Gallus_gallus Locus Q6EE57_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus Q6EE57_CHICK
Gallus_gallus
Q6EE57_CHICK
8
SNORD39, SNORD38, SNORD38
1673..1757, 3704..3775, 4955..5026
6378
TGAAGGGAAGCCTCCGAAAACCCCACGGCACTCAGAAACCCCACGACACTCGTGCTGTT
GTTTCTACCCAGCAATGGGATAGCTCTGTGGAAGGGAAATCTCAATCCCACGACACTCGT
GCTCATCCTATAGCTCGATCTGAGTGGAGATTCCAGACGTTCTGTGACACTCGTGCTTGT
TCTGCTATTCACCAGCAGTGAGTAGCTCCCCCAAGGGGAAGCCTCCAAAATTCCACGACA
CTCAAAGGATGCCACGACATCCGTGCTTGTTCTGCTTCTCACCTGCAGTGGTGAAAGGCT
CCACTGAAGGGAAGCCTCATAAAACCCCACGGCACTCAGAAACCCCACGACACTCGTGCT
GGTTTCCACCCAGCAGGGGGAGAGCTCCACCGAAGGGAGGCCTCCAAAAGCCCCACGGCA
CTCGCGCTCGGCCTGCTGTAATCCAGCAGTAGGACAGCGGGGCTAAGGGGAGGCTCCATG
AGCTCCACCACACTCGTGCTTGTTCTGTCATTAACCACAACAGGGATAGCTCCGCCGAAG
CGGAGCCTCAAAAAATTCCACGACACTCGTGCTTGTTCCTCTCCACGGAAATCTTTAGTA
AAAGGCGAAAGATTTATACGATCTGAAGAGAAACCAGAGTATAACGGCTTCCTTTCCCGG
CCCTCATCCCCCGGCCCGCCCACCTCCCTCAGCACACGGCGATCCCCGCCCGCCCCACTT
CTCCCGCCCCTCCCGGCCCCGCACTATCGCGTCCCGCTCTCAGCCCCGCACAGCCCCGAG
AGACCCCCGGGAGCGGCGGCGCAGCACAGCGCTGTCGGGTCCCGGCGGCCGCGGTGCACG
CTGGGTATGCATATTATGAAGCTGTATGCTAATGAGGGCCTCAGACAGGCCGGTCAGCTT
CCGGGTTCCCGTCTCTGCGGTTTCTCTTGGCAACGGCGCCCGCCCCCCGTGGCGGCGCGA
TGACGTCACGGCCTCGCGAGAATTCGCGGCGGCATACCGCCCCGTGATCCTTTGCGCCGC
CTCTTTGCGCCGGTGCTGCGCCATGGGTGAGTTGGGTTTCCGCGGGGCCTGCATGTCATC
CGCCGCCATCCGTTCGCTGTGCTGCCGCTGCCTGTTCCTATTCTATCTCAAGTGGCGGCG
GGAGGGTGCCGCCGTCCCCTGCTGCTTATCTTTGGGGGCGGCCGGGGCTGCGCCGAGCAG
CAGGCGGCAGAATGGAGCCCAGGCTCAACATGGCGTCCGGGGGGGGGCGGCCCCGCCGGG
CCTCAGCGTGGGGCTCCTTCATAACGATGTGTTCGCGGGGTGGATCGGGTCTTCCGCCAG
CCCGCAGCAGGTGGGATGGGTTTGCAGGGTGGTGGGGTTAGGGCTGAGTGCCTGTAGGAC
ACTCTGCAGCCTGGCTGGGAGGAGGGCGGGTTCATGTGCCTTTTCCTAAGGGGACGCTGC
CGTTTGGTGGTATGGAGGTTTTTTTCCTTGCACGCTCTGCCAGATTCAGTCGGTGTTTTA
AAGCCTCTCTTGTTGCGGACTGAACTGCTTGATATGTGATGCTCCTTACCGGGTCTTGTA
AGGTAAGCTGGGGGGCTGCGGCCCAGAGAGCACTAGGGAACCCTGCAGACGTGCTGGATA
GAAGCAGCCTGCTCTGTGCAGCCGTGCTGGAAGGGTAGGGATCACGACGCCTCTGAGTCT
CAATGATGAAGCTTCTCTGACTGCTGCATAAAGCTGAGTGTGCTGTGCGGATGCCAACCT
TGGAGAGCTGAGGACTCAGAGCTGCGCCCCGCTGTGGGCGGGTGGGGTCCGTGGCACGAC
CTGACTGCACCGCTCCCTCCATTCAGGTATCTCCAGGGACAACTGGCATAAGCGTCGCAA
GACTGGGGGCAAGAGGAAGCCCTACCACAAGAAGAGGAAGTATGAGCTGGGGCGGCCTCC
TGCCAACACTAAGGTGGGTGATTGGTGGCGGGCGGTCAGTCGATTTCCAGACGTGCTTTG
CTGATTTTAGCAACGAGAGGCAATGGGAGTGATGAAATTTTCACCTTAGGTAGATACGAC
AGACTGTTCTGGTCGTTAACTGTATCTGCCAATGCTGGGGTTTGTCATAGTTACACTGAC
CACGTTGCCTTCCAGCTTAAGCACCCCTCGTGGTGTGCTGCGTGCTGACACCAGCAGCAC
CGATTATTTCTCTGTCTGTAGATTGGGCCACGCCGGATTCATACAGTGAGGGTTCGTGGT
GGTAATAAGAAGTACCGTGCCCTTCGGTTGGATGTTGGCAACTTCTCTTGGGGCTCTGAA
TGTAAGTACATCATCGGTGTGATGCGACTGAAATGCGTTTCTACAGCTGTGGCAGTCTGC
AGGACTGCTAATGGGTGAGAGGGGTGATGAAGCGAGGATAGATTTTTGGGCTGGATTTGA
AGCAGTACGCACGGTGATGATAACTGTGACCTTATGTGGCCTTGGGAGGCTTGGATGTCT
GCTGGGTTCACAATGATTGGGGTGTCATAGTTACACTGAAGGGCGTGCTTATATTGCCTG
CTTAATGGGATGGGGGAATTACCCTGGGGCAAAAAAAGAGGCTACCTACAGATCTTCATA
AATGCAGCTTGTATGCTGAACAGCTTATTGACAAGCTCACTGTTTCTTAGTGATGGAAGA
GCAGTGTCTAAAATGAAAAGTGCTGTCATTTGTAGGCAGTACTGCAGTAATGAGGGGACT
GAGCTCACCTTGCAGAACAAGGATGAGGTACATGAGTGAAGAGAGGGAAACCTGTTGGTT
TTTTTTTTTTACCTGTCCTTTGTATGACAGCTGCTAAATGCAATTGCTGAATGCTTCAGG
TGGGCCATGAAGAGTGAAAGCCTTCCTCTATCAATTTATTCAAAATCTCTCATCCTGTAA
AAATGGCTCCCATTCCATGCTGCATTCAGCTCAGCTAATTTGGCAATTGTAGGAGGCACG
TGCAGGATTGAGCCCTCTGTGTGGTGTTGGTTGGCATCTGCTAAGGTATCTTCCGCTCCA
GAAATCTGCTGTTGAGCATTATTTAGTTGTCTTAGAGATCACTTCATTCAGCCCCACAGG
TTTCGGTTTCTCATCTACGATGGATCTTTTTCCACATGCAGACTTTCGTTCTAGCATCAG
ATTTGAATTGATGGAATAACAAAAGATAAATGTCAGCTAAATTAAAGTCAGTGCCAGGGG
GCTGGAGGACATTTGAGGGGATGATGTGAGCTGGCTTTAGGGTATGCCTGAGATGCTGCA
GAGTGTATTCTCAGCTGTCTGATCCCTATAGGTTTGAATTCATGCTCTTCTTTTGAAAGG
CTGCACTCGCAAGACCAGAATCATTGATGTTGTCTACAATGCTTCCAACAACGAGCTGGT
GCGGACAAAGACCCTGGTGAAGAACTGCATCGTTCTCGTTGACAGCACGCCGTACCGGCA
GTGGTACGAAGCCCACTATGCCTTGCCCCTTGGACGCAAGAAGGGTGCCAAGCTGGTACG
TATGCCTGGAGTTGCTCAGTTTCTTGGGAGCTAGCTGTTGTGATGTGAGTGAACAACACC
TGCCAGCACTGATTGGGTTCCTGGCAGTGATAGTGCTGGTCATGTGGGCTGCCTTCCCAT
CAATTCCCAGAATAAGTCAGGTTCTGTTAAGGGAGTATTCAGGACCACAGAGTTCTCTGA
GATATCACACTTGGTTGTGCACAAGGGCCTGCCTGCAGATCTGTCTTCTAATGATGATAC
TTCTGTCCAGTTCTGCTACTGAAGGGAGAGCGATGACACTTGTGATGCTGAGGAAGACTT
TGCGGTCAGGTCCTTGTGCTGAGGGATTGCTGTCCTCTGATTTAAAAGCTCATGGGCTAC
TAACTAAACTTGTACTTGCTTTTAAGTGTCTTAAAGTGTCTTTATCCAGTTTCATTGTCT
CAAATTTCAACATCCAAACTCTAGATTGTTTAAAGTTGAACACCTGTGTGTAGTATTCAG
CTTAAGGTGGTCTTGTATTAAAAATAAAGCCCTCGTTGGCTCACCCACTGTGTGGTTCAG
AGCACGGAGAGAGCTTATAAGTTGTCTGCCAGGAATTGCACCACACCCGCGTGCTCTCAT
GTCTGGAGAAGGAGAGTATTCACTTTCCTGGGGGGATAACTAATTGATGAGGCCTTTGCA
GTTTCATCTGTCTTGGGGTGTTTCCTGAGGACACTGTCCTTTGTTGTCAACAGTGACTCC
AGTCAGTAATATTTCATTTCTTGACCTCAAAAGTGAAAAGCAGCACTTGATTCTGTTAAG
TATTTGTGCCTTGAAAAGGTGTGACTTGGGACGTAACAGTACTTGTAACAAAATCCTTCT
ATTTTCACTGAAGATCTGCTCCTGCAAGAAATAACCATGTACTTAACCTTGTCTTCAGTT
TATGCTGACCTTGTCTTTACATATGGGCTTGTTTTTAGACACCTGAGGAAGAAGAAATCT
TGAACAAGAAGCGTTCAAAGAAGATCCAGAAGAAATATGATGAGCGGAAGAAGAATGCCA
AGATAGCCAGTATTCTTGAGGAGCAGTTCCAGCAAGGAAAGCTACTGGGTGAGTCCCTGG
GAGCATTAGTGTAGGTGGGGATGAGGGAATCAGTCAGCAGTGCCAGAGCAGATACTGTTC
TTGTTCCTGGGATCACATCAAGCTGTGTCTACGAGCTATGATAAAGCTAACTGCAAGGTG
AAAGCAGTGGGAGAGTTCTCCCTGCCTGCACGTGTGTCTTCTGGGTGTTAAGAGTAACTG
TTCCTGTACTTCATCTGGAGATAGCCCAGCACTGAAGCACTGGGAGAGACAGGTAGCAAA
CCTGCCTTTTTAGCCTTGAGGAAGGTGATGGGGCTTGAGACCTGCAAAATGAGTGAAGAC
ATACGAGTGTACTGTGTTTCAGGAAAAGCTCAGCATGTACATGAGCAGTTTTAGCACTTT
CAAGTTTTGTTGTGAATAGTTCAGTGTTTTGAAGTCTTCTGGTGATGAGACCTTTGTCCA
GTTCTGCTACTGAATTTGAGGGATGACTGTTTGGAGATCTGAAGAGGACTTCATTGTGGG
TGTAGAGCAGGTTCAAGAGCACGGTATCTTGGGGGAGGTACTTAAACCAGCACATAAGCT
GGAATGAGCAAGGACCAGCAACGTACATGCTTTTGCAGAGAGACTGCAAGTAATGTGTTC
TTCAATTTGTGTATATACTATAGGGAATTATTTAACTTAACTGAATGAGTTCTCCTTGCA
GCCTGCATTGCCTCCAGACCTGGACAGTGTGGCCGAGCTGATGGCTATGTGTTGGAAGGC
AAGGAATTAGAGTTCTACCTGAGGAAGATCAAGGCCAGAAAAGGCAAATGAAAATCAACT
ATTCTCCTGAAAGAGCCAATAAACATGCGCGTCTCCTGTAATAAATGGGTCGTGTGCTTA
TTTGTGTGCACGGGGGGCTTGGCTAGCTCCTTATGATACATGAAAGCAAGAAGGCTCTCC
TGGCATCACTGAGTACTTTTCTGTTTTGAGGTAAACTCTGACCCTGCTTGCTGTTGATTA
AAACCTCTCACTGGGTTCTGCAGCGGTGCCTTAGTGAACCAAGTGGATGTGGAAGAGTTG
TCAGCAGGGATCAACAGCTGCCTGCTGCCTAATCCCAGAGTGCCAAAAACTCAACATTGG
CAACTTTGGGAGATTTTTTTTTTCATCTTGCACAGATATTTGTAAAAGACATGGGATGAA
GCTCAAATGGCAGATTTCCAATACTAAAAAAACAGGACTGCAGAGGGAAGGTGTAGATGT
CCATTCCTGCTGGAGTTTGGCTTTTTGGGAGCACACGTGTTCCCCTTCTCCCTCTGGTAC
CTTAGGTAAGCACTGACTGCACTGGGGGCCGTGCCCAGCTGCCTCAGGAGGAGGGTGCCC
ACTTAGCTTCAGAGCTGCAGCAGTGCATTTGTTAGACTGCATCTGCGCTGCATCTGGCTG
AAAGCAGATGTCACAGCCCTGGCCCCTGCAGCTGGTATCTCCTGCCATTTCTCTGTCCTC
TGGTTGGTGCCAGCAGCCCTATTTGCTGTGGCCTGGTGCTTTCTGCCTGGCTGCACGCTC
ACCTTCAAGGTCCAGTATCGTGTCCTAAACCAGCTGTTGGCTGTCTGCACTGGTCATTGA
CTAGCTGGTCTTTCCCTGACCTCCTGGTCTCATTCTAGTGCAAGAGAAATCCCTTCTAGC
AGAAGGGCCAGGCTCTCTTTGTGGCCTACCCCTTTCGAATGCTGGGTACAACCTCCAGCT
TTTTACGTTGTCACATCAGGATTGGGATGCTGTGATGAGCTTTTTCCCCTTGTTCGGGAG
CGTCTGGTGATGAGTAACTTTACAAAGTCACTGTAACATCCAGGCTTCTAGTTCCCAAGT
GCTCTGGGCAGGCTGAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1826..1932, 2181..2280, 3299..3474, 4418..4547, 5221..5378
1852..1932, 2181..2280, 3299..3474, 4418..4547, 5221..5300
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved