Gallus_gallus Locus NUCL_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus NUCL_CHICK
Gallus_gallus
NUCL_CHICK
9
SNORD20, SNORA75
6024..6100, 6665..6806
9553
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCATTTTTCATGGGCGTTTCGCCGCATGGTTATTCAGCGGGACGATTT
TCGCAGAATAAGCCATCCTAATTCAGCGAGGTCTTTCGAGCCTCGGTGGTGCATTTCGGC
TCATAATAAGCTAGACATCTCGCATTGCAACTGAAAGCAAGACCTCAACTGACTTTTTCC
CTTATCTGCCCGTATTCGTAGAGGCGGGGATTGCTATTGGCGGAGCTCATGTTGCTGCGT
CATTAACACCGAGGCAGTTAAACACACCACCGGGGTACAGTCGCGCATTCAGGGGAATAC
ATTATCAGCAGTCCCCCACTTTGTTGGTACAGGTTGTCTCACGCGAGTCACCTCGGAACG
CGAGGTTAGGCAATTCTCTCGGAATACGGGGTGGGGGGGGGCGGCCACGTGGTGTGGCGG
AGAGCGAACACGTGGGGGTGGGGAAGGAACGGGGACACCACGCGGGGCTGCCCCGGGCCG
GGCGGGGCGGGTTGGGCCGCCACGTGGTTGAGGCGATTGTCCGCCCCGCGGCGCGACCGT
TGCCGGCGGTGGGACCTCACCGCATTCTTACGGTCCGTTCTCTCCCGCAGACTCCCAAGA
ATCAAATGAAACAGAAAAAAATGGCGCCTCCCCCCAAAAAGGTCGAGGAAAGCGAAGAGG
AAGAGTCCTCCGACTTAGAGGAAAGCAGCGGGGAAGAGGTTAGCCGTGTTGAGATGGAAC
ACGTGCAGCCACGCGCTTCAGAAGTGGCTGAGGGTTATGGGGGGATGAGGTTGGCGGTCC
ACATTGGTAAACAGCTTGGGGGGGGGGGGGGGGGAGGGATTGTTTGTTGTGGCTGATGGA
TAAACTGGATTGCATAGGGGAAAGCAGTGAGGGAAGAACTGGCTGAGCAGCTCAAGCCGT
GCTTCCCGGCTTTGGAAAGGCTGCGGGGATCTTAAAGCTGGTCTGAGCAGCAGTGAGTGA
GGGAATGGTAAATTCATCAACAGTAAGTGACTTATTGCACACCTAAAGCACAGAACTGAA
AATTTTGAAGGTGTGGGTCCCTGTTGCAGAAGGGATTATTGGGATTGGCTCAGGAGCAGG
CAGTTGCAGGATGCTTTGCTGTTCACCTGTTAAAAGCTGCTTTTGAGCTACAGTAATTCA
ACAGAATTGGCAAATAAGGTAAAAAGCAAAAATTAGTGTCAGAAAGAGAAGTTTTAGATT
GTAGTTATTAGTGAATTAGTGGAATAGGCAGAGCAGGTGCAGCAGTGGCACAGAAAGAGC
AAAGATCTCAATTAATGTGGTGTATGGAGCTAGCTACATGCTCACTGCAGCTCCTAAAAT
ACCAACTTCATGAGTTCTGCAAAGTTCTAAATAGCTTTCAAGGCATAATGTCACTGAGGG
GTCATTTTTGTCAGTTTGGTATCTCGTTCTGTCAGGGGCAGCACTAGTCTCACACTCAAT
AAACCTCTTTCAGGTGATGGTCCCTCCAAAGAAACAACAAAAAGCAGCAGTTACACCAGC
CAAGAAGGCTGCTACCCCTGCAAAGAAGGCTGCTACTCCTGCAAAAAAGGCAGTGACACC
AGCCAAGAAGGCTGTGGCTACTCCAGCTAAAAAGGCTGTTGCTCCATCCCCCAAAAAGGC
TGCTGTCGTAGGCAAAGGGGCAAAAAATGGCAAGAATGCCAAAAAGGAAGAGAGCGAGGA
GGAAGATGAAGACGATGAAGATGATGAGGAAGATGAGGATGAAGAAGAGGAGTCTGGTAA
GTTACTTTTGGAGTGCATTTCTGTCTTTTGTGAGTTGACCAAAGTTGGTTCAGCCTCGTA
GGTGAAACTGATTACATTCAGCATAGTGTAATACTCAGAAGGGCAGTGAGGGAGGAAAAT
GGGGTGTTTGGTAAATGTTGGAGAACTTTCTGGATTGCAGCTATGTTACTTGAAGCGTGT
GACACACCTTTTGAGTTCTCTCTGATGATACAAAGTGCTTGGCAAAGTTTGAACACTTAG
TGCTATGGATGAAGGCTTATTGTACTGTTTTGGTAGATGAGGAAGAGGAACCAGCAGTGC
CTGTGAAGCCTGCAGCCAAAAAGTCCGCAGCAGCTGTACCAGCCAAAAAGCCTGCAGTTG
TGCCAGCAAAGCAAGAATCTGAGGAGGAGGAGGAGGAAGATGATGAAGAGGAGGACGAGG
AAGATGACGGTATGTGGTCCATAAAGGATTTAGAGTTTTGGAAAATTTAGTTGTTAAAGT
AGTAGACACGGGGAGCTCAAGGGAGGGTACCGCGATGGGTTAGTGGGAGTGATGCAGTGT
CTCTGAGTGCCCAGCTGCCTTCAACTGGCTACCAGTGTCTGACAGATAATAGCAGGAGTG
TTTAATCTTCTACTGTTGGGGGAAAAAGAAAACTTTTAGGGAGCTGATGTTAGTGCAGTA
AAAACTGAGATACAGGCAGTACGCTGAAACATCACAAAACTCTTCCTGAGAACATACAAA
CTTCATGAGGAATGCAAAACTAGAGAGTTAGTTGAGTGTCTTTTAGACTCAAAAGTGGCT
TAATCTGGAATGCTCCCGAAATCTCACACTCATCTTGTTGCAGAGTCTGAAGATGAGGCC
ATGGACACAACTCCTGCTCCTGTGAAGAAACCTACTCCAGCAAAGGCTACACCAGCTAAA
GCTAAGGCGGAGTCTGAAGATGAGGAAGATGAGGAGGATGAGGATGAAGATGAGGAGGAT
GAAGATGATGAAGAGGAAGATGAGGAAGAAAGTGAGGATGAAAGTGAGTTTATATAACAT
TATAATTTTCCATAATAGCAAAAAAAAAGTGTCCAATCAAAATTGTTTGTGTTGCAGTCT
TTAGGACTGAAGAACAGTTATGCAGGCCTTCCATGTGAACAGTGTAGATGTTAATAGTCC
TGTATTGATACAGCACAGGAGAAGTTGTTTTATTCATGTGCTTCTATTTCAATGTTGTTT
CTTGTTCCCTAACCACAGAACCTGTCAAGGAAGCACCTGGAAAAAGGAAAAAAGAAATGG
CCAATAAGAGTGCACCAGAGGCCAAGAAAAAGAAAACAGAAAGTAAGTGGCATGGGGTCA
TAAGTGATGCTCATTTGAGTTGTTGGACTGTTGGGTGAGGCATGTGTGTAATGGTGAAGG
GGCTGTGGATGTTCAGTGTGGTTTTTTCCTCAGCACAAATGATGATTATAAGGGACTTAA
TACTGAAATGTGATGTGATTTTTGAGCAGAACTGATGTGCTAATGCTGTCGATAGTCTGA
ATTCCAACTCTCTTCATTTGTCTTACATTGAAATGTCTTTTCATTCAAAGCACCTGCTTC
AGCTTTCTCACTCTTCGTGAAAAACTTGACCCCCACCAAGGACTATGAAGAACTGAGGAC
TGCCATCAAAGAATTCTTTGGCAAGAAAAATCTCCAAGTCTCAGAAGTCAGAATCGGTTC
TTCCAAGTAAGTTCCTCTGTAGAATTTTGCCGCCTCTTTCTTTGACTTGGCAGCAATTGA
TTTAGATGGCTGTAAGTGTGCTGATGCTCATTCCCTTTGGGGTGCTGGGATGGTTTTTTG
ATAGCGAATGGAAGCTGGAGGAGGGACCAGAATACACATAGTGCTGATAGTGGTGGTGTA
CTTCAGATGTATACTTCTCCCTAAGGGGAGAGCTGCCACTGCTGTTCACTACTGCTAGTT
ATCTCTGCTGGCCTGTCTGTGTTTTTATTGACACTTTAGCTTGACCATGGTCCCCTGTTC
TTGCTTTCTGTATGTATTCTTATTAGAGACAGATCAGCTTTAACAGTGAAGCTGCTCTTC
TTTCAGGCGGTTTGGCTATGTGGACTTCTTATCTGCTGAAGATATGGATAAAGCTCTTCA
ACTGAATGGAAAGAAGCTGATGGGTTTGGAAATCAAACTGGAAAAAGCAAAGAGCAAAGA
AAGTCTTAAAGAAAATAAGAAAGGTATGACTCAATCCTGAATTATCTGCACATCAAAGAA
AGGTGGGTGGTATTACTGATGGCTGCGGTGCTGCTCTTAAAGGACATTTCCCTGGTTTGA
TCCCTTTGTTGTAGTTTCTCAAATACTGAAATGGATGTGCAAGTTCTGACTTGCAAATCT
GAAAAACAGTTGGAAGAAAGTAGTAGGTAGTAGGTGTGTGAGGAGGAAATGTGGTCCTGT
CCTAAGCTTTAGGAGCTGTATTCAGAACTTAGTGCCTGTAGGGAAACAACATAATGGTAA
CCTAATTAATTTTGCTCTTGCCTTTTCTGCTTTTGGGACTACAAATACATACTGTTTGTT
TTTTTCTGCTGGATGAATTTGGTCTGTCTGCTTGTTGAGAAGGAATATGGAGCAGATGGT
GAGAACTTTTCTTTCCTCTTTGCAGAGAGAGATGCCAGAACACTGTTTGTGAAGAATCTG
CCCTACCGTGTAACTGAAGATGAAATGAAAAATGTATTTGAAAACGCTTTAGAAGTCCGA
CTAGTACTTAACAAGGAAGGGAGCAGCAAAGGGTACGTAGCTGAGAAAGTTGTTAGGTGT
TTGCTGTTATTGCATTTGATGTGTTTAGGCATCATCCCCTTCAATCATGAACTTAAACCG
ATGCCTCCTGGCAGTAATGACCGTCACTTTCTTTGTTGTAGGATGGCCTACATTGAATTC
AAAACAGAAGCTGAGGCAGAAAAAGCACTGGAGGAGAAGCAAGGCACAGAGGTTGACGGT
CGTGCCATGGTCATTGACTACACCGGTGAGAAGAGCCAACAAGAAAGTCAGAAAGGTATG
TTTTCAGATTAATAGTGTGTGTGCAGAGGGCAGGACTTCACTATGCTTGTGTTAGAAGCT
GGCTAGGGCCAGAATGACTTGAAGCACTGCAGCAAAGCTGTAAGATAATGGGAAGGAGCC
TTTTGCCTTACTTGTCCTCCAAATGGCATGCATTGCAGGTCTCTCCTGAATGTTTCTGCC
AAAAGAGGACAGTCCAGGTGACCAGAACAGCACTGTTCTTGGCTTTGTGCCTCACCTCGA
AGTGGGAAGGGGGTGCAACAGCTACCATCCCCTTAGGAGGGGACTTTATGCCTAGAGGTA
GAGAGCTCTTCCTCTCTAAGCCTGGGCTTAGAGCATTGTGTTTCCTTTCTAGGAGGTGGA
GAGAGGGAGTCAAAGACTCTGATTGTGAACAACCTGTCATATGCTGCCTCAGAAGAAACT
CTCCAGGAACTGTTTAAAAAAGCGACTTCCATCAAGATGCCACAGAACAACCAGGGCAGG
CCTAAAGGGTATGTTTAAAACTGAGTCCTCAGTTGGCATTGTGAAAGCCTTACCTCCACT
GATGTCCTGTGCCTCCCAAGCTGACTGAAATCTTCCTCTTGCAAATAGGTATGCATTTGT
AGAATTTCCCACAGCCGAGGATGCCAAAGAGGCCTTGAATTCCTGTAACAACACAGAAAT
TGAAGGCAGAGCAATCAGGCTGGAATTCAGTTCACCATCGTGGCAGAAAGGGAACATGAA
TGCAAGAGGAGGATTTAACCGTAAGTGTTCCATGCCTGATTATTTGATCTTGTGAGAAGA
GTGTGCAATTCAGGCAAACTTGTGTCTGCTTTAAAAAAAAACAACCAAACAACAAACAAG
TGTGAAAGACATGAGTGGATGTGCTGGATATGATGACTGATTATCTGAAATGCTGATGAA
ACCACTTCTAAAGTCCTCTAGATAGTCAAGTGCTGATCCAGCAGTGTCTGTTACCCCGTT
AGTATCTGTGGGGGGATAGAAGTGTGTAGAGGGGGATGAATTTGATGCTACTGAGTGGGT
CCATTTGGAGTCACTTGGATGTAAGGTTCTGTTTGCAGTCCTAAGAGTTTTCAAGGTCAT
CTACCTTTGGGTGCCTTGGCTTCCTTTAAAGAAACAACCCTGGGAGCTGTTGTTGGAGTC
AGTAATGCAGGCTGAATGTGGTGTTGAGAGGTTAATGGTAGCTTTGCTCAGACTGTGATC
TCCGAATGTGTTGTCTTTCCACAGAACAAAGCAAAACATTGTTTGTCAGAGGCCTTTCTG
AGGACACAACGGAGGAGACGCTAAGAGAATCATTTGAAGGCTCTATAAGTGCTAGAATAG
TCACAGATAGAGACACTGGATCTTCTAAAGGGTATGTTAAGCATAATCTGGGCTTACTTC
AGTTACTGCAGGAGAGACATGTATGTGTGGTGCAGGTCGTATCTAACGCTTATGTAGGTG
ATTCTTAGAAGGCAGTAGATGGTGTGGAACTGGAGGGCAGGCCTATAGCTCTGGTTGGGC
ATACTCACTTCTCAATGAGCTCCTTCCTGCCGACATATCCGTGGCAGCCTATGGATTCGC
ATGAGAAGGACATAAACAGCTCAGTAGTGGCACACTCACAACCTGGTTATACATCAGTTG
TGATTAACCACTTACTGTTCTACAAGTAACAGTTCCAGATGACTCTGTGTTGGCTAAGAT
GCTGCTGTTACCGAAGGGATTGCTATCAAGTGCCAGTAGGTGGTGCTACAGTTCATGGAT
TGCTTGGAGTTTGACTGTCTTTCTCTTAATCCACTGCCTAGGTTTGGTTTTGTGGACTTC
AGCTCCCCAGAAGATGCCAAAGCAGCTAAAGAAGCTATGGAGGATGGAGAGATAGACGGA
AACAAAGTGACCCTTGATTTTGCCAAACCAAAGGGTGAATTTCAGCGTGGCGGCGGATTT
GGTGGTGGATTTGGTGGTCGTGGTGGCAGAGGAGGAGGAAGAGGTGGATTTGGTGGCAGA
GGTGGTGGCAGAGGGTTTGGAGGTAAGTAACCCTCTTGTAAGGCCTGCAGTCAGAAATCA
GCTGAAGCTGTTCTTGGGATTACAGTGTGCTCTCACCGTAGAGTGCTGGATGTGAATTTG
TTTCCTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTGTTCC
TTGGGGATTACAGTGTGCTCTCACCGTAGAGTGCTGGATGTGAATTTGTTTCCTGTCCTG
TACCAGGGGAGGGGTTTGGAAAGGCAGTGGTGACTGCAGGGGCCGCATGCATCTTTGTTT
CCTGATACAATCTCTTTTTACAGGTAGAGGAGGTGGTTTCCGAGGAAGCAGAGGAGGAGG
TGGAGATCACAAGCCACAAGGGAAGAAGATCAAGTTTGAATAAACTTCCCTTTTCCTTTC
CCTTCTCTTGATCTCTGAGACTATCTGAAAGGACTCCAGGGGTTTTTATTCTCCTTTTAT
CTTGGTGGAGCCTTCGGAGGACATTCCAAGGTGCAAAGGAGTACTGTGAGCCACTTGGAA
GAAAGAATTTTCATTTCAAGGAAGAAAAGCAAGCTATTTTGTCTGCTTGCTTATTCAAGT
GAACTTTTTAACAGAAATGAGCGATAGCTGTGGGAATTTACCCTTTGTCTGTGAGTTGTC
TTGAATTTATAATGTTTTACCCATGTACAAAAATATTTTTTTCCTATAAACTTCTGTAGC
ATTTTTTTGCTGTAAAAATGCAGAATGTTTTATCATTTGTGCTTCAGCACCCTGTCTTGG
ACAGATTAAAGGACCTAAACTGGGTTCGTGTTAATTCTGTACCGCTACACCAGGGGCTGT
GATGAAGTCTGGCTGGAGGCTTCCTGCTGTAAGGTTGCTGTGCTCAGGGCAGGCACCATC
CTGGCCTGCTTTGTCCCTTCTCCACTGTACAAGGGCAGTACTTTACACCATGACCTGCAG
CTCCTCTTCACCTCTTTTAGAAGGAAAGTAAGGCTGTACGTGTTTTATTTCATCCAAAAC
TGGTGCTGGTCCACTGTCCTCGTGGTTCCTTGAAGCTGAGGGCAGCACCTTGAAGCACAA
TAGGGGAAGTAACTGTTGCCTGTCATGATCATTGCCCTGGAAAGGGGTGAACTCCTGCAC
CCCCCTCCCTCGGGCATAGCACTGGTGTCTTGTCCAGGCCCTTGGCTCCTATCCAGTACA
GAAGGTAGGGGGGCAGCTGCTGCTCCTTCAACCCTCAGCAGGGTTGGTGGCAGCAGACAA
AGCTTGCACTGAGAGGCTTCTGTGGCTGCAGCCGCAGGTCCTGAAAGCTGTGTCTCTCAC
CTGCAGCCCAACCCTATTCCACACCAGGCAGCTTCCCGGCTCGGGCACTGACCTTCACAG
CCTGTCAGCACCCACCTTCCTCTCTAGTATTAACAGGACAAGTGCAGTGCCTTCTGCCTG
CATTTCTACTGCCTCATTCCCACAACAGAACCTCTGGTGAGGGAAAATGCGTTCCCTACA
GCACAGAGCTTCCCTTTACGCATAGCATTCCATGCGAGCGTAGGGCGTACGTGGTAAAAA
AGGGCATTTGGCGGCCGGACCAGCGCTGCAGAGCGTAGGAAAGCCCCATTGCCATAGGTG
TGCGTGCAGAGCCGCTCGCACCACCACCATCAGCCATTTTATTTCGGAGTTTGCGCGTCG
GCCCGGCGGCAAATGGTCGGAGCGCGGCGGCGGGGCCGGGCAGCAGAGGGCAGCAGCAGA
GCAGCACTGAGCTGCGGGCTGCCCCGACGGGAGGGGAGGGGAGGGGGGGTCTCCCGGCAC
GGCTTTATTCCTCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 1873..2155, 2436..2588, 2983..3162, 3378..3461, 3704..3845, 4206..4342, 4765..4891, 5021..5154, 5512..5647, 5748..5899, 6384..6510, 6941..7161, 8063..8553
1004..1117, 1873..2155, 2436..2588, 2983..3162, 3378..3461, 3704..3845, 4206..4342, 4765..4891, 5021..5154, 5512..5647, 5748..5899, 6384..6510, 6941..7161, 8063..8139
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved