACTTCACAGCTCCATGCCTCAGTTGTGTCTGTAGCGTGGAATTC
TTAAATCTGCCTTTCCTCATCAAGGCCATTCCTTAGTTGTTCAGTCTCCTTGCTCTGTAC
CTCAGTTTTGCACCTGCACTTCTGCATTAACACAAACACCACTAAGTAATGGCCTTTAGC
AAGACATGACATGTGAAACCTCAGTTATTCTCAGGATTTGTCTACCCGTTAGCAGTGAGC
ACATTCAGCCAGCTGCAGACTGCTAGACTCTCATAAAAATTAACAAGCTATTCAATGCAG
ACCACTCTATTTTGCTACAGAAAATAAAGTCAAACAACAGCTAACATAGGGGAGGGAAGG
GGGAGAAAGGAGAACAGTGAAGGCAGACCACAGACAGCATACGACTTGTATTTATTTTTT
AATCCTATTGCTTTTAGTGCTTGTGATGCGCGCTGTAACTAAAGGAATCTAACTGAATTA
GAATTTCAATATGTCCCGAGCAGATTGGAGCCATTTCCATTCATGAGCAGCACGTCCCAG
CTGTAATTGCCTGCTTGCTTATCCACACAGCTCTTTACAGCTAATCCAAATGTGGACTCA
AAAATAAATAGTGCCAGAGCATTCAGCTCCCACTGGGCCATCCTTTCAGCATTGCCTCTG
CCTTCACTTTGTTCTGACTGGTGCTCTCGATGGCACAGGGTCGGACTCAAAGGAGATAAA
GATGATTGAGCTGCTCAAGGATTTAGGTGGGAGAAAAGCCACTCTTGCCCTATCTGCTCC
GGCTATTTCTGCTTTTCCTTGGGGTGCTGCCTTGTGGCTGTTCATCTCTCCCTGCCTTCA
CCCCTCTTCCCAACCACAGCACTCTCTAGCCCACTTTTCCTTTGTGGCTTCCTAAGGGCA
GCTGGTGCCCTCCCTGTCACCCCCTCTTTGTGTTCCCACACAGGGAGGGTCTTAACAGGA
TTTTAGTGCTGCCTTTCTCAAATGAAACATCTCTTCAGGGATGTTTAAAAACCATGCACT
TCTCAGATCAGATTTTTTTTCTGGAAGAGTGTGACACCAAGGCATAGCTGCACAGAGCTG
GAGGGAATGCCCCTGCTGATGGGACCTGGCACTGCCTCTGCTCTCCAACATGGGGTTTGT
GACCCAGCACTTGACCTTGCTGCACGCCCTCCCAAAGCCAGCCCACGTTACAGGTGATCT
CTGAACCCCAGGAGCAGCAGAGATGATAAATACAGTGCTTGTCCAACGTGTCACTTTCTA
CGTAGATTCAAATTAATTTACAACTGACAAAGCACAGAAAGCTAAAAATGTCTGCAGAGT
CCTGACAGGCAAAGGGGACAATTATCCCCAGCAACTGCTATGTGCCAAGAGAGGCATTGC
CTCGTGCTTAGATTACAAACCCAGCAGCACCAAAACATGGGAGTAGTGGGGCTGGCTCTT
CACTCTGCCAGCTGAAGGTGGCCTAGTTGTGTCCTCTGCCAGGTAGAGCAGGGGGACTGG
CACAGCCCTAGGGCGAATGAGGGAGCTGAGCCACATTCTCAGGGCTCTTGGAGGTGGCCC
AGAAAGTCACCAAAGAAGAGAGGATGCGACGCTCCTGTTTGCAATAACAAGCAGCAGCTC
CAAGAATTTCTTCAAAAAGTGGTATTTTTGATCAGCTAAGTCAGAATTCACTGCAGCCAG
GATAAGAGAAACAAGTTATCATGGAGATAGAAATGGACAGGAAGAGGCTTTGGGGAAAAA
GAGGGAAGAGGAGCCAAAAAAATCAGGAGGAGTATAGACTATAAAGTGTGCATCTGTGCT
GTGTGGACTACCTAGACTCATAGCAGGCAGGTAGCTCTTGGAGCCAGGTGGGAAAGAAGC
TGAGGGCTTAAAGGAATACTTGAATAATAAGGCTTGAAGTTTTTTCACAAATCATAAAAT
CAGTACTGGAGGAAAAAAAAAAAGATCATGACATGAAAATCTGGATGATTTTAGAGGTAT
TTAATTTTGAAGTGAGTACGTACTGGATGTCATCATGTAGTAAAGAAGTACGACTCAAAT
TTTCTGAACATCCCTTTGATTCCTGTATAACACTGGGCAGAGGGATTTAATAATTATAAA
GGATGATCTGAAGTTAAAAGCAGTTTTGTCTTTGAAAACAAAACCATGTATTCTACACAT
AACTAAGTTACATCCCCATGTGATGGCTTCTAGTCGTATCCTTCTCCTTGGGACATGGAG
CATCTTAGCCACGTCTGTGCCAGTGGAGCTCAGCAGGATCAGTCCCAGGCATCACCCTCC
TTCAACTCAAAAACCAGGTGGAATGCTCAGCCCTCAGCTCAAGGGAGATTTAGGAGAAAG
GCCAGAAATAGAGGTGAAATCATTAATGAAGCATCATTAGCGATCAGTCTTCCTGAACTC
ATTAGTACATTAGCACCAGCTCCCCATTGTCCAGTTTTCCCTTGCTGTAATGAGGAACCC
CAAATACAAGGTCGTTTGCTGGCTGGATTAGTCACTGAGTGCAGCCGGAGCTCTTGGGAC
ACTCCAACAAGAAGAGTTATTTATGTCGCTCTGTCCCACACCGTGCCCATTAGCTCACAG
TACCGCAAGGCCTGGTCACGAGGCAGAAACACACCGTTTGATACCACGGCTGTCGCTGCA
CGATTTAGTGTTGCTGCTGGCAGGGCGTTAAATGTTCCCTAAGTGGTAACTGTCTTCCAC
TAATGCGAATGCATTTCTTTTATAAGTTAACTTATTGCTTTTCCTCTTAGTCCATGCTGC
CTGTTCTTCTGCTCTGGCCACAGACAAGTGGAATTCAGGCAAGCACGCACTGGGCTCAGA
TGGAGCCCTGCACGGAAAACAGGCATTTGGAGGAAACATTGCCCTGTGAATAGTGTCACA
ACACGAGAATTGCCAGTTTGGTGCTGACCTGCTCATTCTGAACCACCCCACTGGGTTCTT
CCTCAACCTCTCCCCGGTGCAACCACACTTCCATCTACCCCTCCATGTTGCAATGGGCCA
TACCTGGGAGCTGGATCTTTCAGGTGCTGTTTTTGTCCTGATTCTGGCTCTTACATTACT
TCCATACCAGGACTAGCAAACTCCCCTGGGTCACCTCTGGATGCAGACAGGAGAATCTCA
GCTTGGCAGTTAACTGCATAGCTGTGAGTAGGAAACAACACGTCACACCTTAGAGCTAAC
TTCTGCCTAACGGAGATACGAATTTAGTCACTTCCATCTGACTTCTGGAGTAGCTTCCAT
GATGTCATCAGAGTTAGGATTTTACACAAGATTAAGTGTGCAATTGTGTGTTAAACAGTG
ACCGTTAGCTCGAGTTGCCCAGCTAATGAAGCAGGCAGCATTAATGCCATCACATATGGC
CTGCTTCTAGGCACCGGCACCATGTGGGACTCTGAAATCCATCTGATGTCAGAGGAGGAA
GGACACCTCTTTTCCCCTCTGGCATCCCCCCAGTGGGGCAGCCCCTCACCACCCAGCTGT
CACCCTCTGGCTCTCGTGTGATGTGCTCTGGAGCTTGTGCGTCTACTCCTTGCCCAGGAA
GCTCTGCCAACTCAAGCAGGCAGCAGAAGCTGCTGATCACTTCTAACGAGTGCTCAGGGT
TTTCCTAATTAGGAACAGACTAGGGTAGCATTCGCCACTATCTCTGGGAGCAATCAGGCC
ATAGCAGGCCAGCCAGCCACGCTTTCCGTNNNNNNNNNNAGGATAAGAGAAACAAGTTTC
TATGGAGATAGAAATGGACAGGAAGAGGGTTTGGGGAAAAAGAGGGAAGAGGAGCCCAAA
AAATCAGGAGGAGTATAGACTATAAAGTGTGCATCTGTGCTGTGTGGACTACCTAGACTC
ATAGCAGGCAGGTAGCTCTTGGAGCCAGGTGGGAAAGAAGCTGAGGGCTTAAAGGAATAC
TTGAATAATAAGGCTTGAAGTTTTTTCACAAATCATAAAATCAGTACTGGAGGAAAAAAA
AAAAGATCATGACATGAAAATCTGGATGATTTTAGAGGTATTTAATTTTGAAGTGAGTAC
GTACTGGATGTCATCATGTAGTAAAGAAGTACGACTCAAATTTTCTGAACATCCCTTTGA
TTCCTGTATAACATTGGACAGAGGGATTTAATAATTATAAAGGATGATCTGAAGTTAAAA
GCAGTTTTGTCTTTGAAAACAAAACCATGTATTCTACACATAACTAAGTTACATCCCCAC
GTGATGGCTTCTAGTCGTATCCTTCTCCTTGGGACATGGAGCATCTTAGCCACGTCTGTG
CCAGTGGAGCTCAGCAGGATCAGTCCCAGGCATCACCCTCCTTCAACTCAAAAACCAGGT
GGAATGCTCAGCCCTCAGCTCAAGGGAGATTTAGGAGAAAGGCCAGAAATAGAGGTGAAA
TCATTAATGAAGCATCATTAGCGATCAGTCTTCCTGAACTCATTAGTACATTAGCACCAG
CTCCCCATTGTCCAGTTTTCCCTTGCTGTAATGAGGAACCCCAAATACAAGGTCGTTTGC
TGGCTGGATTAGTCACTGAGTGCAGCCGGAGCTCTTGGGACACTCCAACAAGAAGAGTTA
TTTATGTCGCTCTGTCCCACACCGTGCCCATTAGCTCACAGTGCCGCAAGGCCTGGTCAC
GAGGCAGAAACACACCGTTTGATACCACGGCTGTCGCTGCACGATTTAGTGTTGCTGCTG
GCAGGGCGTTAAATGTTCCCTAAGTGGTAACTGTCTTCCACTAATGCGAATGCATTTCTT
TTATAAGTTAACTTATTGCTTTTCCTCTTAGTCCATGCTGCCTGTTCTTCTGCTCTGGCC
ACAGACAAGTGGAATTCAGGCAAGCACGCACTGGGCTCAGATGGAGCCCTGCACGGAAAA
CAGGCATTTGGAGGAAACATTGCCCTGTGAATAGTGTCACAACACGAGAATTGCCAGTTT
GGTGCTGACCTGCTCATTCTGAACCACCCCAGTGGGTTCTTCCTCAACCTCTCCCCGGTG
CAACCACACTTCCATCTACCCCTCCATGTTGCAATGGGCCATACCTGGGAGCTGGATCTT
TCAGGTGCTGTTTTTGTCCTGATTCTGGCTCTTACATTACTTCCATACCAGGACTAGCAA
ACTCCCCAGGGTCACCTCTGGATGCAGACAGGAGAATCTCAGCTTGGCAGTTAACTGCAT
AGCTGTGAGTAGGAAACAACAGATGTCACACCTTAGAGCTAACTTCTGCCTAACGGAGAT
ACCAATTTAGTCACTTCCATCTGACTTCTGGAGTAGCTTCCATGATGTCATCAGAGTTAG
GATTTTACACAAGATTAAGTGTGCAATTGTGTGTTAAACAGTGACCGTTAGCTCGAGTTG
CCCAGCTAATGAAGCAGGCAGCATTAATGCCATCACATGTGGCCTGCTTCTAGGCACCGG
CACCATGTGGGACTCTGAAATCCATCTGATGTCAGAGGAGGAAGGACACCTCTTTTCCCC
TCTGGCATCCCCCCAGTGGGGCAGCCCCTCACCACCCAGCTGTCACCCTCTGGCTCTCGT
GTGATGTGCTCTGGAGCTTGTGCGTCTACTCCTTGCCCAGGAAGCTCTGCCAACTCAAGC
AGGCAGCAGAAGCTGCTGATCACTTCTAACGAGTGCTCAGGGTTTTCCTAATTAGGAACA
GACTCTGGTAGCATTCGCCACTATCTCTGGGAGCAATCAGGCCATAGCAGGCCAGCCAGC
CACGCTTTCCGTCCTTCACCCTCAAGGCAGCAGTGGTAAACAGAAACATCATTTTATTTT
CCAGCACTAAGGAGCCCCAGGGCTGAGCCTGGCAGAGGTCTCGGTCCAACACCCATCGTG
GGCTCCAGGCCCTCAGGTAGCTGCTCTGCACTCTCCTGAATTGCTCAGTGCAGAAACACC
AGAGTAGGGTTAGACCCAAGGTCTCATAACACAAATTTCTGTCTGCGATCACTATAAAAA
CACTTCTTAGCTGGTGGCTGATAGATGCTATTTCTCCTTCTAAACTACAGTTATTACAGG
AAGGAAGGACTTCTTACTGTTGATTCCCCAATACTTATCTAACGTTGTAAGAAAGAAAAG
AGGTTTTACTGGCACACAGACCTGCAGTGATGACCATGGACGTGGGGAAAAGACCAGAGG
ACAGTCCCTTTCCGTTGCCTCCCTTCTTTGAAGGCACTTTCTCGGCCAGTTTACTGTGTG
TGAATGCAGCACAAAGCCATGTCAGATATTGCTCAGCTACGTCACCCAGCAGCCCATCTG
CGTACACATGGATTTTGGCTCCCAGCCATGCCTGTCTTTCCCTGCAGTCCTCTCAGCTGG
ATTTCAGTATTCTCCCAGGTTCATCACTATGCAAATATTGAAATTAGCGTGTTTACGCAG
ATAGTGGCATTACAGACTTTTCCAGGAAAGGAGCAGTGAGGAGTTCAAGTGCCTTCTCTG
ATGGCAGCATCAACAACTGGGTGTATTTTTCAGTGAGCTCCAGTGTATGAACACCTGCAT
CAAAGCATTCAATATCCGGCATATTTCATTTCTTTTTCTTAAATTTTTCTCAGAAAGAAC
TGAAAGCACAAAGTGCTGAGCAAAGAAGTGACGTGAAATACAGTGAATCTGTATGGCCCA
ATGGATGGAGATTATAGCCAACTTCACTGCACTCAGGAGCAGATTAGGAGGAGTTGCGAG
GGGAGTGGAAGCCCCACTGGCAATATCCATAGCACTTATGCTTAAAGCCTACCAATGTAA
CTTCAATCCGGAAGAATAGTTGTTCATATTCAATTAATCCAGCCTATCCACAATCTTCTA
GGACTAGATATAGCAAATACGCCTTAAATTAGAGCAGTTCTTCAGGTCCAGACAAAGAAA
AACAACACTTCCTGAGGTCCGTTCAGTGCTGTATTTCACATCCGTGAGATCTAACTGCAG
TAAAGGGTTGAAGCTAGAATGAAACCCCTGAGACTTTCCCCTCTTCAGAAGACCCAGAGG
GCCAAAGTGGAGAAGGCACCATCTGTCTCACACCCCCGTGAAACAAAGAAGCCCCAGGCA
GGAGTTTATTCTGTGGGATTCTAGATTCTTGAAAAGGGATATTTGAAGAAAAATCCCTGA
ATCCCAGGCTGAAATATCAAGCAAACCGTTGTTTTAGAGCTTCTGAGAAAGCTCTACCTG
ATCTGGCCAAATGGTTTCGGGACAGTCATTTTTCTGTGGGAAAAGACATCTTTGTCACAT
CAGATACATTTCCATAAAACACTGCATTTATGCCTCATACTTCTGCCTCATTCAGACTCC
TTGCCCGAGAGCCTCATCTCACTGAGGGCCATTGTGCAGCCAATAAATTGCAATAACCAT
GCATTTGCTTAAACAACAGCCACTTTCTCCCAACAAAACACCACCACAACATTGGATGCA
GCTATTACCTTTTCTTAAATTGCCAGTGATTTCTTGTTCATGGTGCAAAGCCTGTGCACT
GTGGAGCATATTTTACCAGGGGTGCAAGCAAGATTTATCCTTCGTTCCCACTGTCGATTT
GTCATTCTCATTACTTTACATCTCAGCTTAAGTTTATCAAATAACCCCTCCTGGGCACAG
CCACGGCGGATCTGGGTGCAACTTAGTCTGCTGCACTAGGTGGGCAGTGACAAAAACTAT
CACTATTCCCCCCTAGGTCCTTCCATCGTCCCACTGCAGCAAGCAAAGCCAACACTGGGC
AACGCTCTAAAATGTTTATTTGGACCAGTGGCCGGAGCTCTACATCTTACAGACACGATG
AGAAAAGGTAAATGGCATCAATAATGACTGTCTCTGGTGGGTTTGGAATCTCTGGGACCA
TGACCTGTCACTGCTCTATAGTGGTGGCAGTGGGAGAGGGAGGAGGGATACAAAGCCCCT
TGCCCCTCGCTCCCCCCAGCTGCTCTCTGAAGTCCCGCTCTGAGGTTACCACAGCACACT
TTAAAGCATGCTACTCCCCAGCACAGATTTGCAGCCACGGCTCCAAGCTGTTCACAGGTG
TCCTGCTCCCTGCCCACAGCACACACATACGTCCTGTTCCAGGCACAGCTCACCGCCTCC
TCTCCTCCAGCCACCTATACCTTTTGCACATCTATGTGATGCATCCAGCTGCCAGAGATG
CTTCCTGTTTCTATGCATGCACACGTGGGGAGCATGTGTGCATGACACTGCACAACAGCC
GGGTGATGGCAAACAGCTGGAAAAGTGGCTGGCTTCTGGTCCGTCCCAGTTCAGCAATGC
TGTTGCAGGAAATAGGTTGATGGACATGGGAATACTGAGTCTCACATGGGCAGGGAGTTG
CACAGAAGAGAAAGAAAGGGAAGGAGAGGTTTTAAGTCTACAGACAAAGGCAGCACTCAG
TTGGGAATGAGAGAAGTTAAATATCATTGCTGAGAGAACAATTGTCAGTAATGCTCAGGC
TCATCCTTCCAAAATCTCTCTGCTTTGTAGTGAGATTTGCTGGGCAGCTCATCTTGTCAC
TACCAAACACATTTCCCCTTCCTTTCTTTCCCCCTTCTCCCTTTCCTCCTCTCCTTCAGC
TCTCCTTGCAGTCACTATTAACTGCAATCACAAAACATCAGACTCAAGTGAAACAAAACC
AGAGGTCAGTGCAGCTACAGTGCCAATTAGCAAAACACACTCGTTAGTTATTCTAATGAG
ACATTACTGCTGGCATCTGCCTACGAAAATGGGTTTTGAGTCCAGGTACCAGAGCTGCCT
ACAGAATGTTGGGTTTCTTTGGAGGACTGAACTCACTGAACTCTACTGCAAATGCCACAG
AGGTGCTCAGCTCTTTGTATAATCCAATCCCAAATAGGTATTTTGAGGACCTGAACTTGG
CAGCAGGTTTCCACCATGGGCATTCAGTTGGAGCTGGACATCTAACTGCCTCCTGTACTT
CTGCAAGCCTCTTCTGTAATTGAGATTTCCCCAGGCTTATGTTCCTCTACTGCTATGCAC
CAGCCGTGGCAATTCCAGGTACCTTTTCAAGCCATCAGAAGGGATTGAAGGAAGAGCAAA
TGAGAACAGGAGAGTGCTGACTGCAGCCTCAGGACTGCAGGAGAGAGGTGTGAACACAGA
GCAAGTGCTCACGACGGGAAGAACTCACCCGTTGCTGTCTGATGGTGATTTTAACACATG
CAAGGTCACTGGCAGTAGCACCATGTCATACAGTCAGTACATTTCAGACAAATAACATCC
CCTAAACGACCCTTTCCTAGGAATCCTGTGCTCATTAAGCTTCAGACAGAAAGGCTGTCA
GCTGGAGCAGCAAACTTACGGCAGCAAACAACAGTCTGCTGCAGCAGTGGGTCACTTGTT
GGGGGATAATTGCCTCCTCCAGGGTGGGGAGCATCTCTTGGGCATCTGCTTTGGTAGGAC
CAGGGCCAAGAAGTGCATTCATCGCTATGTTTGAGAAATCTGCTGCTCCCCAGCTGCTGC
TTCTTAGGCTTTGGAAACCTAGCCAAAATCTCATTACTTCTCAGCTGTTCATTATGTTTT
CCACAATGATATAAGCTTGGAAAACCAAAGCGCTGGTTGGGTGCAGTTCAGTTTGGTCTC
TTTTGGAGGTGACAAGGTAGGGAATTGAGTGAAGTCCGTTCTCAGTGATAGGAACCACCA
CAGAGGTTCATGTATGAGTTCCAGGGAGATATCCTCTTGCAATACTTCAGATAATAGGAA
TTGATGCAACTAAGCATCCCCAGTAAGGAAAAATGTAAATAAATTGGATTCTGAGTAGAA
AAGCCCCTGAGCACTAGAAATTCTGTGGTTAATATATGAGAGGTTTTTGACCTTATTCTT
CAAGGACTTCTGCTATCAGTAGATATCAGAAGTATGACTTCTGCATAATAACTGCGATAT
CAGAGAAGAAAATGTAGGTTCAAAGTCACTCTGAATATTCCCAGCAGACAGGAATCTCAA
CAGCCCCGCAGCCCACAGAGCAGGTGGGAAGCAAGTGGCAAGCCTCGTCCTTCTCATTAG
CTGCTGCTAAAATGTCTGTCTCCAATGATGGCAGAAAAAAGTCTTGGCTGCAGCAAATGT
GAGCAACTCTGCAGAAGATATAGAACTTCTTTATGAAGGTGATGAGGCACTGTATTTCTC
CTTGGCTGTAGCATTCAGGCTGACTAACGTAACACACCCCCTCCTCTCCCTTCATCTGAT
GGTCTCATAAGGAGCTGCTGACCGCCCTGCAGTGGGATCCCTGCCCTGCTGCCAGATCCG
CAGAGGGACCGCTCTGCTCTGTTCCCCTCAGGCACAGTCACGGCCGAGGTTTCCTCTCTG
GCAGTCGAACCAAGGGAGAGCAGCCAGCCCATATCCTGTGAGCAATTTGGCTAAGGGAAC
ACTTCAGCTTGAAAATGATGATGAGAGCAAAGACCTTTTGTCCTTGGAGGCTTGCTTTCT
ATTAAATGTCTTTACAGAAGATGGAAAGACCTTGTGTTTTGATGGCTGTGACATCCTTAA
AAACAAAATACACCCACTTCCACGCTGATATCATGTCTGGGGAGTTGCCACAGGTAATCA
CAATTATTAGATGGAGTCTGTGAGATGAGCAGTGACCCATGTGCTGACAGCCCTGGGGTG
CAGCATCAGCTGGCCAAGCGCAGCACCCCTCCAGCTCTCCCAGTCCCTGGGCTGTGCCAA
AAGTTCATATGTACCAGAAGTTCACACATGCTCAAAACCCATTCTGCAGAGCAGCAAACA
CACAGGCAGGGTAAGGCAGCTGCTAAGATGATGCTCAGGCTGCCCTGCTGCGGCAAAATA
TTCTACTCACCCTTTAGTCCATCTTTTTCTAACTCACACCCTTGGCTCAAGGCCACATAG
GAAGCATTTGCAACCATTCTCAATTAGCTATTTGTTTTTAAATTGTCCATTTGTATCCCT
TTTATGTCCTAGCTGCTCTGGTGACACTGGTGAGCGATGGCTCTGTGTTTTATGTCTACG
CGCTGACATAAGTTATGCTGTGTGATGGGGTAATGTTCTGGAACTGCATGACAATTTCTG
CCTTCCTGCCTGCTTCCATTTGAGAGCAATGCAAATCGTAATAGCGGCTCTCAGAGTTAA
ACACAGATTGACAAATAATCATAAAAATGTAGCATCAGATTATTACTCTACGTCACTTAT
TTGAAGGCAATGGCATCCACCACTTCACAATACATTTTTCTCCCCAGCACCAGGGAAAAT
TTTGACAGGCAGAATTACCATTTCATTCCCAACTAGAAAAACACTGACAAGCTTTAAAGG
ATGGTTTGGAAGAGAAACCATGGACAGCCGAAAGAGTAAATTACAGAAGGATGAAGAAAC
CTCAAGAGGTCTTAGTTATGGGGGACCGACGGCAGTAGCATCTAAGCACAATCCTTTCTG
TAAAACCCCACACCACCTGTGCTTTGCTTGACTATGACTCATCACCTAAACACAAATTCA
ATTCCACTTTTAAGGAGTTTGTGATTAAATGTGTTTTTTTTCTTATTTTTACTGTGCTTA
TGTATGATTTTCCATCTGTCTCGGCTGTGTTCCTTGTCCCTTTCGGTGGATGTAAATGAT
ACGGTCGGTCTTTCGTCACACAGTGCTTTTTTCCAAGGTTGAGTGAAAGTTGGTGGTTCA
GCTTAAAGGAGCGGAGGGTTTGCAGTGATGTTGACGTTGCTCACCTGCCATTTTGCAGAC
AGTAGAAGAGGAACCTCTTCCGCGTGTACTACCATGTCCATGTTATGGTGGTGCCAGGGC
TCAGAGGGGTGCGGTTCTCACGCTTCGGGTGCTGCCTGGATGATTCTAAAGAACCGTAAC
AGAAAACACAGGAGATTTTGACCAGCCTCAGGTCTGTAAGTACATTTTAAACCCACAAAG
TTTGAGTGTGTTTGAAATGTACTCAAATATTTCCTTCTTCACCATTGTGTCCTCATGACC
CATTGAATCATCAAAGGCTCAGAGATGAAAGGAGGACTTACGGTTAGAAAATGGAAAGGA
CTCTGCTGAAGGGGGAATGGTTTGTTGTATCTGCTTTTTTTAATCCCAGAACAAATAGCT
TTAGTGAATAATTTTCTGCCAGAGTTTTCAATGTAATGAATAACGGAGCTTCCAGAAAGA
TATTTTTTAAATAAAGCAAATAAGCTCCCAATCCCAAATAAACCCACAGAAATCAATTGC
AAAATCCCCAAAGTGTTTCATGAGCCTTGAGCTGCACTCAGGGCCAAACACTTCCCAGAC
CACTGACCTGTAGGGAATCAAGAAAGAACGCTGTCCCTTCACAAAACGGCAGTGACTGCT
TTCTTCAAGTTATATCCAGCATACAGTAACATCAGACTCGTTACCATATTTGACTGAAGA
CAAGGCACCTTACGTACCCAAATATATTATAGTACCCTAAATTGACACTGAGAAATCAAA
TTCATCTATAACATAAATATTCTGAGCCAATGAAGCTGCACCAAAGGAGGACTTACTGAG
CTGGCACAAATGTCTAATCATTGTATTTGCAATAAGAGATTTTTACCTTTTCAGAAATGG
CTGTAATTTGTTTTGGAGATGAGTTAATTTCCACCAGGTCAGAGTGAATCCATTGAATAA
GGACACCTGAGGACCTTTAAGCCTTTCTCTCCCACAAGATGGGTATGGAGGTGGAACTGC
CCACCCTAAAGAGGGTTTATTGACTAAATATGAACTTCACATAAAATGTATTATTTTCAA
CCTCAGAAATATTTACCAAAAAATCAGGGATCACGATCTACTGGACAAAAGGAAAACAGT
CACAGCCCTAAAAGCTGGAGAAGACCGGGCCATACTCCTCGGGCTGGCCATGATGGTGTG
CTCTATCATGATGTACTTTCTCCTGGGAATCACCCTGCTGCGGTCCTACATGCAGAGGTA
ATTTTGGTGCGGTTACCCTGACCTCACACACACTGCTCCAGCTGACTTATCATGGCTTGT
TCTTATGACTGATTTTAGTGAAGTTGCATAACTTCTCTTTCGGTCAACATAGATCATATT
CTGCATTTCCTGACCCTAAAATAAATTAGGCATAACGACAGGGAAAGCAAGCTGAGCAAT
GCAGGCATAAGTGAGGGAAAATTTAGATCCCTGTTTGACGAAATCTGATCCATAGGCTTT
AGCCTTGCCGCAGTTTAGCACAACCATAATATCCACATCAGCTGTTCTGCTGACTGCCGA
ACCCTGTCAGCCCCCCAGTGCTTTGCTACAAAGCCCAGACAAACTCCAGAGAGAACAAAA
GTATTTAGCAGCCTCGAGAAACAATGCACTTCCAAATGAAAAATGGAGAATTAATTTGGA
AAGAAATCCAGCTGCTTTGGAGCATGTTGTTTTCCATGTGGGTTATTGCTTTCACGTTTA
ACAAGTGAAATCCTCCCAAAACACAGCGATTTATGAAAGTGAAGTATCATATTTCATCTT
TATTACATTGTACTTAATTTTTCCAAGGCCTTCTCTGGCTTCCTTCTCTGCTACAAAGCA
GAAATTTTGGCCTGTAATACATATGCAGTATTTGAAAGCAGATTTCAAGCACCAGCCCTA
TTCAAAATCCATCCCAGACAATAATAAGACTGTCAACAATGCTTTTTTCCACCCCAGTCA
GCAAAGTTAGGGGAATAAAAAATATGTAATTGTGGATCAAAATGGTGATGGTCTGCGTGC
CCCAACTGAGGCGCTGCCCAACCTTGGCATACATTGGCTTATCCACCACAGGGTCTGTAA
TAAGATATCCACAATAAGTGCCAAAGTTAACTGGTATGAATATCCTCAATTATATCACTG
CAACCACTGAAAATCATTCCTCCTTGACCCTGCCATTATAAGGAAAAAGAACCATGACAC
ATGAGGATGAACTGAATGCCAGCCAGCATCTTATTTGTGCAATAAAAGTATTTGTCCCTT
CTTAAACCCAAGCAAAGTTTAGATTTTTGGAGACAGGGATCGAGGCCTTTTAAGTATCTC
AGAGTATTTGCATTTCCAAACTGCCCTCCCAGACCTTTCAGCAGTATCAGGGTCAATTGC
AGAGGCTGCTAAGGTCAGAATTGCTCATCTGGAAAGCTGATTTATATAACAAACTATGTG
AAAAAATGCCTGAAGCACCTATGAAGTATCAAATATTCCAACTTCACAAGTCTCCCGTAG
GTAGGTGTTACATTATTACCCCCACATGTGAATAAAACAGCAGTTAAAGGTAAAAGTGAG
AAAAAGTAGAGTTTCTGCAGGTTTCTGCTTGCGAACGCCCATACCCCAACAATGAGAGGT
TGTCCTTCTCCTTAGCTGAGCTGGATGCCATGGTTAATGGTTGAGGCTCAGCTCATGGCA
TCCCATCGCACAGTCCCACTTGAGACATGCTCCCCCAGAGCACGCTGCTCCATCCCCTTC
TCTGCTGACTCCTTTTGATCTCAGATATAACTTCTTCAAGCCAAGTCCCAGTTCGCTTTT
CATCTACACATAGAAATTAGTGGATAGGGATACCTTCCCAAACATTAGGCACTGCAGAAT
AACATGAGAAAGTCCAACCCTGGCTCAAAGCCCTTCAAGATGCCCCACATATATCCCCAA
AGGAAATTCCGAGCTGCAGTCAGTGCTTATCACCCATTCTAGCCATGCTCTGACATCTCC
TTTTTTTCTGCTTTAGCGTCTGGACAGAAGAAGCTCAGTGCTCGCTTCTCAACGCATCCA
TCACCGAAACCTTCAACTGCTCGTTTAGCTGCGGCCCAGACTGCTGGAAAATCTCTCAGT
ACCCCTGCCTGCAGGTGTACGTCAATCTCACTTCTTCTGGCCAGAAGCTTCTGCTCTACC
ACACCGAAGAAACAATGAAAATTAATTCTGAGGTAGGAGCACAGAATGAAATTTCTTCCT
AAATGGATTTCTGGAAGGCTGCTCACTGTGTTATAGCCATTCCTTGTTTAAAAGTGATAT
AAGGCTTGCAGCTCCTACCTCCCTGGTAAATGCAGAGCAGAGAACAGTGCCCAGACAGAG
CTTCCATCTCTGAAGGGGGACGTTCTCCTCCTCCACACCATGCAGACAGCACATCCTGCA
TAGTGTCACAGTCCTGGGGCTAGAGCCTCAGTCTTTCATCACACCCCCCCACCCCAGTGC
TGGGGTCATGGATGGTGCAAAGATGCTGAAGGTTTACAGAAAAGAGACTGTCAAGATAAA
GGATGGAGATAAAAAAAAATAAAAGGCAGACTAAGACGCCAGCCCATTTTCTCACACCAT
TTCCCCAATTCCAGACTTCAAAACCAGAAATATTTTTAACAGAACAACTCCTCTCTGCTT
CAGCAAGTGTGACACCCAGTACGACTCAGTCCAGGTGGGACGGAGACAGCTCCTGCCTGG
AGGCTGTGATGCAGGCAGTGGGTATACAGGCAGCAGGCGCACAGACGGCACACAGGCAGC
ACCGCTCGCTCACAGGTGGCTGTGAGCCACCTCTGCGATGCTGCATATGGGCTGTGACAC
AACCTTCTCCCATCTCCCCTTCCAAACATCCCCAGCACTGGGTGCCAAAGACCACAGGCT
GCAGCAAGATGGGATGCAGCTCAGTCACAAAGCTTTAACTTCTTAGTTATCCAAGGTCAC
TGAACCCCAAACTACAGGCGTGCTGCAGTCCGCAATGGCAGAGCCCACGTTCAAGCAGCT
GACAGCGTAACCTATTGTATTTCTATTTATGGCAGCAGTTCAGGAGACCAAATTACTTCT
GTATATTAAGATGAAGTGATATTAAAATGAGTCAAAGCACCGAGTGGTTGCACAGGGCTG
GTTATTCTGCTGGATAATTAGCTCCTGTGGCTGAGAAACGAAGTCCTTTGGAGTTGAGGT
GTGAAATGCAGCAGTGTCCCCATTCCACCCCAACAGCATAGAAAAGAGGCACCTGCAGCC
TGTTTCCCAGCGCCCAAAAGTGAGGGCAGACTTGGCTCTCCATTGGGACAGAAGCAAAAT
CCAGTGATTTGATTAAAACAGATGAGATCAGTCTCTGCACTCTACTGGATTCAAGTAAAT
CAGGAGGTTTAGCATAAATCTCCACATTCTGCTACTGATTTTTGTTTGATGAAAACAGAT
TTTGAAATTCTCCCAAACACCTCCACCTCTTAATTTAATGTGGGCACAGTTAATGCTCCT
CCAACCCAAGGTTGTTTTACAGGTTAAGCTCTGCTCTCAAGAGGATTCCTAGGTTTTCCT
CATGTGCTGCTGGCTATGTGACCTGAATCCAAACACAGTTTTCAATGGACGCTCGCCATG
TCTGTAAAATACCTGGCTGGGATCAGCAGAGCCTCCAGGCTTCAGGCCAGCACAGCCCAT
TTCTGTAGGGATCCCCTCCTCCCAAACTTCTTGTAAGATCTGCATTAGGTGGCAGAGGCT
CTGGGACAATTCCTACTGCAGATCTTGGGGGATTAGGAGAAGGATGTCCCATTTCAATCC
CAAGGATTATCACAGCCTTAGCACAAGGCATGACTACAGACTAGATAGTGAGGTATTTTC
CCAAAAGAAAGAGAAAGTGCCCAAAACCCCACACCTGCTCAACCCATGCTCAGTACTCAC
CATCTTCTTCCTACTTCAGCACACCTTACCAGCAAATCCACCCCCACCCCCCACATCCAT
ATCCCAGCAAGCTCTTCACCCTGAGCAGCCACTGGACCATTTTCATTATTTCCCCCCTCT
TCCTCTACCCACCCCTACCTTGCAGGTCTGCATTCCCCATCTTCCTCCTCACTAAACAAG
CCAGAGAGAAGCCTGCCCTGGCTCACTGAGGCCTGACACAGATGAGGATGCACAGAGATG
TTATACACCAGCACACACGACCTCCAAGAGGTCCCCCTGCCTCGCTGAGCACCGCCACGC
ATGCCAAGCAGCACCTGCAGCCCATCTCTCCCCTCTTGCCAGCAGCAAAATGAGCAGAAT
GCACTTTGATTTTAAATAATGATTAATCTAGGAGACTTGCTACCTAACGGAGCTGCTGTC
CCACATGGCGTGGTGAGGAACAGGTGCCATTTATACTGAGACATACGGCGTGTCACTGCC
AGTCTCAATGGGAAGTAAATGGATGCCAGCTGAGCTGCTCAAGCCTATCCCAGAAAAGCA
TCCACAGTTTTTCATGGCTTGTCATTGCTCTCACTGTCTGTACTTTAGCCTTAAGGCATG
ACCAGCTCCTTGCCAATACTACAGTCATGGCAGCTTAAATATTTCCACGGCTATACTTTT
CTTACTTGGTTGCCATACACTATAAGAGTTGACAGGGGAGGTACGCTGGGCAGTGTGCCC
TGCACCCAGAGCCATCTGCCACGCCAAGGAAGTGCTGAGCAGCTTAGAGCAGTTCCAAAA
GCCCCAGTTCCATTCCATACTACATCATCTTGATTCCTTTCCTGTCACCACTGGTTTATA
TCCATGCTTCGTAAGTGAGGTAAGCAAGCAGGTTTGATCATCAGAAGCAGTGATGTACTT
GCCCAGAGTTGTTGTGCGGTCTCCATCAATGGAGATACTCACAGCTTGACTGGTCAAGTG
ACTCTTCACTGAGCAGGGCTTTGGGTTGGATGTGTTGAGAGGCAGATAGCCTGTACAAAC
TGCCCAGTCCTTTAAATTAGAAAAGTAGGGCTGGAATCTAGCAAGTTCTCTTTACAACTA
CCTAGTGTGTGCTCTTTGTGATCAGATCGCTAGTAACACAAGAGCCACTTTTCCCATGTT
TTATCACAGAATTCTTACTTGAGACAGATGTCCAGACAAAGTTTACTTCCATACTTGCAG
ACCTCCAGGTGTTTGGCAATGCAGAATTGTAATAAAGCAGCGCAGCTTTAGTAGTTTACA
TTCACAGACACAGCATAAGAATGGCAGATATAAAATTCCCTGCCAAGCACTGTAGAAAAC
TAAATGACAATCAAACCAAAGAAAACACTGCAAGCATCCCATTATCAGCATCTGCCTCCC
TGCCTGCCCGTCACCTACGCAATGCTCAGAACTGAAACAAGGACGTTAGCACATGGAGCG
AAGGGCACCCGTTATCTTGAAGCATGAGGAGAGATGATTTTGGCACGAGGAGCCTGGCTG
TGATGCAAAGCATATCAATCTCCCCTGCATGACTGCCTTCCATGGTTTCATCACTTCAAA
CCCGCTTGGCTCAGGCAGCCCAACCAGCCCGACACGGCCGGTGCCTCCGTGTAGGAGGCA
ACAGCTTGAGTTCTGCTTCTGCATCAGGTCTGCTCCAAAAGTGTTTGCGGAATACTCAAG
CCTGCAGGAAGCCAGGATCTACAGAACCTCCCCACTGTGCTCTGGGGACATTTTTGTAGA
CCCTGAATCCAGGAATCTGTCATCATTGGGGCTTTTACATGTTTGCTGTTTTCTGTCAAG
AGGAGAGGACTGTGCAACAGCAGCCAAGTCCTCATTCAGTCTCCTCTCTCAGGACAGTAG
CAGCTGCAACTTCAAGGAACAAAAATATCTCACACCAAATTTGCAATAAAAAAAAAAGCC
AACAAAACATCAGAGCTGGAAATATTGCTGCTAGGACAGTGATAGCATGATTCAGTAAAA
GAAAATTAGGTACAGCTTCACTGACAATTTTCCCCTACTGACTAGATTATGATCTATTAA
AGAGTCACAGACACTGGAAGAGGGCTTGCGGCTTTGGACATTTAAGACAAAGCTGGGCAG
AGTGCAAGAGAATATCCTGGGGGGAGCAGCCCCGCACCAGCAGGAAGATGGATGAGATAT
TACTGCCCTGATATTTTCCATCTTTAATTTCTAGAGCTCTATGAAATATTCATTATGGCA
GGCCGACATGCTCTACCCTTAATGCTGCAGTCGGCTAACTCCAGACAATCTTCCTGCCGT
GCTCCAAATCACATTCTGGGCTAATAAACTTGCCAATGAATCAATCAAATCCTGTTATGA
GGTTAATCCTTGAATCGTTATTAGGACTAGAGATTTGTCTCGGTACGTTATGAAAAGTCA
CAGCATAGTCATGAAAAAGAATAGAGGGACATTTATAAAGTTTATAACTTAAAACAATAA
TAATAAAAACCCAAGCGTTGCATTAATTTAATAAAGATGTCTCTTTTCCTTTGAAAAACT
CTTGCTGTCATTAAGTTATCTAAATTTAACCATCACCCCATACAAGCAAGATCAGCAGTG
CAGGCAGGAAAGCATGGCAGAACCCAAGAGCAAGTTAAGCAACAGCCCAAGAGCCAGAGC
TGAGCTCCAGCAAGAGGTAAAGCCACTAGGAAAATCTGCATTTTATCCTTGGCTTTCTAT
TTGTCCTTAATTGAGGCACTGCCCCTGTTGGAAGATTCGTATTAAGGTTTCTTGTTGGCC
TTTCCTTCTGTGAGTGAACTCCCATGACTACTGAGATCATTTTGATCCCATACGAGCCAG
ACCTGAGCTGCCAGATTTGTATTTACAGCAAGTCAATTACCCATCTCGCTGCAAGGGTAT
GCATGCCACTTAAGATGAAGAGGTGCTTCATCAGTTTCATTTTTGCATGTGTAAATTAGC
AATAATAATGTATTCACCTATCTCACGAGGCTGCTGTGCAGATTAAAGCATTAATATTTG
TACAGCACTTCCAGGCTCTCCAATGGGAAATTCTGTAGATGTACAAAATATTGAGTTTTG
TCTGGAATAAATTTATTATTAGCTTAATATTATTGCACTCTTATTATGAAAAGCATAATC
ATCTTGAGATTTCCCTCCTTGCCACCTGAAAACAGACACTGCATCTGGTTTGGAATTGCA
TTTTTCTCCCTCTGATTTCTCCCCAGTGTTCGTACATACCCAAGTGTGGCAAGAATTACG
AGGAATCCATGTCAATGGTGAACGTTGTGATGGAAAACTTCCGAAAGTATCAACGCTTCT
CCTGCTTCTATGATCCTGAGGGCACTCAGAAGAACGTGATATTGACCAAACTGTACAGCT
CCAACGTGCTGTTCCACTCGCTCTTCTGGCCCACGTGCATGATGATCGGCGGCGTTGCCA
TTGTTGCGATGGTAAAGCTGACTCAATACCTTTCTCTCCTCTGCGAGAGAATCCAAAGGA
TCAACAGATAAGAATGAAAACTCCTCCAAGAGTTAATTACAACTAAAATACTGTTTTCTC
ATTCTTCACCAAAGAACCTTAAGTTTGTAATGTGCAAGTCTGTTATAAGTTCCTTACTAT
GTACTTATAAGTAGAGCAATAATGCAAAAGCTGTTCTATATGCAAACATGTTATTATTAT
GCAGACAACCGAAAAAATTACTGTTTGAGTTGATCATCTTGTTTGACGCTGAGACTTGTA
CTTCTTTCTTTTCTACAGCCAGAATTGGGCTCAGTGTGACCATTTGCCAAGCTCAGTCAG
TTGACTTTTTCAGTGTAAAGAATGCTGGGGAAATTCACGCCTGGACAAAGGGCAGCAAAT
GACTTGTGCACCACTGAGGTCTCACCTCTGGCTCAGCCCTGCCAATGGATTTCTGGTTTT
GCCTTTTTACTATTGGCTGCAGGGGAAAAAAGTAGGGAAACAAAACAGAGGTTTTTCTAT
GAGCAGGTGGCACCACACTGACTACTGCGAGGCCAGGATAAACATGAGTATTTTCTGCCT
AAGTAGGACTTGGTGATGCTGTGTGTTAGCTCCCCCAGTTCAGAAGTAAATTTTACGCTG
TGGTATGTACAGTCTTTTGCAAAACACTTTGGAGTTTTATTTATTTAATGCTGTATTTTC
CTTCTGTTTTACCAACAGCATCTTTGTCATCTGCAGAAGCTGTAGCCAAAAAAAAAAAAA
AAGCAACAAAAAAAAAACCAACCAACAACAAAAATCACCTTGTTCCATTTTCTACTTCAG
TCTGAGCCCTGCAGATGGAGACGGGACCAGAACACCTTATGTAAAGGTTTATTACTCATC
TGTCGTGTATTTGCTACCATATCACTGTAAAGAAAAAGTAACACAATCAGCTATTTTTTC
ATTTTTTACTTCCAACTATTTTAGATTTTTTTACTTGATATATATACAGATATATATATA
TATATATATATATATAAAAAGAAAAGCTATATTATATCTAGTTGTGTATCAGAACTTGAT
TATGGGGTGGTGGCTTTTTTGTTTTTACCAGCTGAGAAGTGAACAACGTAACTCATGTAT
TCATAACCTTCAGCCTTGGATAATATCATAACGTGGAGGAGCGGCACTGCAGGATGCCAT
CCAATATTCATGATGTTGTGTCAAGCAAAGGTCCCTATTGCTGTAACAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 128356..128466, 133386..133556, 135310..135511, 140426..140888
128411..128466, 133386..133556, 135310..135511, 140426..140707
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved