Gallus_gallus Locus IF4A2_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus IF4A2_CHICK
Gallus_gallus
IF4A2_CHICK
9
SNORA63
4995..5122
8878
GGCAGCACCCGCTGCCGCTGTTTCCTTTCCTCTCTGCCGGCCCTTCCCGCCCCCAGCGC
GGCGGGTCGCCCCTTCCCGCCCTCGGCGTGAGGTAACGCGGGGAAGCTGTTCTGTACAGC
GGGGGCACTTCTGTGTGTGGGGGTCGGGGGGCGAGCCCCGCAGTACCCGAGGGAGCCGCT
CCGCCCTGCCATCCTCGGACTCTACAGAGAGAGCTTTAAAAACAACCGACGCGGTACGTG
CGCAGAGCACAGCCATGCTGCGGAGCGGCCCCTCAGCACGGCAACCCGCGCTCCCCTCCC
CCGCGCTGCAGCAGGGCCAGGGTGGGAAACCCCGTACGGAGCGGGAGGGGGGGGTGAGAG
GAAGGAGCGAGGTACCGTCACTCCGCCACTGCTGCAATATCCTTCCGCGCGCCGAGGGGA
GGAAAAAGTAGTCCGAGGCTCCGCCGCCCTCGCGGCTCCTGAGGGCCGAGGAACTCCCGC
TGAGAGCACCTCCCGGGCCGGGCAGAAGGGGATCGCTCCCGGAGGGGCCTCGGTCCGCGG
GAATTCGCGTTTTTTCCCCGCTTTGAGCGGGCGAAGTCCATGACCAGATTGGCGCGAAAC
GAGTCCGCCTTGGCCACGGGTAGTAAGGCGGCCGCCTCGGACTCTTTGCCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCGCGGTGAGAGGCGTATATCCATGCGCAGAGCGGAGCGAAACGAGTCCGG
CAGCGGGCGGGTATATAAGGCGGCCGCCGCGGAAGCTTTGCCTTTTCAGTTGAGGACAGC
GCTGGTCATCGGAACATGTCAGGCGGCTCCGCGGATTATAGCAGGTACGGCGCGGCGCGG
AGGCCCCGGGCCCCTTCATCGCGCGGGAGGAATGCGGGCGGAATGCGGCGGAACGCGCTG
CCGGCCTCTCCCGGCCCCTCCCGCTTCCAGACGTTTCCATCCCGCGTCCCCACTGCGTCC
CCCTCCAGCCGGGGTTGAGTCCTTTCCCTCGGGCTTCTCGTTCTTACTGCTGATCTCCTT
CACAACTCCCTATCTCTAAAAAAGGGCTGGTTTTACTTCCGATCCAACCCTGTGCGCTGC
GTGATGTAACAGCAGCGCTTTTGTTACGGGTACTTATTTCCCTTTTTATTTTTCTCCACC
GATTTCTCCCTTTCCCTCCGCGGGCCCCGGCTTTGAGGCCCGGCGGAAGACGCGGCCATG
TCCGCGGCGCGGGGCTGAGGCGCGGCCTCGAGGCGCTGTGCCGGCGCCTTCCTCCCTCGC
CGCCCGCGGTGCCCGATTTGCGCAATCCCAGGGGTGGAGCTCTCGCGAGACTTGCTGACG
CGGACGGGTGGGGGTAGCGCAGCGCGGCCGGCGGCTCCCGCTCCCCCCGCCCCCCTTCCA
CCCCCCCACCCCCCCCCCCCGCCCGCGCTGACGCCCGGCGCTGCGGCGGAGCTCGCACTG
CGCGGCGGCCGCCATTTCCCCGCCGCCTCCAGCAGGTGCCCCGGGGAAGGGGGGCGGGAG
CCGGGGGACGTTCGTCCGATGGGCCGAGGGTTCGGGCAGAGCGTCGGGGCGGCCGGCTGG
CACGGTACCAGAGCACCTGCTGGGCCGATCCGTCACCGGCCCGTCGCTAACGCTGGCGTT
GTTCTCCCACAGAGACCATGGCGGCCCCGAGGGAATGGAGCCCGATGGTGTCATTGAGGT
GAGCGGAGCTCCGGAGCGGTCCCCGATGGAGGCAGTTGGGCCGCGCGTGGAGTAACGCGG
GTTTTTTTCTTTGTTGCAGAGCAATTGGAATGAGATTGTCGACAATTTTGATGATATGAA
TTTAAAAGAATCCCTTCTAAGGGGCATTTATGCTTATGGTTTTGAAAAGCCTTCGGCTAT
TCAGCAGAGAGCTATTATTCCATGTATCAAAGGTAGGCGAGTGATTGCTTCACCGTCGGT
AGTAACGCGTTAATCCAGAAAACGTTAAAAAGTGAATATAATGCTCCTTTTATTTCTGCG
TTTACACGTGTTTTTAATCTCTATGGAACAAGTGATGTGATGGTACACCATCTTTCGGGG
CTGACCTGAAATGGAGAGAACTTGTAATGCTGATCACTTATTTCAAAGGGAATGAAATAA
AACTAAACGTGAATGACCTGTGTGGGAACAGTAAACGTGTATCCTACTTTTTTTAGGGTA
TGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCAT
CCTGCAGCAGTTGGAGATTGATCTCAAGGAGACCCAAGCACTAGTATTGGCCCCTACCAG
AGAACTGGCTCAACAGGTATTGATAGTGTAGTTAAAAAAAAAAAGCTGCTTGTGCGTTGC
ATAGGTTTCAGGTTTCACAACTGTGAGACAATAAACAGACTTAAGGGGCTGTAACTCATC
CATTCAGAACCCTTTTCGTCTTGAGTAATGGGGGAAATGAAGTGGCTTCTGCCCCACGAG
TTCTCTGCCTGCTTGAAGGGTTGTGCTGCATGTGGAGGGTGTGCTGGGGCAGGGCTGCAG
GAAGCAGCTGCTCTGCTGCGCACAGTTCTGAGGGAGCATCTTCAGCCAAAAAAAAAAAGT
GTTATTTAAGTACGGTGTTCTGAGTGGAAACAAAATGGGCTTTTTTGGAACTATTTAAAC
TTGCGTGCAGTTGTGCAACATGAAAACTGCAGTGCGCATGTGGTCACTTCATTGTCTCTG
TAATAATGTGATGTTTTCTTGCCTTAATGTTACATTGCATGTCCACCTCACCCTCAGGGC
TCCATATTCTGTTTTAGTAAGTGGGAGTACTGAACAGACTTCAAGGGATTTAAATTTTTT
ATCATTTATGTAACCCAGTAATGCTGGCTTTTTAAGGTTAAAATGACCAGACCTCAAAAC
AGAGTAGAAAATCAATTGTGTACAATTTGCCCTGCTTTTAGAACTAGTATATGCCAAGAC
GCCAGTGCTGTGGTAAAGAGTCTTCTGGAGGGTAAAACTAAATGTATTAGATAGACAGAG
AAGAACTCTTAAAAAATCAGTGGAGCAAGGGCCTCTGACTGAAGGTGTTTTAGTCCTTGG
TTTTTTAGTCTGAAGATGTTGCTGAGATGAGGCTTCTTTTAAAGCCTCTACAGATCAGAG
GGCGCTTTCCTAAGATCTTTCTGGACGTGCTTTATGTGCAGATGTTACCAGCTCAGTTTG
CTTCTGAGGCCTTGCTTTTCAACTTAGCAGATAGTTGGGAATCACCTTTAGGTAGTTAAA
ACTAGCAAGGATGAAAAAATAACTTCAGAACTGTCCCTGACTTATAGTTTCTAATGAACA
CCTAAATAATGGGCAGTAGGGCAAAATGAGAGACGGGTCTCTGTAGCTTCTAGAGCAGCA
TAATCCTTTTCAGTCCATAAGCAGCAGTGATACAGCACTGAGTGTGCCAGTAGCTGCTAC
TCACAGAAGGGTTTTATTTTTAGATTCAAAAGGTAATTCTGGCCCTTGGAGATTACATGG
GAGCAACATGCCATGCTTGCATTGGTGGCACAAATGTTCGCAATGAAATGCAGAAACTTC
AGGCTGAAGCTCCACACATTGTGGTTGGAACTCCGGGCCGTGTGTTTGATATGTTAAACA
GACGCTACCTTTGTAAGTATGGATTTGGCTTTTCTCTCAGTGGTACCAACTAATGGAGTG
TTGTGTGTTCCTGAAACTTCACAAAGTATTCCTTTTTATTTTTATAGCACCTAAATGGAT
CAAAATGTTTGTTCTGGATGAAGCTGATGAAATGTTGAGCCGAGGATTTAAGGATCAAAT
CTATGAGATCTTTCAAAAATTAAGCACTAACATTCAGGTAAAAATCTTCTTATCTGGTCA
AGTCGATGGGTGCAGATTTGGTTACAGGTATAGCTGACAACTGCTCAATTGCTGTCCTGT
CTGCCTTGACCTCACAGAAGGTCAGGTTGGTGCTGTGACATAAACACAGCAATGCAGTCA
CTGCTTTTGTTAATGGTTTCAGTTCTCCTGATTAGGGTGACTAGAGCAGAAACTAATGTC
ATGTCTTAGGTGTGTGCTAATGCAGAGCAATGCTTTCTAGGTTGTGCTGCTATCAGCTAC
AATGCCAATGGATGTGTTGGAAGTGACCAAAAAGTTCATGAGGGAGCCCATCCGGATTCT
AGTGAAGAAGGAAGAACTGACTCTGGAGGGTATCAAGCAGTTCTACATTAATGTTGAAAG
AGAGGTTGGTATCCGTTACACCTGTGATGGGAGAGTTCAGAAATGTTACCTTCTTGTCAA
AGCACTGTGCTAAAATTACAGAAGCTGAGGCTGAGCTTTGGGTTCTGTAATAATGCTAGT
AGAGTACACGCAAGAAGAAGAAAAAGGATGCTCTGGATCGAAAATGACCGGGGTGGACCT
CTTTCTTAATGTCCGTTGTCCTGTGTCAGAAGATCCGGTGCAACAGTTGCTGCAGGAACT
TCATGTATTGCTCTGGTTTTCCAGGTTGTGTTAATTATAAGTGCACAGTAGGGCATGGTT
TATTGATCATGGCTTTAGAGTTCTTATTCCTGTTGTTTCTGCTGTGTTCAGGAGTGGAAG
CTGGATACTCTCTGCGATTTGTATGAGACACTGACCATTACTCAGGCTGTTATCTTTCTG
AATACAAGGAGAAAAGTGGACTGGCTTACAGAAAAAATGCATGCCAGGGACTTCACAGTC
TCAGCTCTGGTAAGAGTTGTTCTTCCCACACAGCTTCTGAAATGGCAGCTACATACTGAA
AAGCAATGCTAATAAAAGCAGGATAAGTTATGATATAGCTGTGCAGTGCTGTATTATCGT
TCCCCCTGCTTAAAGAAAAATGTTTCCTTCTATCCCTACCTGCTTAGTTCCCACAGCAGG
TAGGGACGCTGGGTTTCATACATCCTCTTATTTCTGAAGATATTCTGGTCCTGGAGTACT
GGAATTCCCATGGTAATTCTCATGTTCTTAACTGCAGCATGGTGACATGGACCAGAAGGA
GCGGGATGTTATCATGAGAGAGTTTAGATCAGGATCAAGCCGTGTCTTGATCACTACTGA
CTTGCTGGTGAGTGTTGCCTCGCAGGGAACATGCTTCTGTTTCAATGTGGTGCCAAAAGC
TTCATAATTGAGTGAAGGCTCTTGTAGCCTGAACTACTGGAGCTTCTTGGAAGAGAAAAG
ACTATGCTCCACTATGGACTACACAGTTGTAGTTCGTCACTAACAATGTAGTCAACAAAA
GCATGTGATGAGTAACGTAATCTAAAGACGGTGACTTGCATTAAAGGTCCTGTATTGTTT
TCCAGGCTCGTGGCATTGATGTGCAGCAAGTTTCTTTGGTTATAAATTATGACCTGCCGA
CCAATCGTGAAAATTACATTCACAGGTTAGTTTGCTCTGTCCTGCAGTTTGTATGCTACA
CTGAATGCCGTGCTCTGTGCAGAACTTGGCACAGATCCTCACCCGCTCTTCCTGTTAGTC
TTTTGTCACTGAGTGTTACCCATCCGTGCATACAATAACTGCTAACAAAGGAGGAAAAAA
AAACTAGCAGGAAGTAAACGCATTGGCTTTTTTTTATGCTTGAAAAAAGCCCTGATTTGC
ACAGACAGTCCTGAGATGAGGGAGGAGCAGAGCTCAAGTCAGTTATTAAAAAGCAGTGGG
AAAACTTAGATACATGCAGAGTTCAGCAATGGCTGACCCATGTGTTGCTGAGCTGTGGGT
GAACTGCCTCTTTGTGTTCCAGATTGTAGCAGATGACAATGCCATTATTGGCATAGCATC
TTGACAGCAAGGTTGTTAGCTGGATCCTAGGTCCTAGCTAATCCTCACTTGCTCTACTGC
TGCTGCACAGTCACTAATGTTAGCAAGCCTAGGGGTTTAAATCTGCCTTCACTCCTGGAG
GTGTAACTGTGTTCATGTTCTGTGTGCCTTGTTTGCTCTCGGTGGCTCCTCCTGCAGTGG
TATTCTTTCCTCTGTGGTGTGTGTCTTCTGGTAGCAATTTGAGTTTTGTTTCCCTAGGTT
TAGTTTAACTGCTTCAGTGACTGTCCCTAAATTAAGTAAACTGTGCTTTGTTACTTGATG
TAAAAAAATACAGGAGTCGATAGCAGCAGTTGATGACACAGGATGGTGCTCAGAAACGGC
GTTGACGTAATTTAGGACGTGGATTCGTAAGCGGCACAGTTTGAATAAAGAGCGAGTCGG
TATTTATATTTCTTTTGTCATGACTATACACTAAGTTCTGTGAGCCATTTCTGTGTGTAG
CCCTTGTTGATGAAGTGATGTACTGGGCAGTCCACAGGAAGGTAGAACTGATGGTGGGTG
TATCTGAATTGATTGATAGTGTGTAACAGACTCACCCTAAGTTTTCCCACTGGAAACCAT
TAATATCAAATCAAAATCGAGTGTGCTGTTCCATGTTATTGGATACAGAACTTCAGAAGT
TCTGATTTTCAGAAGATAAGCTCTCTGTACACCACGTGATTGAGATTGGATGTGTGTGGT
ATGGGCTTTTAGTTCCTCGAGGGGAGGAGGGAGGAGCTAGCAGTACATGAGCTAGCACAC
TGTACCGCAGTACCAGACATTACATGAGGATCTTACTTTGCAGCCAAAAGTATAACCTAT
TCTGCTCTGCTACTCTCCAGAGGATGGACACTTCTTCTGTACTGTTGGCACTAACTGCTA
GTTTTTCTTAACCAGAGGTGACGTTGGTCAGCAGCTAGTCCTGTAAATACGGCATAAGGT
GGCCCCTGGCAGATAAAAACAGCAGTGAATGAATGGATCTGTTCATTTTTAAAGTACTGG
AAGTGAATGGAGTAGTTAACTCGTGTGTAAATGTGTTCTCTGTTCTGTGCAGAATTGGCC
GAGGAGGTCGTTTTGGCAGGAAGGGTGTGGCTATAAACTTTGTCACTGAAGAGGACAAGA
GGATTCTGCGTGATATTGAGACATTCTACAATACTACAGTGGAGGAGATGCCAATGAATG
TGGCTGATCTCATTTAATCCCTGGAGAGGAGATGGTTTGAATGCAGTGCTCGCTGTTGCT
GAATAGGCGATTCACTTGCATTGTGCTTCTTTCTTTGGGGATATATTGAATCTTGTCTCA
ATGCTCATAACGGATCAGAAATACAGATTTTTGATAAGCGAAGCGACTTTTTGTCGTGAG
CTCTTGTGGGGAAAGCCATTGGCTTTATCCACTTTAGGGTTAGACTGTTGGGGTTGGGTG
GAAAGTCATGGGGTCTGTAAATTTTTTCTTTATTAGAAATTTATTTCCTAGTTCCATAGA
AGTGGTTGTATTAGATGTTCTTTATCATTTAATAATTTACTTATGGACTAAAAGATATAA
GTGCTGTATAAAATCAGCCAATTATGTTAAACTAGCCTACCTTCCTTTATTGTATGTACT
TACCCTTCAGATTGAATTGGAAAGGCCTTTCAAAATCTCAAAACTTTTATAAGAGCATTA
AAATGCATTTTTGTTTGATATGTATTTATTCAATAAAGTATTTAATTAGTGGTAAGTGTG
ATCTGGACCCTGTTGCTAAGCCCCAGCAAGCAAGCAATCATACTATTGTCTTAGTTAGGG
TTAAACCCAGTAAAATTTGCCATATTGCACATGTCTTAATGAAGTTTGAATGTTCAATAA
AATACTTCTATATTCACTTATATTGTAAGTCTTTTTCTTCAGTTGGTGGGGCGTTGTTAA
TGGGAGGGTGAGCAGCTACCTCACTTCTCCTATGCTTTATGTCTTGTAATACTGCATTCG
TTAAGTGGAGTAAAAACTGCTGTTTGGTTACCTGTTATGCTGTGAAAGCCTCAATGTGGT
TCCTATTTTGAAAGGCTAGCAGCACAGGCTCAAATAAGCTAATAGGTCACTCTCATGCTT
CTTTTAATCAAACCATGACTGCTTCCAACTGCTGAGCAGTTACTTTATTGTAAAAACAAT
ACAAAAGTAGGCAGGTCCCACCACCACCCCCAGGCTCACTGCTGGAGGAGTTATGTGTTT
CGTGTTAGCTGCTGCATCACAAGGGCACACAGACTTATCAACTGCAAGTATTCATCAGCA
CCATCTGCCAAGCATTTGTCCACTTCCTGCAAACAGAAATGAGAAGTTAAAACCCTTTAC
AAACTGCTGTGTTCAGACAGCTGTCTCATACTACAAGGGAGAGCAACCTGGCTAAGTTGG
GTACTCGTTTGGCTCCAAATTCTGCAGTGTTTGCACATCACGTCCCCTCAGACCACACGA
GGAAGAACAAGCTCTGAAGGAGGCCAACACTTCACAGTTCATAAATACAAAGGGAGATGC
ACTGTTTGCACTGCAAATGATGGGGTAGTAATCTGTTCTACTGGGGTTACACCAAGAAAT
ACTGGAAACTATAAATCAGAGCTAATCACTTTTCTCAAGATAAAAAGGGGGAAATTAACC
ACTGTAGACAAATAACTTCTTTCCCCTAAGACAGTAAACTAAAACTTACTGCAAGCTTCT
CGACGATGATAGATTTCTGCTTGTCACTGAAGTCTTCACTCTCAACAACGATGTCATGAA
GCTGGTTTACAAGCTGAGCAACAGCATACCCCTCATTTATAAGATTCTGTGTAAGGGTAG
CAGAAAATGGAAATAAAATTAAGCAGTAGAACACAGGAAAATGGAACACCAATCTGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1872..1917, 1999..2131, 2396..2535, 3683..3851, 3947..4056, 4300..4443, 4791..4928, 5197..5286, 5525..5604, 7072..7878
1035..1063, 1872..1917, 1999..2131, 2396..2535, 3683..3851, 3947..4056, 4300..4443, 4791..4928, 5197..5286, 5525..5604, 7072..7213
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved