Gallus_gallus Locus EIF4G1
snOPY snoRNA Orthological Gene Database
Gallus_gallus EIF4G1
Gallus_gallus
EIF4G1
9
SNORD66, SNORD66
10265..10341, 11475..11552
17697
GCCGTTCCGCAGCTTTGCCAACACATTGGTGGACATCTGTGCCTACGCTGGTGCGTTGA
GCTGACCGAGGCTGAGGGAGGTGGGAGCGGGACCTGGCCTTCTTTCTGCTTATCCTTGCC
CTCTGCTGACCCCACAGGTTCAGGGAACGTACTGAAGGTTCAGCAGCTTCTGCACATCTG
CAGCGAGCACTTTGACTCCAAGGAGAAAGAGGAAGATAAGGACAAGAAGGACAAGAAGGA
GAAAGAGAAGAAAGAAAGCTCAGCTGACATGGGGGCACACCAGGTAGGGAAACATGAGCT
GGAACCTGCAGCCCAGGCATAGGAGCTGCTCCGTGTGAGGTCAGACCCAGAGGCAGTGGC
CCTAGCAGGATGCTCTGCTCACACTGTCCTGCTGGGCTGTAAGAGATCACGTTTGGGGTT
GGTGGTCCCTGCCTGGCACTCAGCACTGGTGTCCCCGCAGGGTGTAGCAGTGTTGGGCAT
CGCACTTATTGCCATGGGTGAGGAGATCGGTGCCGAGATGGCCCTGCGCACGTTTGGTCA
CCTGGTGAGTGGCAGTGGGAGGACAGTGTGGGGCTGGGAAGGGACCTGGATGAAGAGGGC
AGGTCTTCTCTCACACCTCGGCCTTGGTAAGCTGGGTTGTGGATGCCCCACCGTGCCCTT
GCCCTTACCTGGAGTTTAATACCCTCTCTACCCCCGTTCCATGCAGCTGCGGTATGGGGA
GCCCACCCTGCGCCGTGCTGTGCCCCTGGCCCTGGCGCTCATCTCTGTCTCTAACCCCCG
ACTCAACATCCTCGACACCCTCAGCAAGTTCTCAACACGATGCTGACCCCGAAGTCTCCT
ACAACTCCATCTTTACGTGGGCATGGTGGGCAGCGGTAAGCCTGGGGCCAGCTCGTGCGT
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGTCAGACGGCACCTG
TGATTTTTACCCGACACCCCCCTCACAAATGAATACGCCTTCTCAGCCGCGACAGGTAAG
GGGTTTGGTATGGGAAGAGGAGGTTTTGGGGAGCTGGTTAGGGTCTGCGGCCTTCTGACT
GAGCAGCCCACACTCTTCCTGCTTGGCCACAGCAGTGCTGGGGGCGTGAGGAGCCTGATC
CTGCCCCATGGGGCTGGCGTGCACCTACCCCAAATCTCCATCGTGATGTCCCTTCTCCCC
AGCTCTGGGGTGAGGGCAGACAGCTCCTGCAGGGCACCCACCAAGTGACCGCTCTTCTCT
CCTTCCTCCCCTTTCCAAACCTTGCTCGCTCCTCTCTCAGTTTCCAGCAGGGCCTCGTGC
TATTCACCAGCAGGTACTAACCAGTCCCTACCCTGCATGCTGAGCACCCGGGGCAGCCCC
AGAACCTGGCACTGCACAGAAACACTTGGGGAGCACGTGGGGAGCTGCACCGAGCCCTAG
GGGGGAGCAGGCTGGAGGAAAGAGGTCCCTCTTTCAGTGGGATCAGCTGGAGGGGTTTCA
CTGCAGTGTCCCCAAGTTCCTTGGCTGCTCTTGCATGAAGTCTAGTGCATGTGGCTGTGC
CTGTGCTAGTCCTGGCCCAGGCCACTGCTTCTGCCTGTGCCTCTCTCCTCATCCTTTTAC
CCCTTCTCTCTCTTTGGGGGGGGAGGGGGGCTCTCCTGAGGCAGCAGCTGTGCCACGCTG
TGGCCTGTCCCTGACCAATGCAATGCCCTGGGAGCAATAGTGACTTTCTGCAGTGTAGCC
AGCATGTCCCTTAGGCTGTGGGAGGCTGCAGAAATGGTGGGGCTGGGACCTGACAGGTCT
TGGTGCCCTGCAAGCTGGATGTGTCCCCTTGCATTCTGCCTGCAACATTGTGACCATCCC
TCCTGCTTTTCATGGCCCCTGGGAGCGTGAGCAAAGGTTCTGTGCCTCGATCAGCTCAGA
GGGACAGCTGGGGACAAACCTAGTGACATCCACAGTGTGCCGGGTCCCCCTGGCTCCATA
GGGACCTCCAGAGGGGCAGGCAGCTCCCCGCGTCCCCCAGCATGGGTGGATCTGGGATGT
GGCCATCATCGTGCTGGGAGCTCGGCTGCTGCTCCTCCATCCCACAGCACCAAGCTTGCA
CTACCACCCCTGTCCCCCTCCCACCACCCATCCCCTTGTCCCATCCCAGCGCGGCAGCGG
TAACTCCTGTCTCTCTCTTTCCCCTCTCCCTCTGTATGCGTGCACTTGCTATCAGGGAGG
ATTCAAGTCTCTCCAGGTAACGCTTTCTCCTTGCTTCAGCCTTGCCCTGCGCACCCGGTG
TGCAGACACCTCCTTGCCTGCTGCCTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCACAGTGGGACTGCAGGTCCCAGCA
TTCAGTGCGAGTGCCGGCCCCCATTGCAAGGCACGCCGGGACCTGCCGCTGAGCTGCGTG
CAGCCGTGGCCGGCTCCGGGCGCTGGCGCTGCCGGCCCTGTTGGGCTGGGAGTGGGCTGT
GCTGGGCATGAGCTGGGTCGGATGGAGCCAGGCGGCCCCCCCGCAGGTGCGTGGGGTAAT
GTGGGGTGCCTGGAAGGGGGTGTGTGTGGGGGAACTGCATCCTGGTGGGGGGGGGCTCCC
CTCTTTAAATCTCCGCCCGGGAGTGCGCTCTGTGTCTAGGATGAGTTTTGGGGTGATGGG
TGCTGTGGACCTTCTGCTTGGGGTAGGGAGGGGGCCTGGCTTGGTTGCCTTGGCACTTTG
GCAGGGGGGGTACTGGTGCTCTGGCCTCACTGTATCCCTGTCTCTCCCAAAGCATTTCTA
CCAGAACAGGGCCCAGCCTCCCGCCAGTGCATCCCGCGTGCAGAGCAACACAACGGCCCG
GCCTGGCCCTCCTGCCCATGTGTATCCAGCTGCTTCCCAGGTGATGATGATACCCTCTCA
GATATCCTACACACCTTCCCAAGGAGCCTATTACATTCCCGGACAGGTGAGGGCTGTACC
CCGGGCTCCGCGGGAGGGGGCTGGGGTGGGCCCAGGGTTGGAGCCCAAGTTTGTTCTGGG
GGGTGGAGGGGGTTACCCTGGTTCTCTGAGCTGTCCCTGGCTCCATCAGGGTGTTGTCCG
GCTCTGCAGAAGGGCAGCAGCCACGGGGTTCTGTGTGCTGACTCTGGATATGTGATGCTT
GGCTTGTGTCCTGTGCCCTGCCCTAATGGCACACAGGTATGGGGCATGCACAGATTTGGG
ATGTGCCTGTGCCCTGCTGGGGATATAGCCAACTTTCTTCTCCTCCGTTTCAGGGTCGTT
CCACATACGTTGTCCCAACACAGCAGTACCCGGTCCAGCCCGGTGCCCCTAGTTTTTACC
CTGGAGCCAGCCCCACAGAGTTCGGGACTTACGGTACAGACTGGGGGGATTACTCTGCTT
GCCATTGCTCTTCCACCCACTGCGCTTCGTCCCTTTTGTTCCCCTGATTCTGGCCTCCCT
GCAACCCCACAAAATCCCTCTTGTCTCTGGGCTTGGTGAGGTGCCTTCTGTGACTGCTGA
TACCACTATGTGTTGTTTTGGGATTCTGGGGGTGCTCTGTGTCTCCTGATGCAGCCCTGA
AGGCTGTGCATCGTGTCCCATCTGTCCACCCACCTCTTTCTTTTCCAAATCAGGATGGAT
TAATGTTTAACTGCCCAGGCAGAGGGACAGGGCAGACTTTATCCCCTTTTCCCCTCGGCT
TGCAAGCTGGCGGAGAGCAGTTGTTTGGTGCTGCCTCCCCTCCCTGAACCAGCTGCCTGT
CCTGGGTGAGCAGGGTCTGGGCAGTGGCTGCTCCGCGCCTGCCCTCTCCTGGAGCTGGGG
AATGGTGGTAGAAGCAGCCCCCCCTCCTTCCCCCGGCTTGTATGCGGCTACCCGGGCTGT
GACTATATTTAGGCTTAGTCCGTCCCGGGAGGCCTGGTAGACACAGAAATGTGAGCTGAG
GCCTCCGTCCCGTCCCCGGTATGGCAGCAAAGCAAACCGGGGCGGAGAGGGGTTTCTCCT
GAGCCAGGTACGTGTTTGTCCTCCCTCCCTTTTATCCCATCAGCCCCTTAGAGGGAGGAG
GTGGCCCCAGGCAGTGGCCAGCTGGGCCCAGTCCCAGCGCTCAGCCCAACGCCTTACTGC
TCCATAGCGCCCGGAGCCCTGCCTTGCTGGGTGTTTTTGTCCCCTGGTCTGCAGTCTTAG
GGTCTCCTCCTTCCCCGTCTGCCTAGCTACCAGTGGGGTTTGAGGCCCTTCTGGTGCTCC
CCCAGCCCACCACTGGGATCCTCTTTTGTGGCTTCATTGCTTTCCCAACATTTGGCCCCA
ACCGCATGCTGCTTCCCTGGGCAGCCAGGCTGGCTCTGCTTCTCGTGTGGGTCACCAGAA
TGGGGGCAATGTGGCCATCAGTGCGTTGCTGAGTGAGTTCTGTGTTCAGTGTAGCTGGGA
AATGCTAGCGCTGGGAGGAGGCTAGGGTGCAGCTGCCCCTGTCTCTCCCTGTGCTGGTGT
TGCAGTCACTCCCTGCCTGGGGCACGATGCAGCCCTGGCTGATGCTAGCCCTCCCTGAGA
TGCTCATCACATGGATGGCTTGGGAGGAGCACGGCACCTTTTGGGGGCTGGATCAGGGCC
CGGTGCTACCTCCAGCCCTCAGCATCGCTCGGTGCTATGAGCTCAGTTCACGGGGGTCTG
AGTGGGGAGCCCAAGAGTGTGAATGAATGGAGGGCGTGGATGGGGCTGTGTGGAACCGCC
CTTAGGCTGCTGCTGGCCCAGGAGAGATAAGGGAGCTCGTAGGAAGGCAGCACCCCTGGA
ACCAGGGCTCCTGTGCCCAAGCATGGCTCAGCGTCCCAGAGAGACTGGTGGTGTCCTGGA
GCCGGTGGGCACGGCTGGGTGTGGGGGCGGCGCAGGGACGCCGCGTGTCATGGGGAAGGA
ATTTAGTCAGGCCTGTCGGGTGGGTTGGGGTGATGCAGGCCAGATGCAGCTGGGGTTCTC
TGCAGCGTGGTGTGAGTTCCCCCAGCTCCTGGCAGTCCCCCTGCCTTTGTGGGAGTGGGA
GGACTGGACTCGGTGGGTGCACACTGGGCACCTGCTGCCTCTCACGCTCTCTACTCTCCT
CTAGCGGGTGCCTATTACCCGGCCCAGGGGGTGCAGCAGTTCCCGGCGGGGGTCCCCACT
GCCCAGGTCATTGTGAGCCAGCAGCCACCGATCCCCCCAAAACGAGAGCGCAAGACGGTA
AGGAGCCATGCGCCTCTGGCATGGGGCAGATGCATGCTGGAGATGGGGATGGTGCCATGC
CTAGCGTGGGGCACGCTGCCTGTGCCGGTTCTTTTCTGGCTGCCTGCTGTGCTCGGTGTG
CAGAACTCCAGCTGAGGGTGGTATGGGGCTGTGCACCTGGGTCGGGGGGCTCAGTGGGTG
CCGACGACCTTGGCTGTCCCAGCGGGCGGCGTTGTGCTGAGTCATGGCTCCGGGGGGGCG
GGTGTGCCGCGGCTGCCAACTGCTGTCTGCTCCCGGAGATGCTGGCGCTCAGAGGCCTTG
CGTGGGGCCTATTTATAGCGGGGAGCCGAGCAGCTGCTGGCCCCGCACTGCACCGCAAGC
TGGGGGACAGGGGGTGCTGCTGGGCTGGGGATTTCTCCAGGAGTACTGATGGAGAGGCAT
TGGTGCTGCTTAGGCTGGTGCTCTTGTTGGTACCTGGCAGCTGGTTCTGTTTGCAGATGA
GCGAGCGAGAGCCATGCCTCCTCTGTGTACTGGACCCACCAGGGTGTATTGCAGCTTGTG
CTGCACCCACACTGACTGTAGGGATGTGGGGTGCCTGCAGCGCCTTTACCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACACAC
TGCTGTGCACCATCCCTTCTGGTCAGGCAGTGGGATAGCACCCTCTCTGTGAGGCTCTGT
GCCCTGTAGGGAGGGGACGTGCCACTGGCTGGGTGCGCCCTTGGGTGCTATGTTCCCCAC
CCCCACTGACAGTTCCCCTCTCTCTGCTGCTCTGGCCTATGGACAGATCCGGATACGAGA
CCCCAACCAAGGTGGCAAAGACATCACTGAAGAAATTATGTCCGGAGCAAGGACCTCATC
TACCCCCCACCCCTCCCCAGGTCGGTGGCCCCCATTTTCCCAGCTGGGGTGCTGGGAGAT
GCATGGTGTCCTGCTTAACTCCCTCTTTGTCCCCTTAGGCTGGAAGCGGTTTGGAACCCC
AGGCCAATGGAGAAACCCCTCATGTAGCAGTTATTGTTCGGCCAGGTATGTGCGCGCATT
GGGGGCTGGCTGTGCCACATTGCTCCCTGGCACAGCTGGTGCCAGGCCCCATGCCAGCCC
CACAGATCACTTGGGGCTTGTGGGGACAGACGTGTTCCCTGTGTACCTGGAGACCAGTGT
TTCCACTGTTGGTTCCAGGAGAGTTTATGGGGACTGTCTTTGCTTGGCCTGGCTGTACCC
TGGGCACTGGAGGACCCCCATCATCCCTGTTCCCCGTTTGTCCGCTTAATGTGGGTTGGC
ACATCTGTCCCTTCCCCTACTGCTGACGGAGATCTGGAATTTAGGGGGATCAGGGCACAG
CAGGGGTCAGAGCCCCTTGCTAACACCTCCTCTCTTGCAGATGACCGCCCAAAGCCCGCG
CTGGTGGTGAGCAAGCCCGTCTCCCTGGAGCCCAGCAAGTCAGCGTCCCCGTCGCCTCCC
CCTCCCCTCATCCCCGAGGTGGAGCCTGTGGTGATGTCAACTATGACGCTGGTGCCAATG
GAGCCCCCCATGGAAGCGGACACTAAAGTGGAGCTGGGCGAGGCGCCGCCCGACCTGCAC
CAGACGTTTAGCGCTATCACTACAGTGCCAGGGGCTGGGGAGCTGCCCCTTGTACCCCCA
CCTGACATGGACACAGCGGCTGTGGTGGAGGAGGAGGTGGCAGAGGAGGTGGAAGAGGTT
GCCATTCCTCTCCTGGAGCCCACCTTGCAGGCGCCCGCCCTGCCCGAGGTGCCATCGGTG
CCTGCCGCCCCCCTCATGCCAGCCGTGCCCCCGGTGCCAGCTGCGCCGTCGCCGCCGCTC
GTTGTCCCGCCGGTCCCTGAAGCACCCGCCAAACCCGCCTCTCCCAGCCCCCCGCCGCCC
CAGGAAGAGCCCTGCCCTGAGCCTGTTGCTCAGCCTGCTGCTGAGGCCAATGGGGTCTTA
GAGGAGGTGCCCCAGCCGCTCCCTGAGGCGCCCGTGTGCCAGCCGGTGCCTGTGCCCATA
TCGGAGCCTGCCCCGGTGCCCGCCCCAGCGCCCACTCTGGACTCTCCCATTGCGCAGCCT
GAGGAGCTGCCCTTGCCCAACGGGATGGAGGGCTCCAGCAAAGTGGAGGCGAGCGAGGAG
CAGCCTGAGTCGGACATCAGCCCCATCTCGGAGCCCGAGGAGCCAGTGCAGCCTGGAACC
CCCGCCTCCCCCCCAGCAGAGGAGGAAGAGGAAGAGAGCGAAGGCCCTGCTGAGGCCCAG
GAGCGGAGCTCAAGTCTGGCCCCTGCCCCGTCGCAGACCTTGGAGGCGACTGTGCAAGGT
TTGGGGTGCTGGGGGGTTATTTGGATGGGGTGTTTGGTATAGGGATGTGGGGAAGATGTT
GAATGGGGACGGAGCGTGTCGCCCTGGGGCATGATGTGGGTATGGTTTGATTTGAGATGT
GTGGGAGTGCCCTGGCTCAGGGGCTATGGGGCACTGGGAGATGTGGATGCGTATAGGGTG
CCTTAAGCACCGGTGTGAAAAGGATGTACTGGGGTTGTATTTGATGCTGTCCTGAGACTT
TGCGAGTGTGGGGAGGGGGTGTGTGCTGGGGATGGGTGGATGGGTGGAGATGTGCTTTTG
AGAGACTGTAAAATTACAAGGCTTGGAAAGTATATAGGAACCCTTGTGAGGAAAGTGGGG
TGCCTTGAGGTTGTGGTGGAGGAAGATACTCTATATTCTTGTTTTCTGAGGCACCCCACA
CACATGTGGAAATTAAACGAGGGGGCTAAAGGAGGATCGTGCACCCTTGGGTTGGGTGTG
GGGGATAGGGTGTATTCATAGAAGTATGGGTTGCAGAAGTACAGGTTTCTGTAAGAAGGC
ACGGGGCGGATGTGTTTTTGAGGAGCACGTCTGTGTGAGGTTACGTAGGGCTGCTTGGGT
GGGGATCATGCATCCTGAGGGCAGTGTATATGGGAGGAGAGGTATGCATGGCAGCGTCTC
TGTATAAGGGAGATGGGATATCCTTGTGCACAGCCCTGCACAGGGGCAGGAGTGCTGTGA
GGATGGGGAGCCCCCGAGGCTAGGGAAGGGTGTGGATGTGGTGCTGCATTATAGCACAAG
GTGAGCAGGGGTGTGGAGGGGGAAAGGTATGGAGAGTCCCTGCATGGTGCTGTGTGTGTG
AGCAATCAGTGTGTAGGTATTGTGGTTGGGATGGGCTGTGCTGGGAAGTGCTGGGACCCT
GTCCTCGTGTTGCTCAGTGCTACTGAGGCCTCACCAGTGACCTCAGAGCTGGCACTAGGT
CATGTGGACGCTGCGTCAGTGCCCAGCCCTCACATTCTTGCCTCTTTGCTAGTTGCTGTG
TCGGTGCCAAAGAAAAAACGAAGGATGAAGGAGCTGAACAAGAAGGAGGCAGTAGGCGAT
TTGCTGGATGCCTTTAAAGAGGTGAGTGTCCCAAGGCACCTAAGGATCACTTTGCATCCC
ATGCCTTCTTGTGATGAATTCTACTTTGTGCCATCGTGTCTGGGCCACTGATACTTCATG
ATGGTAAAGAGGATCTGAGGGGGCAGGACACCTGGTGTAGGGCAGAAGGGCAGGGTTGGA
CTCGCAGCGTGACTGTTGTCCCCATCCCTCTCCTGGTACAGTCTCAGATCAGCGACAGTG
CCTCAGAGGTGGAAAACAAGCCTCCCCCTTCTGCCCCTGCCCGAGAAACAGAGGACGCAG
CCCCCACCCGTCCCCAGGAGGAGTCGGAGGAGACGTGGGAGGAGAAGGAGGACAAGCTGG
CCCCAGAGAAGGGCAAGGCTGGGGACCAGAAGTACCGCTACAAGGAAGGTGAGCCCTGCC
TGGGCCTGTGAGGCCTCTGATGGGAAACACCAACTCTGGCTCCAGAGATGGGGAGGCTCT
GGGTGGCGTGGGCCAGCTGTCCTAAGCGTCATATGCTCCTCCTGTCTTGTCCTCAGACTT
TGCACAGTGTTGGGGACAGAGGCTCTGGCACATGTGTCTTGAGCAGGAAGCCAGTGGCAT
CAGGCTCTCTAAGCAAGCAGGGTTGTGTTTGTGGGGTGCCAGGGCAGGGCAGCTCTGTGG
TTGTCTCAACCCTGTCTTGCTGCTCCCCAGCATCGCAGTCCCTTTTTTCTCTCTCACTGC
AGAGCAGTGGAAGCCATTGAATCCTGAGGAGAAGAAGCGGTATGACCGGGAGTTCCTGCT
GGGCTTCCAGTTCATCTTTGCCAGCATGCAGAAACCTGAGGGGTTGCCCCAGATCACGGA
TGTGGTGCTGGACAAGGTTGGTGCGGTCCTGGAAATTGGGGTTTGGGGGTTGGGCATCTC
TGCTCTGCACCATGGCAGGGCTGGGCAGGGACCCATCTGCTGTGCTCTGGGTCCTGCTGC
AGCACTTGTCATGTGAGCAAAGCATAGTGGGAGGCATGGGAAGCTCTCTGGGGCCATTTT
TCCAGTTCTTTGTCCCGGCGCTGAGGCTGGGGGATGGATCCATTCCTCCTCTGCCCCCCC
GGGCATCCTCAGCCCTGTGTACCTTCGCAGGCCAACAAGACCCCATTGCGGGCGCTCGAC
CCCATCCGCCTCAGCGGCATGAACTGCAGCCCTGACTTCACCCCCTCCTTTGCCAACCTT
GGGCGGCCTGTCATGGGCAACCGGGGCCTGGTGAGTATCTGCCTGCTCCTTCTTTTGCCA
TGCTGAACCCCCCTGCTTCTCTGTGATGATCAAGCCTTTGAGCCACTGTGTCTGGGCCAC
TGATGTCAGTGATGGAACTGAGGATCTGAGCAGGCAGACGGGGATGTTGCAGGAGCTGGC
TGGCCTGGCCTGTCCACCAGAAGGGCTGGAGCAAAGAGTTGAGTTTCTTCTTCCTGTGTC
AGCCTTCAGGGTTGGGTCCTCGCCGCTCACAGCAGACTCAGAGGAAGGAGCCCCGTAAAA
TCATTGCCACTGTGTCCCTCAATGAGGATGTCAAGTTGAACAAGGCTGAGAAGGCCTGGA
AACCCAGCAGCAAGCGTGCCTCTGAGGAGGAGGATCCGGAGAACATCAAGACACAGGTAG
GAGCTGGGGGCAGGCGGGTGGTGCATCTGGTGCCTCCTGAGGAGGGCAGGGAAACTTAAC
TGACTCTTGCTGATCCCGTTGTCCTTACAGGAACTGCTTCGCCGCGTCCGCAGCATCCTC
AACAAGCTGACACCCCAGATGTTCCAGCAATTGATGAAGCAGGTGATGGAGTTGTCCATC
GACACGGAGGAGAGACTCAAGGGTGTCATTGACCTTGTCTTCGAGAAAGCCATCTCGGAG
CCAAACTTCTCTGTTGCCTACGCTAACATGTGCCGTTGCCTTATGGGGGTGAGCAGGGGC
TGCGGGCCTGGGATTTGTTCAGGACTGAGCTGAACACACTGCAGTGTGCCAATGCCTCTG
CATGGGGTGGGCAATTTACCTCTAATATGAGGAAAAATGGGGTGTGTGGCTGGCGGGCTG
AGCACAGAATTGTAGCACAGCATCACAAAGAGGTAAGGTGGTTTTTCTCTGCTTTAAGCA
GTAACCAGGGGTTGGGACTTCTGTGGGAGGCACAACTCACACTCCTCTGGGTTGTACCTC
TCCCTGCAGCTCAAAGTGCCCACGACAGACAAGCCCACAGTGACTGTGAACTTCCGCAAG
CTGCTGCTCAACCGCTGCCAGAAGGAGTTTGAGAAGGACAAGGATGACGACGAGATCTTT
GAGAAGCGGCAGAAAGAAATGGACGATGCCAGTGCTGTGAGTTGGGGGTGGAAGCTGCAG
CTGGGGGCTGGCACCGTGCCCTCAGGTGGCTCAGGGCTCTGATCTGCCCTGATGTGACCC
TTGCAGCCCGAGGAGAAGGCGCGCATGAAGGATGAGCTGGAGGAGGCGCGGGACAAGGCC
CGACGGCGGTCCCTGGGTAATATCAAGTTCATTGGAGAGCTCTTCAAACTGAAGATGCTG
ACAGAGGCCATCATGCATGACTGTGTGGTGAAGCTGCTCAAAAACCACGATGAGGAGTCT
CTTGAGTGCCTTTGCCGCCTGCTTACAACCATTGGCAAGGACTTGGACTTTGAGAAGGCC
AAGGTACTCCTTGCCCTGCCCCATCTTGCCCTGCCCTGCTTTTAGGAGGAGTGTGACCGT
GGTTCTATGCCCCTACAGCCCAGAATGGACCAGTACTTTAACCAGATGGAGAAAATCATC
AAGGAGAAGAAGACATCATCCCGAATCCGTTTTATGCTGCAGGATGTGATTGATCTCAGG
CGGGTAAGGCCTGTGGTCTGCTGTCCCCTGCTTTGTTTCATGGAGCTGCTGGCCTGTCCT
CTGAGTGCCAGCAGTCTGTGTGTCCTTGAGAGCAGAAACGTGGGTATGTAAGCTGTGGCC
AGCCCCAGAGACACCATGCTAGCTCCCAGCCCTTGGTTAGCATGGCAGCAGTAGTGGGCA
CACAGTAACTGGCGGCTGTTTAATGCAGGGAGCTCCTGAAACGGAGCCCTTTTGTGCCAA
AAGCTGCCACAGCATGCAGGGAGCTGTGGTGGCCGAGGTGGGTGGGCTCTGGGGACTGGA
CAGATAGGAAGGAGGAATGTCTCTGCCTCCGTCCTCCAGCTGTCTGAGTATCCCCTGCCC
TGCTCTTCTGCCCTCTGCAGAATAGCTGGGTGCCACGGCGAGGAGATCAGGGCCCCAAAA
CCATCGACCAGATCCACAAAGAGGCGGAGATGGAGGAGCATCGGGAACACATCAAAGTGC
AGCAGCTCATGTCAAAAGACAAAAGGAGAGGACCTCCTGGACCATCCATCAGCGGTGAGT
GACTTAGGGCCACCAGACACAGGTTGCTCTTTCTGCTCACTGCTTGGGTTAGGGCTGTGC
CTGACTTCTGTGCCCTTGTGCCCAGGTGGACGCAGCAGCCTGGTTGCAGATGACGGCTGG
AACACTGTGCCCATCAGCAAGGGCAACCGGCCTATTGACACCAGCCGGCTAACGAAAATC
ACCAAGGTGACACTGGGGGGGAACGCTGTTGGGCTGCCTGGCCCCACAGTCTTGGTGCAG
GGCTCAGAGCTGACTCTGTTCTCTGCCTTCAGCCTGGATTGATCGACTCCAACAACCAGC
TCTTTGCGCCAGGCGGGCGTCTGAGCTGGGGCAAAGGCAGTAGTGGAGGGTCTGGCGCAA
AGCCTGCAGATTCAGGTAGGCGGTGTGGGGCCAACTTGGTGGTGCCGTTGAGTGGGAATG
GGAACCCTTTCTCCCAGCGGTTTCTGTACCGGGGATATGCCGAACTCTGAGGCTCCCCTC
TTTTCACGCCCAGCATCTGATTCAGGGCGACCGGCCACAAGCACCTTGAACCGCTTCTCA
GCACTCCAGCAGTCCACCCCTGCTGAGAGCTCGGAGTCCCGTCGCGTGGTGCAGAGGTGA
GTGTGCTGGGGAAACTTCCCCAGGTTGGGCAGTGGTCAGTTGGTGTGTGGGTAAACGGAA
TCTGATGTCCAGTCTGGAGTCGTCGTCTGTGGCAGGATGGAGGTGTGGGCATGGGCTTGG
TGTGGGGTCACTGCGTTCTTGTGGGAAAGGCAGACCACATCTTTAGCTGCACAAGCCCAG
ATGCCATCAGAAATGGGAAGGCAGATCTTTCTGCTGTACCTTGGCACTTGGAGGATCGCA
GCTGGGTGCTGTGTGCAGCCTGGAGCTACAAGGAGTAGACATCCAGGGATGGGCTGGAGG
GATTCTTACAAAGACTGTTGGGGGTAGTTGGAGCTGAAGTGCCAGATCCTGGAGACTTGG
ATTTGTTCAGGCAGGAGAAGGAAAACCTACTGCAGCAAGGGAGCAAGGGAAGGTATGGGG
AGGATGGAGCCAGACTGCCCTCAGCATTGCTGAAGGTCAGAGCAAAGGATGGCAATGGGC
CTTTGTTGGAACAGGGAATCTCTTCCCATGAGGGTTGTCGAGTTGTAGAGGGAGGAACTG
GAGAGGGCTGGGAATTGGAGTAGGACAGTGTTGCCTTGCATAGCTCTGGAGATTTTGGGG
TCAGAGAAGTGTGGCAATGGGCTTCTTCACACTCTTTCTTCCTCCCACCCAGGAGCAGCT
CCAGCCGCGACAGGTCAGAAAAGGCTGGGGACAGAGGGGACCGGGAGTCACGTTCAGAGA
AGAGCAGTGACCGTCTGGAGCGTCCTGATCGGGGAGAGCGGGGAGAGAGGAACAGGTCTG
CTGTCACCAAGAGGAGCTTCAGCAAAGAGACAGAGGACAGGAGCAGAGAACGGGAAAAGC
AGAGTGGCCCTGAGGCCGTGCGTAAGACTGCTAGCATGTCAGAGGAACGGGACAGGAGCC
GAGAGACGAGTGAGTTGGGGAGGAGAGGTGTCCTTGGAATCTGGCTGTGGGCTGAGGCTC
TGCTGGTCCCAGGCAGTGCCTGATCCTTTTGCTCTCCTCAGTTAAACAAGAGCCAGCACC
TCCTGCGGCATCACCCAAACCCATGCTGTCAGAGGAGGAGCTGGAGAAGAAATCTAAGGC
GATCATAGAGGAATATCTGCACATCAATGATATGAAGGTGAGAAGAGGAGGTAGCCAGGC
ACCCACAGGATGTCATCTGCTTCTCCAGGCAGCACTGCTGTTGGACAGGTTGCTGGCAGT
GCCAGGACGAGGAGCGGGGAGCAGGGGCTGGCTGGGGGGCAGCACTGACCCTTCTGTCCC
AACAGGAGGCCCTGCAGTGTGTGCAGGAGCTGGGCAGCCCCTCCTTGCTCTACGTCTTCG
TGCGGAATGGCATTGAGTCCACGCTTGAGCGGAGCACGATCTCCCGCGAGCACATGGGGG
TCCTGCTGTGCCACCTGGTGAAGGCTGGCACGCTCTCCAAGGAGCAGTACTATAAAGGGT
GAGGGACTGAGGCAGCTTGTCCCCAAAGCACTATTTGGCCTGCCTTTGAATTCAGCTCTC
CTGAAGTCCCTCCTAGCTGAGGGCACGGGGATTATTGGATCCCAATGCCCCTCTCTCTGC
CCTCCAGGCTGCGGGAGATCCTGGAGATTGCAGAAGACATGGAGATTGATATCCCGCACA
TCTGGCTGTATCTTGCCGAGCTCATAACACCTATCCTGCAAGAGGAAGGCATCCCCATGG
AGGAGCTGTTCAGGTGAGGGCTGTACCCCTGTGCGGGACTGCTATGGGGTCCTGGTGGGG
GCACATGTAACAACCATGTTGCTTGTGCCCCACAGGGAGATAACAAAGCCCCTGGTGCCC
CTTGGGAAGGCCACCACGCTGCTGGTTGAGGTGCTGGGCTTATTGTGCAAGGGCATGGTA
AGTGCATACTGCTCACACAGTTTCCAGCGTATGTGTTGGGGCTGGCACAGGGAAGGGGTC
GAACCCTTTTGCACATGGAAAGGGTGGCGGTGGGCAACGCCCCTTGCTGTACCTGGGAAC
TGGGGCAGCTGGCTGCGGGATGGGGAGCAGTGGCACTGAGGGCTGACTTGAGGTTTTCTT
GCAGAGCCAGAAGACTGCGGGCAAGCTGTGGCGGGATGGGGGACTGAGCTGGAAGGAATT
CCTGCCTGAGGACCAGGACATCAACAAATTCGTCACAGAGCAGGTAAGAGCTGGACTGTG
GCTCCCAGGCCCTGCTACTGGGAGCAGCCTTCCCCTGCATTGCACCTAACAGCTTGTCTC
TCTTGCGTCCCCCAGAAATTGGAGTACACGATGGGGGACAACTCGGACACGCCAAGCTGC
AAGGAGCTGACCTCGGAGGAGCTGTGCAAGCAAATGGACAAACTGCTGAAGGAGAACTCG
AACAACCAAAGAATATATGACTGGATTGAGGTGAGAGTGAGGGCAGAATGCCTGCAAGGC
ATCCTCTCCTGGCTCAATTCACATCTCACAGCCCCTCCCTCCTTCCTTCAGGCCAACCTA
AGTGAGCAGCAGGTCTCGTCCAACACATTTATCAGGGCCCTGATGACATCCGTGTGCCAT
TCAGCCATCACCTGTGAGTACTGGGGGGAGGTNNNNNNNNNNATCCACCTCTATGTCTCT
ATCCATCCATCCATCCAACCCATGGGATAAGGTTTCCTATAATAGCACGTCGTCCCTGCT
GCCCCGGTGCCCCCCCAATGCTCTCTGCTGGCCGTGTGGGGGTTTGTGCCACCTCCCCCT
GTGACCACACTGTCCCGTGCCAGGCGTGGCGGAGCAGTTTGCCATCGCCGAGGCCAAGCT
GCGCGCCTGGTCCTCGGTGGATGGGGATGACTCCAATGATGAGTCCTACGATGAGGACTT
CATGCCATCCTCGGAGAGCTCCCTGCCGGCCGGTGAGCACGCTGGGGATGTGTGGACTGG
GGATGGTGTCCTGCTGCCAGGACTCCCCATGGTGCCACCATGGGGCTGGCAGTGAGTGGG
ATTCCCGGCCGTGGGGCTGACCGCTGTTCCCGCAGAGCATCATCCCGGTGCGGCGCTGCT
GCGGGACCTGCTGCGGGGCCACCTGTGCCAGCTGGGAGCACGGCATGGCTCCTGCGAGCC
TGAGAGTGACTCGTCGCACACGCTGTCCCCCGAAACCCTCTGCTCCAGCCTCTGCAGCCT
GGAGATGGTGTCCCCCTCCGAACTCACTGCCAAACTGCTGGGCTCCCTGGGGGGTGAGCT
GCCCCCCCCGAGCAGCCAAAGTGCCTTGCGGGGTCTGGTATGGCCCCGCTGCCAGGACTC
GCTGTCCCCCATGCCCTATGCTGAGGCCTGCCTCTCGCCTGCCGAGGACGAGGTGGTGCT
GAGCAAGGACTTCGCGCTCCGCCGCAAAATCTCCGACGTTGCCTCCTCCGGGGTGGTGTC
ACTGGAGGAGGAAGATGAGGAGGAGGAGGAGGAGGAGGAGGAGGAGGATGAGGCTGAAGA
GCCGTGATGCCCCGCAGGGACCCTGCCTCTCCCCAGCACTATGCCCCCCAGGACTGACGG
GACCTGAATCTGTGGGGCTGGCTGTCCGCATGCATCCCCCCACCACCCCTCTTTGGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1027, 1033..1074, 3652..3825, 4133..4232, 5944..6056, 7606..7699, 7779..7844, 8200..8892, 9016..9117, 9894..9899, 10132..10220, 10427..10607, 10922..11055, 11310..11429, 11642..11815, 11910..12107, 12369..12515, 12606..12842, 12918..13022, 13400..13553, 13645..13745, 13832..13934, 14047..14155, 14812..15068, 15161..15276, 15425..15597, 15727..15852, 15935..16016, 16204..16302, 16395..16529, 16611..16697
1001..1027, 1033..1074, 3652..3825, 4133..4232, 5944..6056, 7606..7699, 7779..7844, 8200..8892, 9016..9117, 9894..9899, 10132..10220, 10427..10607, 10922..11055, 11310..11429, 11642..11815, 11910..12107, 12369..12515, 12606..12842, 12918..13022, 13400..13553, 13645..13745, 13832..13934, 14047..14155, 14812..15068, 15161..15276, 15425..15597, 15727..15852, 15935..16016, 16204..16302, 16395..16529, 16611..16697
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved