Gallus_gallus Locus RABGGTB
snOPY snoRNA Orthological Gene Database
Gallus_gallus RABGGTB
Gallus_gallus
RABGGTB
8
SNORD45, SNORD45
1266..1348, 2792..2876
11001
CAACTCTTTCATTTGCTCTTCCTTAAGGACAACGGAAAGAAACGGAAGGCATTTCTACA
CAGCTGACGAGTTCGCTACGACGCGCGAAGGCGCACAGTTTCAGTTAGCAAACAGTACAC
GCGCTCCCTCGGTTTGAATTTAGCGCTCGACTGCGACAAGCCCGAGCGCCGCAGCCTACG
CAGGACCTAGGGGTGCCCCGCGCGCCGCCGGCCGCGGTCGGGCAGAGCAGAACGTCGCGC
TGGGCCCTGCAGGTGGCGGCGGCCTGAGCTGCCCGCCGGGGTCCCGTCCTGTTCGCGGCG
CGGCGTCGGGCGCGAGGGGCTGTGAGCGCAGCACCCGGCGGGCGGCTCTCGGGCAGCCAT
AGCGAGGCCCCGCCGGGTGCTACTTTTTGCCACGCCCCGAGGTGCCTCCCTCTTTCTGCT
ACAGGCGGCGAAGATGGTGGGTACGGAGCTCCGCGTGGTGATGGTGGTGGGCCCGGTCCA
TCCCGTGCCTCGTCCCCTTGTGCCCCGTGGGTGCGGGGCTGGCGCGCGCTAAGGGTCGTG
ACGATCGCAGCCGCGGTAGTTCCGAGGCACTGCGGGCCTGGAGGTGTGCCTGCCGCCCGC
CGAACTGGCCGGGCCTGGCTGCGGCGGGAGCGGAGCACGGGAGGCGTGGCGAGGGGAGCC
TGCCGCGCTCGGCCTGTCTGCAGCGGCCGGGCTTGCGGCACTGCGGGGCCTGCGTCGGGC
CCTGAAGCCCGCAGCGGGCGCTGTCTCGTGGCGCGCGGTTGGGGCCGTGGTGTTTGGGTT
TGTTGGGGGATCGTAGTTTGTTTTGCTTCGCGTTATTTAAACAAGAAAACACAACGTATT
CGTCCTCCTTCGCTAGGAAGGATTTAGCCAGACAGAAAATATGCCAGTGAAGTATAGAAT
CTGTCTCGTATTAGACATACACAGAGAAGCGTCCGATGCAGAGCAGTCAGTTGCTGCTGC
CAGCGCTGGTGGAGGTGCACCTTACTGCCAGAACCTCTTGAGCTGGCTATGCAGCTAATG
CCTCGTTGGTGCTTTTACAGGGGACACCACAGAAGGACGTTGTAATAAAACCAGATGCTC
CAAGTACGTTGCTTTCAGAGAAACATGCGGACTACATAGCTTCGTATGGAACAAAGAAAG
ACGATTATGTGGGTATCAGTTTTGCTTCAGCACAGCTGTGGTTTTATTAACGGTAGCAGC
AACCCATATTTACTTGTTCTATACAGTCCAAAGTATAAAAGGAAGAAGGCTTTGTTGATT
TCTTTAGGTCTGTGATGAGTTTTGGCATGTATTATCTGAGCATAAGTGTGAAGATTATCA
GTTTAGCTCTAGAATTACTCTGAGACCTTAGAAATAAACTACTAGTTGTGCCTTCATCCA
GTAGAGCGCATGAGCACACCTATATTCATCTTGGGTGCTTGCTAGGGCAGCATACTGAGG
TGCATTGCAGCACTGCCCTCTGAGTACTGAGTGCAGGGAATGCTTCTAACGGGTGTCACT
TGTGTAGCTGTGATGGAGCATATGACAGATGGATTTTATTTGGTGAGAAGGGTCAATAAC
TGCATGTCTGAGGGAGGGGAAAAAAAGTTGCAGTTATCCTTACTGTCAGCACTGCTGTTC
CTGTGGTTAAAACCTGCCAGCTGTAAGGACTGCTTGGCACCAAATAATGCTTATAGGTAG
TGTATATGTAAACAACTTTTACATATTTATATGTGTATATATATATTTGTGAATTTACTT
CCTTCTACAGCACTGGACTGTGGCAGTTCTGTCACTTGTTAGTAAGTTTCATTAAATGAC
TTCTTATTTTTGAGACTAGTTGAGGCTGTAATTTGAGTGACAGTTTGGATGCCAGGACAA
TAACTGATGATCTGAAATGAACTGGTGGCTTACTGGTTGCCTGTGTTTAACTTGACGTTT
AGATTAATACTCCTAAAACAGGTAATACAGGAGAGGGTGGGAATTTAGTATATGTAGGTA
TATGTGTACATACACATGTTTTTATGCGCACATATGCACAATATACAGAGTAACGGTGGC
TAATATGTTCTAAGTCAGTTATGGGATTGAAAATATTTGACATGTTACAAACTGTAAGTA
ATGTATTTCCATTGCTGTACTTCAGTGGCATGTTTATCCGATGATGAACTAAAATAATGC
ACTTCTTAGGAGTACTGTATGTCTGAGTATTTGAGGATGAGTGGTGTTTACTGGGGGCTG
ACAGCAATGGATCTCATGGGACAGCTGCACCGAATGAACAAAGAAGAAATTCTGGCATTC
ATCAAATCGTGTCAACATGAATGTGGTGGAATAAGTGCCAGCATAGGTCACGATCCTCAT
CTTCTGTATACCCTGAGTGCTGTCCAGGTAAAACTAATGTAGAAACAACCATTTGTGTGT
GTAATGATTTTGATGATTGCAGATTTCCAAACCAGACAGTGTTGGATACTAATAGTAAAA
GCTATTTCAGTACCTTATTTAAAAATAAATAAATCCAATTGACAAAACTTTAGGATTTAG
CTGTATCAATTCTTTAAAAGTAGTCATATTTGAGTGTTGCACTTCTAATGTTCGTTTAAT
GATGAATTTGTGAGCTGAGATGGAAAACAAAACGTAGAGGCTCAAATGCTTCTAAAAAAT
TGATTATGTAGTGTATCTCTAATTGAAGCTTGTGGAAGAAATATGTAAATGGTGTTACAA
ATTAATATGGGAGCATCTGGTTTTAGGAAGAAAACGTTGGATTTAAGGTATTAGGTCTGA
AAGCCTTAGGACAGGAAAATGTTGTTTTCTTGGGTCAGTGATGATTGGTGGCATGTATTA
TCTGATGTAAAGGTGATGTTTATCATCACATTAGCTCTAGAATTACTCTGAGACCCAGGA
AACTGAAATTTCTTTAGACAGCAGCCTTTGAGCTTTTCCAAACACTCCAGTCAAATTCCT
TTTGTGAAGTCCTCCTTCTCTGAACATTTAATTAGACAATTGGAGACATATTTTGTAAGG
GGCATAGAGTTCTTAGATTAATACTTAATATTATTAGGAGATATTTTTATGTCAGCAACG
CACCTCTAGATACGTAAAGCTGGAAAGCGTTAGCCATTGCAGATGTGAAGTTTTTAAACA
TAACCAGTGTGTCTTAATGAGTGTGTGTGTCCTCACTTCACAAAATCTGTTTAGTCCCAT
CTAAATCTCCAGAATGTTTAAAAGGTAACACTGCATCTTCCTTTGATCTCACTTATCAGT
GATGTGTTCAGGTTAGCTCTTGAAGGAGTATACTGTGGTACCAAATGTTCCGTTGGAGGT
GCTTTGTAGATTTTTTTTTTTTTGCATTCCTGTAATTATTTTTAAATTAAATAATAGCTG
GCAATTAAAATACTCTAGCTTCTTAATTTTAGGAATTCAAATTCATACCTGTTGGTGGTT
CTCAGGTTCAGTTTTTCAGTGTTCCTTAGTTTCACACGTTCTTTCTATTTTCAATTGTTC
TGTTACACACTTATAATGCATTTTCAGAAATTGTCCCAGTTATGAGTAAAAACATGAAGC
CAGCTGGGGCTCAGAAGCAGCACTGTTGCATCCACTTGACATACTGTCTTTAATTTATTG
GCTCCAATCAGTGCTAGTTCAGAATCTTAGCATTCCTTACTCTGACCTGTTTTTCATTCA
GAATGTGTTCGCTGTGCAGTTTGTGTCTAATCACACTGTTTATGTTTTTTCTTGAATTGT
TACAATTTGCTATTATACTTCAAATTTAAATGTTTAAAATAATTCATTTTCTGTATATAT
GAATCACTCCTGGTAGACTTTAACTGTAAGTGGTATTAGTCACTGTCTGCTTCACTTACA
GGTGTACAAATAACAGCAATGCACAAACTACAGGTTTTAAATTCTGGAATGATATTGCAT
AGCAGAATTCACCCATAATCAAATCTCTCTTGTTATACAGAATGTGAATGTAAAAGTAAA
GAAGCCAGATTATGCCTTTGAAAGGAGAGCTGGAAGTTGGAAAGCAACAAAACATGGAAC
AGTTCAGCAAGAATTGTTTCTGTTTTCATTTGAGACATCTTTGGTTAGCAGTAGATGTGC
TTTAATGAGTCAAATCTGATTGTAACAAATAACATGTACCAGTCAGAATCAGTTAAATGA
AGCATCTTACAAATCCGGATTTTTTAATTTGTTAATAAATAAATCTAAATAGCCTTTGCT
TCTCTTTGATTGTTGCTGTGGCTTTCTCTTCTAGATTCTGATCTTATATGAAAGTCTCCA
TGTTGTTGATGTAAATAAAATCGTTGAATATGTACAGAGCTTGCAGAAAGAAGATGGATC
ATTTGCTGGAGACAAATGGGGTAAATTTTAGATTGTAGAAATGCACCGATTTTGTTGACA
GATGTTAGTCTGTGAACTTAAGTTTTCTTAGATGGTAGTTTTGCATATGTACTGTATATG
AACTTTAGTTCCTGAGTTGTTAAAAAAAAAAAAAAAGGAAGAAAAAACTAAGTTTTGTGA
AGGACAAACGTAGGTTTTCTTTCCCTTCCAAAATATTGTGAATATTCTAAGATTCATTCC
TTTTTTTAAAAAATAAATTGTCCAGCTCTTAGAGAAAAAAAAAAACCTTTGGGCACTTGT
AACTAACAGTACTTTTGTATGTTAGATACACTATTTCTGGTTTTTTGCTTGCTGTTTCCT
GGCCCTCCTTTTATGATCTTTATCCGATGAAAGGCAGCTTTCACTACATGGAAATCAGAA
AAAATACAGGCTGTCTTTTTTACTCATCACTATTTATTAATACTTATTTTTGTTCATAAA
GGATTTACGTGCATAAACAAAGGTAATTTTTAAGCTGTAGCATAGCCGTAGAGTCAATAA
AAATACTTATTCCCATGGAAGGCTTCATTTGATAGAATATATTGTGTGTCACTTCTACTG
TTCTAGTAAAATCTAACAGGCAGTGTCATGGTTAGTGTATGTACACTGCTGGAAAGCTCG
TGATACCTTACCTTGTGCTTTAGGAGAGTCATGTTATGAGCTTTCTCAGAAATCATTCTG
CTGAAGTTTTTTTGGTTTAGCATCAAGATAAAAATGTGCTAAATGAAACTTGCAATTCGA
GTTACTCTTGATCTAATAACAGAAATGGCTTCCACTTCTGCTCAGGTATTAAAGAGAGCC
CAAAGCATTAAAAACAGACCAGTTTCAGGTGTTCTTTTATTTATCTGTTTTAAATATCCA
CTGCTTTGCCTTTATCCAGTAGGGTACTACAGATAAACTTTTATAGAGCTGTTTGCAAGT
TACCGCTAGTTGAATTGACTTGAATATACATCTGAATGCAGGTAGTGAGTTGTTTGCTTT
TACGTACAGTAAACACAAATCATTTGAATTGTAATGTGCACTTTGTAAATTATTGAGGAA
GTAATCATTGGTTTGAAAAGTGACCTTTAAATGGCACCGTTTTTCATTGTGTTGCTCTTT
TTATATTTGTTCCTTATGTTCAGTGGTGATTGAAATGTATTGTTGTTACTAATGAAAATA
ATATTTCATTTCCTGCCCTCCATGTCTTAGGAGAAATAGATACAAGGTTCTCCTTTTGTG
CTGCAGCAACTCTTGCACTTCTAGTAAGTCCTAAAACATCACTTGAACAAGTACAATGTT
TTTTTCATTGGTGGATAGCTGAAGTTAACCAATTTGGCTGAAGGTAAAATATATTGGTTG
CCTTTTTAACTTGCAGGGAAAACTGGATGCTATTGACGTGGGGAAAGCAGTAGAATTTGT
TTTGTCCTGTATGAACTTTGATGGAGGATTTGGCTGTAGGCCAGGTTCTGAGTCACATGC
AGGACAGGTGAGTTTTATTTTATATAGAAATATTTAAAATTATTAAATATTGCAAACTAC
CTCTGAATGTTTGTTTGGCGTCAATCGGTGATGCCAGTTGATGGAACCTTTCTTGTTTCT
GAAATGATGATTTCCAGTCATTTAGTTGAAGTAAATGAACAAGTAGGTGAAGTTGGGAAG
TTGGTTTGGAATTCAGGAGGCTATAATCTAGGAAAGAAAAAAAATCAGGGAACAAGTTTT
AGGACTGTATTTCAGATTACCAGTACGGTCTGAATGGCATCCAAATAGTGGTGCCAATAG
TTGGTGTGAGGTTTTAAAGAGAATTTGGAATTGATATTAATGTAGACATTGGAAAAGAAA
AATGTAATTGGGGAAAAAAAAACACTTGTGATGTGTTGCAATGTTTACCACAAATTCTAA
TGAAACATGCGAGTGAATTGTATAATATGTTTGATGTTTATCAGATGAACTGAGGAATAA
GTGACAGCTAAATCTTCTAATCTCTTAAATTGCAAGAATGAATCATTTGAGCAAAGTAAA
TTGCAAGAAGTGGTGACTACCTGTTGCATAGGAACCTCTATAATGTTTTGTTACAGGCAC
TGAAGAGTGTTATACTGCTAATGGCAATTTCTGAAAAATGGTCAGTAAAATGTAGTTGGG
AAAAGAGAGGAGTAGTGTAATAGAAAGGAATCCAGGGACTTGTCAGGAAGAGAATCTCAA
GGACTTCTTTCAAGAGAAAAATGACATGAAAAAATGATTTCCTGTTTTTTTTTTTTTTTT
TTTTTTACATGTAGGGGATTGTTGCACCTAACTTAAGTTTATTGATAGGTACCAACCTTA
GTAAACTATTTTAATCCCCTGTCACCCTCAGCCCCCACACTCTCCCCCTTAGCCTTGTTA
TATCTACAGTAGCGTTGCCCCTATGGTCTAAATGGCTGGACCACTCCTGGTGTTCAAGGG
GGTTGTCTGGGTTGTCTGTTTGGGGGTGTTTTTTCTAACCAGGAAGGGGTGGTTATGAGT
AGGCTTCAGTTGAAGTTGTGGTTTGTTGCAGTTTGTGTCTGGTTCTTTTCAGTGACCGCC
TGAAATGTGTTGGTAGTATGCTGTTGCACTACATGTGTTATTTTTGAGGTAAAATAGGCA
GGGATTAAGACTACATGGCACTTAGTACAACTATGGCCTCAGCAGGCTTACTTTCTTATG
ATTGCCTGCAACATTCATGATTACTAGTAACTCTTTTCTGCCAGAGAATTCATTTGGTTG
TCAGTTTGCCCTCCATAAGCCTTAGAGAAAGAGGATTATTGGTTGGTGGCCCTGTCTGTG
GCAGGGGGGTTGGAACTTGGTGATACTTGAGGACCTTCCAACGCATGCCATTCTATGATT
CTGTGAATATACATGAGCATAGGCTGGTCACAGAGTTGTCATAGAGGCCACGTCCAACCT
GTAGGAAGCAGTTTGAGTGCTAGCTTGTTTTAAAATAAAACAGTATTGCTCTGCCTTTTC
ATCTTATTGGAAATCTTAGTCTCGTATCTTACATCAGTAAGAAGTTCTATAATTACTGGA
ACTCTTTCAACAAAAGCAACTGTGAGATTAATATCTGCCTTTAATGGGAAAATGAAATTT
ACCTGAAAGGTGACGTGTGCTTATTTTGTATCCTGTTTGCAGGACTGTATTCTTCCTTTG
AGATCGTCCTCTATTTAGTCTCTTTAACTGTCTAGTTTTTAAATACACAAAACATTTATG
TCTGTAATTTTAGATCTATTGTTGCACAGGATTTCTGGCTATTACAGACCAGTTGCATCA
AATAAATGTTGACTTGCTGGGTTGGTGGCTTTGTGAACGTCAGCTACCTTCTGGAGGTCT
CAATGGGCGACCGGAGAAGGTACTAGATGGCTTATTCTGTTTGTTCAAAGCTTAATGTGG
AGTATTTTTTCTGGAACACGGTGTTACTTTGAAATGCTCAGTAAACTCAAGAGATTCAGG
CCTTCATTTTGATTCTTCATTTTGTTGCAAGCGCTTTGCAGTTCTTGGCTACTCATAGTT
TGGTGCTTCAGTTGAGGAAAGTATGTGTACTGAAATATGTCTTGCTGGCCAATTCAACCA
GTGTCTTATTAAATCAGGCCTTGAATATTTTCTGATGATGGGAATGATCCCTTCTGTAGG
ATTTGTACAAAAATTGTTTCATTTTATCTGCATTCTGTGTATAATGATGTTTCATGTTAC
AGTAAGAAATTGTGTAACTTAGAATAATCCCCACTGGAAAATAGACAACTAATCAATATT
CAAAATATTAAAAAAAAAACCCTAGCTTGTTTTCTTTTTTTTTAATATGAAGCTTGTTGC
CTTTGCTCAAGAAAAAGGCAATGTAGATTTGTAGCCTGTCACACATGAGATGAAGGTTGT
TTCAAAATAACATTCTTGTGGTCTTGTTTCTTGAAAATGGCAAGGGGTTATCTAAAAAAG
AAACTGCATCCAGAAACTTGCTTCCTGTACCCCAGAGAAGCATTGTTTTTATGCAGTGAT
GTTATGATAGCACAGCTAGGAGGAGTTCATAGAATCACAAATTTGTGATGTCATGTTAAC
GATGAAATCAAATAATACTTTGCTTCTCTGTTTGCCAGTTACCTGATGTATGTTATTCAT
GGTGGGTTCTAGCATCTCTGAAGATGATTGGTAGGTTACATTGGATTGACAGAGAGAAAC
TGCGCTGCTTTATTTTGGCTTGCCAGGATGAGGAGACTGGAGGATTTGCTGACAGACCAG
GAGATATGGTAAATAATCTTCAATTAAGTCAAGTTTGCATAACAGAAATTCTCAACTTAA
AAAGTATGTTTCATGTTTGAATGTAACATGTGATCCAGATATTGGTGTTTTGCAGAATTG
CAACATCTGCAGCTGGGAAGGAACAAAGTAGAGTTGCTTTAGAAGGCTTACATAGGAAGC
ACATGCAATTGTGTGTTGCACGTGCTCTATAGCAGCTGACTTCAGTGTGGGATACCGTCC
CCATAATGCATACCACACTGTTTCTCATAAGACCGCATGGAAGATCTAGGTGAAAACACT
GACAGTTCAACAATTTGCAGGCATTTAGAGACCACCACAGGTTAAGTAGTCTTCAGATCT
CTTTGTGCTTTTGTCTGATCTGAATAATTCATGAGTAAATACTCAGAATAGTTACACACC
ACTGCATAAATCCTTTCACTGGCACTGGTGTAAATGAGGAGGAAGCTTTTGTGATGACAT
TATGAAGAGGCTGGTTGTATTAATTTTCTCCTTCGCTGAAAGAGTAGTTATAATTGTTGT
ATTCTCTGTGGTTTAAAGCATAAATAATTGAGATAGTACAGGGTGGTGGTCGAATAAAAG
TATTACATGATCTCAGTGCAGCTACCCTTGAATACATGGCTGCTTATTTGTGAACGGTTG
GAAAATTGTGGTTATAACAGCCAAGGAGAAAGGCTGGTTATGCTAGTGTAGTTTTAAGCG
TTTAGGCTGTGATCTAGTGGTTGGATCTCGTGTATGTGGCTATAACATGATAAACTAGCT
CAGTTTAGTGCAGTATAGGGCCTCTGTGAAAAGACCCAGAAATTCCAATAATACAAACAG
GATGAATGCTGCACTGGGTAATTTTGGATAGGATTTTGTAGAATGACTAATTAAGTCCAC
TGACAGGATGCATATGCAATAAGAATTTAAACAGTCTGCTGCAGTTGTGTTGATACAGGC
TTTCAGGGGAAATTTGTGTAGTGAAGGAATACTTTGATATAAAATAACTGGTGATCTCTT
CTATTTCCTTGTTTTTTTTTTAATTTGGTTTTACTTTTCATTTTAACAGTAGATTGCTGC
TCACCTCTTAAGATTTTGCAGCACAGCTCTTTATTCAGAGACCATTAAACAGCATTATAC
TGTTGCTGAAGAGTTTGTGCAGTTGCAGTGTTATCTTGAGCTACACAAGCTTGCAGTTCT
CTTGCTAACAAACAGAAGCTTCCGTGCCAATGACAACTGATTGTTGTTTTGGAAATGAAT
GGACACAAACTTTCTGTCTTCCAGGTGGATCCATTTCACACTTTGTTTGGAATTGCTGGA
CTATCCTTGCTGGGGGAGGAGCAAATTAAGGCTGTTAATCCTGTTTTCTGTATGCCAGAA
GATGTCCTTCAAAGAATAAATGTACAGCCTGAGCTTGTGAGCTAAATCTCATGGAGACAG
CAAGTTGATATACCCTCTTGGTTTGGTTTTATTGATTGGAAGTCATCTGTGAAGCTTAGA
ATATTCTTAATATTCTTCTTTGAGATGTGTTTACATTACTACAGTAAGGCAGTAGCTTTA
CTGTGGGCTTTGTCACTTCATGAGCTGTATTGTAACAGGCTTGTTGTATTCTGAGTGTAA
TATGTTCTTTGGTTGTACATAAGATGATGTAGAAACACTTCTAATCTGTATCTAAATATA
TGGGCTTTTTTTTAATAACCACGTTGAAGCAGTAGTGTGAATAGCTTAATTTTTTCTATT
CCTGCAATGTCAACCATGATAGCATCTGTCTTTATGCAAGCATGTTTTGATGGTGTATCA
CGCACAGCACTTTAGAAGAATACGGGAAAAAAAACCACCTAACTTACACCATGCACTTAA
TGCCAAACGCTTGTCCGTGTAATTCTTTCTGTTCATGCTTGGTCTCACTTCTATATACTC
AGATGCAAGCTTTGTCTTTTGATAGTAATTGTTACCAGTGAAAGCAACAAAAAATATGTG
ATTCTGTTAAATACAGGAATGTACTCCTATTGCTGGTGAAGCCTCTTTTGTCAAAATTCC
CCCAGTAGTTGAAATGGAGCATACCTTGAATGTATCTACATTGAAAATTACTAATGTTAA
TCATTCTAGAGAAATTCTTTATGGGAAAGTGACTTGCAGCTGAATATAGTGATGACAGTA
AATTTGTTGCTGGACTGAAATTGTGGTGTTGCAGCTTTTAAGAGAGAAATTGCCAACACT
TTATTGTGATGTAATTGAGAGTTAAATTAGCCATGGAAAACACCCATCTCAAAGATGAAA
TCCTTTTGTCTTTGCAGAAGCCCTGAAATTGCACATCACTTTACATCTTCCTGCACACTG
TTTGAAACTGAATTCTACTTCACAGTAAGATGTGGTTGCGAAGGGGAAGAAGTCGTCTTT
GATAATCTCTGTATGTTTGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1147, 2169..2366, 4234..4339, 5550..5602, 5716..5826, 7573..7698, 8438..8587, 9864..10001
1001..1147, 2169..2366, 4234..4339, 5550..5602, 5716..5826, 7573..7698, 8438..8587, 9864..10001
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved