Gallus_gallus Locus RL5_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus RL5_CHICK
Gallus_gallus
RL5_CHICK
8
SNORD21
6655..6750
10649
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCGCGCAGGCGCACTCCGCGCGCAGCCGCCGCGAGGGTCAGCCCCGCGCCC
CCGCAGCGCCGGGCCCGGCCCGCCGGGGCCTCTTTCTCGCGTCGCCGCGGGCGCGGGCGT
GACCGCCGACAACGGGCCGCGCTACTGTCGGCAGCCGAGAGCCGGGCCCGACGGCCGCAG
TTCGTTCGGAGCGAAGCCGGGTGGCGGCCGGGTCTGCCGAGCCCTCCCCGCAGCTCCGCG
CCGCCCCGTCACCGCGGCAGAGAAACGCGACTCGGCCCTCACCTCGCCCCGGCTCTTCTC
GCCGCTGGCTTCCGCGTGTCGCCCACCGCACGACGCGCCGCCTCGCACCGCGGCGCTGGA
GCCCAAAGCTGCCGCCCGTCCCTCGCGCGAGGCGGTGACACCCGGCGTCCGCTCCCTCTC
AGTACCTTCTGGTGCCGATGTAGCGCCCGCCCGGCAGCCGCCACGGTGCTGCCCGCGCGC
GGGGTGCCCACGGTAACGTTCCCGGCAACGCCGTGCAGCCGCGGCCTGAGCCCGACCCCA
GCGGCGCTGCCGGGCCGGGTACCGCTGGGGGCCTGGGGCAGCTCTGGCGCGAGCCCGCCT
GCCGCCGTGCTCCTGCAAAGAGGAGCGAGCAGCTTCGGGCAGAAGCCTGCCGGGGTTCTC
GTTTGTTAGAACTCTCCTAAAAGCTTAAATCACAGAATTGAAGAGCGCTATTAGGAGACA
CGCGTACTACCCTAGGGAACGCAAATATCAGGGACGTAGTCTGAGGAGAAGCAGCAGCGC
CCGGAGCAGCTTCCCACCGGCCTCCTGCCTGGCAGGTCACCTCAGCGAGGCCGCCGAAGC
GGGTCCCGGCACGGAGCGGCCCCACGCGGGCAGCGGACGTCGGAGGGCACAGCCGCAGGG
GCAGCCCCGAGCTCACCGGGGCTGAGCACCACAAACACAGCACGAACTGAGAAACTACAC
TAAGAAAACATACCTGTACGCTTCTCCTTCTACTATTAAAAGTTACCGGTAAAAAAGTAT
TTCATCACAACGTCAAAAATCGGAGCTTTTACCTCAGCGAGTTCAGAGCCCTTCTGAACC
GCGGCCACAGTCCCAGCGAGCATCGCTGCCACAGGTGGGGGCGCGAGGCCTCGAATTTGT
GAGGGCGGGGCGGGGCCGCCTGTCCGCAGCTGGGGGCGCGGTGACGGCCGCAGCGCTGCC
GTGCGGGTCCCGTGTGGTGCGGTGCCTTCCGCGGCACGGCCCCGCAGGTGATCAGCGGGC
GCCGCTGTGCGAGCGCTGGGAAGCAGGGAGAGCGCCGAGCTTCCAGAGCTGGGAGTGAGG
TTTCTGAAGCTGGCAGTAGAGGATCGCACCGACTCTTGTCTGACCAAGGGGAGGTTCATT
CTTCCTTTGGTTCTCTTGAGGCTGTTTGTAGCAAATGAACGACTTTTTAAAATAACGTTT
AATATTCAAAAATGTTTTCGTCCATTCATTTTTTAAGCGAGGCCAACCGGAGAAACGTGT
CAGACGGAAGGCACAGACAGCTCCGTGCTCCTCTGGCAGCTCCAGGCCTCGCCTGTCCCG
CGCACACAGCGGCGGCAGCGCGCTCTTGGTGTCTCCCACCAAACACCCGTTTCTCAAAGC
AGCTCTGTTTCAGCAATAGCATTTCGTTGGGTTTTGGTCGGCTTTACGTTTTAGTTATTC
ACTGTTCGGTCAACCACGACAACGTTCCCTTGGAAAAGAAGTGAATAAAGTCCTTAATAT
TTCTATGACAAATATTTTTAATACCAAAACCATTGTTTTTTACCCTGTGGTAAGAACCCC
GTTGCTGCCAAGCGCCCCCGTGCCGGCACCTGCTGAGGAAGCCGGTAGGGAACCGCGGGG
CGGCGCTCCGCTGCGCACAGCGGAGAGGCGGCAGGCGGCGGTTCTTCCCGCGCACGTCAC
ATCACTGGCCGCTTCGAGAGAGCGCTCCCGCCCCTCATGGCCCGCAGGCGGGCGGGACCC
CCGTCCCAAGGGCGGCGGGCGCGGGTGGGAGCGGTCCCTCCAAGCGCCGGCAAGGGGGGC
GCGCGGCCGTGTTTCATGTGGAAGGCCGGTGCGGGCGGCGCCCCCGCCCTCGGCCGGGGC
AGGCTAGGGACCTTGCGGCTGCGCAGTTGGGAGCGGCCCTTTTTCCCCCCTGCAGTCCGT
TGCAGTTCGTTGTGCGGGAGCGGGCCCCCGGCCCTAGGGCCCTAGACCGTGACCAGTTAC
CCTGGGCAACGAATGGGTCAGGTACCTGGCCCCGGTATCGTGTGAACCCCCCGCCGCCCT
ATAGTGAAGAGATCTCTTGTCCCCCTCTCGTTTTCCCGCCGCCCCCCGCCGCGGCGGCGC
GCTTTCTCTGTGCTTCCTCCCCCCGGGATATGTGGGAGAGCCCCCCCGGAATATTTTNNN
NNNNNNNCTGCCCTCCGTTCCGCGCCCGCCGCGCGCTTCTGCTCGCCCGGATGGAGCCCG
ATTAACCTGGGCTCGCCGTCGGCCGCTGCGGCTCCAGCGTGGCAATGGCTGCCTGCAGCA
CCGGGTTTGCGCCGCGGGGCGGATCGGGGCGGCTCCGGCGGAGCCCTGCGGGTCCGGCAC
GGTCCGGCACGTCCCTGCCGCCCCATCCCCGCAGTCCCCTCGCCGCTTCCCCCTGGGCCG
CGGCCGGCGCGGTGCTGGGGCGAGCCCGGGCCTCAGGCGCGTGGCGGCGAGAGGGAGTGG
GAGCCGCGGGCGGACGGGCGGCAGCTGGGGCCGGGCCCGCTGTGACACGGGCCGCGCAGG
CGGCACCTGGCTGGGGAGCCGGCGGCTGACAGGCCGCCCTTGTCCTGCCGCGGGGTGCTG
CTCTGAGACCTGCAGGCGTGGGGGGCGTCTGACTCGGGGCGGTGCTAGGACGGCTCCTCG
TGTTTTTGGTGGGGGAGTTAGGGTGAAATGGCCGAGGAACTAGCTCTGCGGGAGTGACTG
GCAGGGAGTTGTGGCAGTCTGTGCAGACAAACGTTTCATTAATACATACGATTTCTCTTT
CTCTCTTGAAAACATGAAGTCATGGGCAGGAAAGTTCGCGTGAAAGATAAAAATTCTGCT
TTCTCTTCCTTAAGATGGTTTTAATCTCATCGTGTAAGAAAAGCTGTCATTTTATGACTG
ATTCACCACAGTTTTATCAGTAACGATTCATTTAGTTTGGATGGCTTTGGCTTATGTGGT
GCCATGTTAGTAACATCTGACTTTCCTTATTCAAGGGGTTTGTGAAAGTTGTCAAGAATA
AGGCCTACTTCAAGAGATACCAAGTAAAATTCAGGAGAAGGAGAGGTATGGCTCAATTCC
CTGTCTTGCTGAATTATGTTATATTGACAAATATTGTTACTTTTTTTAACACGTTTTCCA
CACTGTAACTGTTGTTTTTCAGAGGGAAAAACGGATTACTATGCTCGTAAGCGTTTGGTA
ATTCAGGATAAAAACAAGTACAACACCCCAAAGTATAGGATGATTGTGCGTGTTACTAAC
AGAGACATCATTTGCCAGGTAAGGTCTGTGGTGTTTGCCACTTATTTGTCAGCCTCCCGG
AAACAAACAGAAAAGGGGGATTGATGAGGCACTTGTTGGTTGTTTTGATGCCTAAGCAGA
TTTAATATTGCTTTTTGGCTTCCTGGAGAACAATCTTTAAGGTTGACACAACATCAGTAA
TAAACCATAGTCACAATACAGAATAATTTTACTAATGTCAACATTCTAAAACAAGGTTGT
GGTATGAGCTTGTACTCTTCTAATGATGCTGAAATATGTTGAAGGTTTTAGGGAAAAACT
TTATCTTTTCTGCTGTCTTTGAAGTGCTTTGAAAAGAGAGATCTTTTTTGTTTGCTTGAA
AACTGCCGTGTGACCTGTCAGCTCCCTTATGTGATATCTAAAGGTGCCCTCACTTTCCAG
CCTTTTTACTGTGATATTATGTGGATCGTGTGAAGCAGATAGGCCTTAAGATCATTTCAC
TGAGATTAAAAGAGAGTGATAAATAAGAATAGTAGGCACCTTTTTGTGGTACGCGGTTGT
ATGTTGCATCACGTAATGCAGTTTCTCACTGTGGTTCATTTTCCTGGTTCATTTCCAGAA
CGTTCTATCATAATGCATTTTGTAAAGCTTAAAGATAGAAAGTTTTCTTGTTGTTTCTTT
CTTCGTTAAATAGTTTTATCTGTGGAGAATAGTAAAGAGTGCTGTTTTTAATCAGCTCAG
ACTAAACTATATGACCTTGATGAATTTACTTTATCTCTGAAATTCAAAACACAAATCAGT
GTGGCAGGTACTGTCTGACCAGCTGTGCCTTTCCAGAGGTGGGAACTCTGGAGAGGGGGG
AGTAACTTTCAGAGGCAGAGGAGGTGTGGAAGTCAAAGGGAGATGGTTCTGATGTTATTG
CTGTCTCACAGGAGACCCCCGAGATTACAAGGGTCTTTTATCTTAATACAGTCACTCTGT
AATAACCAGTGTCCTCACAAACACTCGCATATCTTTACATTTTCAGAGGTGAGTTGTGTT
CTGTGTTATTTGAGAACTACATGCAGAAAGGAGGACAGAATCTATCTACATATGTAAAAA
TTCCTTGAAGCGTTGCTTTTGTTGGCAGTTTCCTGGTCTCTTGTCTTATATGAAGAAGTA
AATAAAAGTGGTTGCCATCATTTACTTTCTCAAAGCCAAACATGGATCTGAAAGCTTACC
TTCACTACTTAAGGATTTAATTACGCCATAAGAAATTTTGAAAAGCAAAATGAAACAGAC
TGCAGACAACACACTGCTCTCAAGAAAAGCAATTTGCTGGACATTTCTATACAGAATTCC
TGTTGGCTTAAGTAGATGTCAAAGAAGTGGTAACCTGAGCCCACAATTACAGTGAGAAAA
CTAATGGTTGTTTTGTGGTTTTTTTTACTGTTGTCAGATTGCCTATGCCAGGATTGAAGG
CGACATGATTGTCTGTGCTGCTTATGCCCATGAGCTGCCAAAATATGGTGTGAAGGTTGG
CCTGACCAATTACGCAGCAGCGTACTGTACAGGTCTGCTGTTGGCACGCAGGGTAGGTAT
CTGTCAAATTGTCTGGAAGTAGTTGCTCTATTTTTCGTAAAAAAAGGGAAAGCTAGCTCA
CTGTCTTAAGTGGTATTGGTAGTATAGATAGCAGATTCTGTGGGCTTGTGTAAATGCTAA
CCTGTACTCTTTACCGTATAGATTTGATGGCCTCTTGGGACTGTCAAATCACAAAGAGAA
GTATGACAACATGCAGTTTCAACTCCGGCAGCCCACTTTTAAGTCTCTGCACTTAAGTTT
GGTGGAGGGAGGGAGTCAGGACAAAAATGTAAGAAATGTACCTTCAATAAGAATTTAAAT
ACGTGAGCTGAATTCGTCCATTTTCCTATGAGCTTGTGGATAGGTCTGAAGTTTACTAGT
GTACCTGATGGAACAAGAGATTGAAATGTAACAGGCATGTTTATTGCAGTAGTTATTATA
AGTGTTAATACTAGTATGGAATGTGTAATTTTTGTAAAGAAATTGTTTTGAAAGTATGAA
GATTCTGTTGCAATTTTGTGTTCTAATTTGGTGATTCTTCATTTTGGCTTTAAAGGGGCA
GAATTTCAGAAGTGATGCTTTTGTTTTTGCTTTTATTTTTCCCCACAGCTTCTGAATAAA
TTTGGTCTTGATAAGATCTATGAAGGCCAAGTTGAAGTGACTGGAGATGAATACAATGTG
GAAAGTGTGGATGGAAAGCCTGGTGCTTTCACATGTTACCTTGATGCAGGTCTTGCCAGA
ACTACTACTGGAAACAAAGTTTTTGGTGCTCTGAAGGGTGCAGTGGACGGTGGTCTGTCC
ATCCCTCACAGGTAGTCATCTCTCCAGAAAAACTCCTTTAATTACCTGAGATAATTCTGT
GTGTGACAGTCTACTTATAGTGCCATTTTTATGCTGAAATTGCTATTTTTATAACCTGGT
AATGGTTAATTTAGTGCAGGTTCTGGGATATGTTTTAGTTTAGTTGGGCTTCTTTTACTC
AAAGTTGCAATTCTAATAGCACTGCAGAGAATCTTGTGACTAGTAAGAGATGCTGTTAAA
TTTTTAGAAACTAAAGAACCACTTCACTGCTTTCACTGAAAACCATCCGGTGATGGTTTA
TTTACCAGCACTGAGGTAAATATTCGTTAGTTTTCACATTGTTTCAAGACTTCAGCAAAT
TGTGTGTACGTGTTAATTTTGCTGTGTGTATATATGAGATCCAAAACCAAGCACTGGTGT
TTCCCACATTTGTCGAGACAGTAACAGGTCTGAGCAGTCCTCCTGCACTTAAAAATTTCC
ATGTAGAGGTTTTGGTCATTCTCGTCAGAGGAAACCTGTGACCAAATCAGGATTTTGGCA
CTAACACTACGTTTGTCTGCTTCTTTCAAACAGCAAAGTAGGGAAGAAACATTCGATTTC
CGTAGTGGATTTTTGTATTCTCTCTTGCTGTCCTGGAGTTGTGTTTTCTTGTTTGTGTTT
TTGTTTAATCTTTCTGTATGTCTTTACTAATTCTTCATTTGTTTCTAACCTGGCTGCTAT
GTGATGATACCCCAATGTCTGACCACTCCGTAGTAGGTCCATGGTGTGTAAATGATGGAC
TGCGTAGTTTCAAGACGGGACTGATGGCAGCTGAAATGAGCTTTAAAACTTGTTTCTTCT
TTTTCTTTATATTCATTTTCTTTACACTTCCATTTTTAATTAGTGTCCTATTTCTCAGTT
ATCTATAGCAGAATATGATCTTAGTCATTTCTTGGTGGAACCTGCTTTTCAATCAGAGTG
TTTGGGGAATATGTGTTACTCAGAATTTAACTGCTCTTTCACAGTACCAAGCGTTTCCCT
GGTTATGACTCAGAAAGCAAAGAATTCAATGCAGAGGTTCACCGCAAGCATATTATGGGC
CAAAACGTGGCAGATTACATGCGTTACCTGATGGAGGAGGATGAAGATGCTTACAAAAAA
CAGTTCTCCCAGTACATAAAGAACAATATAACGCCTGATGGGGTAAGATTTATGTCTGCC
TCTTGTCCGTTAGTAGCGACACAGATCTTGTATAGGGTTTTCTCTAGTAATGCAATTAAG
CTCAATATGTAAAATAGTAATGTGATTATTTTGTATTTTCTCCATCCAGATAAAAATGTT
TTTTCCCTTATTGAGGGTTCTATAGCATATAGTAGGTTTTTTGAACATGAGGGCATCTTT
CCTGCTTTGAAGTTTAACATCCTGCTTATTTAGGACTGCATCCTAAAACAGCCTACGTAG
TTTTTCTGATACAGAAATTAACACTTAAGTTTCTGTGCTTGGCTACCCACTCGTTCCTAA
TCCTGCACTGCAGCTGTGGTTTCTGAGGATCTGCCTTCTGTCAAATTTGTTTTACAATAT
GTGACCTTATCGATAGCTGTAGGTTCCAGGCAAATACAGAAAATCCCAACCTAGTTCTGT
TGCAGAACTCACCATCTTCTGAAATACATCTGGTATTATGCGTCTTATGTCAGTATGACA
TGGAAATTTTGAGTATATCACAGAAAACACTAAAAGATTGGTATAATTACCATGGTGCTT
TTTTAACTTCAGATAACTTGTCTGCTGTTTAGTTTCTATTATTAGTGGCTCTGAAATTTG
CAACATTTGTATGTTCATTTTTTGAGTTGTAAAGAAACAAGTAACATTTTACTGTAAATG
CCAACTTTGTACATATTACTAAACAAGCTGTTCATTCAGAGAAGATTTTCCTATTAAGTG
TCTAATTGTCTTAATTAGTCACCAGCAAAAATACTGAAACTGGGGAGAAAGGAGGAGGCA
GAATAGGGTCCTCTGGTGGCTTCTGCTGTTGATCTGTGTAACTGGACAGATCACCACAGT
TTTCCCGTTCACATCTTAAAGAATTATTATTTCTGCATACTGACCTGCTACCCAAAGGTC
TGTATGTTATAGTACCATATTAGCTGTCAGAAATGACTGCTTTGGTGTAACGTCTGCTAC
TGTATTTCTGTTGTTGCTAGCAGACTGTTGCTACTGGGGATGATGCAGGATCTTGTGTGA
TTGGTTAATTTGTAGCTGCTTTCATATAGCTTTTCTTACTAAGCAGCTTTGTAATGTATA
CTGGGGTAGGGTCTGACAAGTAGTAAGATTCCATCTGATGAAAGGGTTCATGTAAAATAA
TTCTCGTTTAATTTAAGAACTAAGTTTTCAGAGCACTAAGCTAGATAAGGGAAGTAAATG
ATTTTTTTACTGAAGGCAGAAGCAGAACAAGATTCTGTATTGCCTTTCAATTTAAGTGTA
GGGAAACCAGACCATAGGAAGCAAGCTTCAGAGGAAAGAGCACTTCCACTGCAAGGTGCT
AGCCTGTGCTTACAAGACCTTTAAGTAGTCTGTAGTTAAGCCTCTTAGTCCACCAACTGT
AAAATAAGGATGAAAATAATTCCTTAGTTTTGTATCCAAGTTGCTATTTTTGATATTTAA
AGACTTGGATATTTCTAGTGATGGCCAGGAATTCTTGTCGGTTTTAACAGTGATTCGCAT
GAAGGAAACCTCTTAAAGGAAATCATTGTAAGCTGTATTGTGATGATAACTGGCTCTAGT
GCCCTCTTTGCTAGGGATATCTTAGTATTTGATACAATCTTACAATGCACCACTGGAGAA
CTGTAACAACTTTTGCTTTTTCAAGATGGAAGAAATGTATAAAAAAGCCCATGCTGCTAT
ACGGGATAATCCAGTCCATGAAAAGAAACCCAAGAGAGAAGTCAAGAAAAAGAGGTAAAC
ATGAACGTGTCTTCAACAGAGAAGTTATTTCAATTAATGATGGCACCAAGTAGACTGATT
CCTATGGCGCTTGTGTCAAAACTCGTTTTTAGATCAGGTTAAGATACAATGATTTATATG
TAACTTTGTCAGGAAAGAATTTGAATGTGAAGAATTTACAATTTAAAGGCTTTTAACCGT
GCAAAAAAACAAAAACAAAACCTCAAACAGTAAAGCATGTCTTTGGCCTGAATAGCTGGA
ATTCTTTAAGTCTGTATTTTAACACTTGGATATCTCAGGGGCAAAGCTACTTCCCTTCAG
GAGAGGGCAGGCTGACTCGTGTCAGTACTAAACTATTTCATGTTTTTCAGAAGAGAAACT
TAGGCACAGACGTTGGAATGGACATGATAGTGCCTAGTCACTTAAGAGCTTACCTCTTGA
GAAACTATTTTTTTTGTGGTGCCCTAACTAAAGAACTTGAGAAATAGAGTAGGATACAGA
AGTGGTACTATGTTCTAGCATAGAATTCTTAGTCACAGTTCTGATGTACATCAGCTTCAT
TCATCACCACTTCTGCCTCTTTCTGCTTTGGTTAATAATAGATTATACCATTTGTTTACG
TTGCAGAGTGAACAGTACCAAGATGTCCCTCGCCCAGAAGAAAGACCGTGTTGCTCAGAA
GAAGGCTAGCTTCCTCAGGGCCCAGGAGCGTGCAGCTGACAGTTAAGACAACTTCCACAA
TTTTCTATGAAGCTTTGGAAAAAGTGGCAATAAATTTATTGACTAAGCAACTGTGTAAGA
CTGGCTTATTGATACAACTTAAAGATAGGAATATTTTTTTATAATCCAGATACTCTGGAG
CCTTAGTCTTTTTTTTTTTTTATATGAACTCATTCACTGAAGATAAGTGGTAAAGACAAA
GCTACCACACTACAATTCTTCCCCTAACAAGGGGAAATAATTTTGATGAACTTATAGTGT
GATTAGGTAGAATTTGTTCCTTTTAACTAGAGGAAAACTTCAATTAAAAATAAATAACCT
TTACAGGCGCTTGAAAGTTTTTCTTTCAGTGTACATAATGCTATGAGATGTGTATGTACC
TTAAGGAAAACAAACCTCCATTGTAGGTAGCCTTAAGCTTTTAGGAACATGAATAGCAGT
GTTTTTCAGACTGTGAATGAGTATAGCTGACAGTAATACATGTTGAAATATTGAAGATTC
CTCCACAAAGTGAAGTAAGTACTTACAGGTTCTGGCTGCTACTGAATCAGGTACTATCTT
AAAATGAAGTATTTTTTATTATTTAGGGATTAGACAAGAGAACTTACTCTGAAGTTGAGT
ATATTTGTTTAATTATAGAGGTTGTAACTTGCCTTATTCTACAGCTGCCTGTGAAACTGA
GATGCTGAAATTGAAGGCTTTCACCAAGTAGAATACACTGATGAATTCTTTGTTTTAAGA
TACTGATAGGTGGGAAGTATAGCTATTGGGAGGGGGGGGAAAGGAAGCCTGTTAGTAATT
GTAAACAAAAGTATATATGTATATATATTTTTTTCAGTGACAGCTCAAGCTTGGCACAAC
AGCAATAAAAATTAAGGTTCTGTATAGTAAACTGCACTACTAAATGTTTTCCAGTTTTTC
AAAGAAGCTGTTCAAAATGCCCACCAGTACTTTGGGTTCGGTAATATTTTTTGCCCCAAA
CCTTGTAGCAATTAGTCATGTTTCCACCAAGAATATCCTGCTTTAGATTTCAGTGCATTG
CTAGTTATAAATACTAAATTAGACAATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1233, 3335..3404, 3502..3617, 5017..5151, 5748..5950, 6944..7121, 8785..8873, 9486..9649
3335..3404, 3502..3617, 5017..5151, 5748..5950, 6944..7121, 8785..8873, 9486..9582
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved