Gallus_gallus Locus ENSGALG00000021873
snOPY snoRNA Orthological Gene Database
Gallus_gallus ENSGALG00000021873
Gallus_gallus
ENSGALG00000021873
8
SNORD81
4939..5017
6173
ACTGGTATTTCACCATCCACACCAACAGATTGGAGAAAAGTGCTCAATGCATATTTCAA
AAAAGGACCTGTACTGATTAGGGTTTGTCATTAAATTGGAGAGCCTGTGATGTTTTCAGT
ATTAGAGTAGTGGACAGAAGTGATTTCTGAAAACTCTGTGCTGAGGCTTTTTTCCATGCT
TACTGTCACTGCTGGAGATACTCCCTAGTTCTGCAGGCATTTGATGATGTCCTATCTAAC
TTTTTCAGGCCTGCTGCTGAATATGAAGACTTGATGCTACTTCCCGAGGTAAAAGTTATT
GGAAAAGAAATCAAACATTTAGGGGCTTGCTGTTTGGATCTTATTTTTCATTTTAATTAC
CTCAGTGGGCAGACTTTATTCCCTGAGTTAAGTTAATCCTCTGGTGCCACAATGATGACT
GTATAGTTTGCTACTCTTGACCAAGAAAATGATGAGAGCTCAAACCACCATAATTTCTAT
CTGAGGCACAGCGACTTAGGATTCACCTTGATAAAATATTTTGACCTTGCATTTACTTTC
ATAAGCTTTTTCTCTTCCAGGATTTGAATAATGCACTCACAAAAGAAACTTCATCTGGTA
AGAAACTTTGTGCAGTCTGTGTCTGGGTTTGTTCTGTGTAGCTGCTGAGTCACTGCAGTG
AAAATGGTGGGATGCATAAAATGGGATGGCAGTGCTTTGGGATTAATTGCCACTAAGGCA
CAGAAATGGGTACTTGTTAGTATTTCAAATACTCTACAAAGATTTTACATGTTTTATTTT
GGGTAATTGAGCTTTTTGAAGTCCTTGCTGGATGACTGCTTGATACTACTACTCCAAAGC
AGATACAGTGATGATAACATAGTTCAGCAGATTATCTCGTGATGAACTATGTTCTGTCTT
TCGCTCCTATCTGATGTATCTAGCTGTTGTATCTAGCTCCTTGCTAGGGGGTCTAGACTT
GACGAAGAAAGCTGAGGGAATCTGATTTTCTTTTGTTGCAGGCACTGGGAAAAAACAAGA
TGAATGTGCAAGGTAAATATTGCATTAACTACAGCAACACAAACTAGCTTTCTGTCCCTG
ACCTGTGAGAAGGCTGTGTATGATGACAACATAGTTCAGCAGATAACTTGTGATGATCAC
TCTACTGGTCTTTCGCTCCTATCTGATGCAGCCTCCTGTACCTGTGGTAACTCTGGCAGA
CAGCTCATGTGGGAAGCTTGGGTGAAAGAGTGTACTCACCATGTTGTTGCTTTGCAGTTT
GCCCTGTATGGAGATGGAAGAATGCATGTGCCCAGCAGTTAATTTACCATTACTGATGTT
GGTGAAGATGTTGCCTTTATAACTGAAGGTAATTGAACATATTTTAGAAGGCTGCTATGT
TTGACTGCTGTATTTCTGGACTAGGTCATCTACAGTGTTGCATTTAGGCTTGCATTTAGA
GATTAAAGTGTTTGCAAAACTATATTGCTTCTGGAAAATTTGAAGCAAAGATACAAGTGC
CTTAAGTATGCCCTATGGTCCTGTATACTTTCCAGTAAAGTAAGTAAAAATTTTGTGAAG
TGTCAAGGATTTCTAGGGTGTTCCTGCTGAGACTAAATGCAGCAGTGCTAATTTAGTATC
TGATATGCTTTTTCTGGTTTAGGCCAGCTTGAATGTTTGCATGGTGTTGAGGTCTCTGAG
CTTTTTTTTTATTGCTACCTTTTTTCTAGCAGTTAAAGGGTAAGATCCCAAAAATGCTGA
GGGGAGCTGGGGGATAGATTTGGGCTCCCTTGTGGAAGATGGGAGTGTTGCAGTCTGCTG
TAAATGATGTTGAATCAGGTCTCTGATCCCAGTGAGGATAAAACTTGACTAAACGCTGAT
ACAGTATTTGACTGAGCTGGTTGTTCTTGAGCTCAGAATTTTTGTTGGATCACATCTAAT
GGCAGCTTTTCCTTTGCAGACTTCGGAGGTGTTTCTGATCAAGAGGTAAGTACTTGTTTT
TAACTTTGAATATTAGCATAACAAATGTGGAATGTGCCTGTGAAATGAAATACCCAGATG
AGGGAGGAGAAAAGAGGGCAGTGATGGCTGCTACTTACATTCCAGCCAGACCAGAAGGAT
GTGTAAAAGAAGTGCTGGATAAGACCCATCCTACACAGACTGGCTTTGCTGAACTGCATG
CGTGCTTGTGAAATTGTTGATAGCACATCTGGGTCCATCCTGTTCTCAAAACAACCGTAG
CCCAGACCAGATAGCTGTTCAGTGACTGAATGTGTAAGCTGCCTGTGTGATGAGACATGA
ATACACTGACTTCAATCATGGAGGTCTGCAATTAGCTCTATCTGACTTCAGGCATCTGAC
TAGATTTCATTCTTCTGTGTTTGTTTTTGTGCTCTTCTGACCACTCTTTCTTCTAGTGCT
GTTGTGGAGCTGTGAAGTGGAGCAGTTGTTTGTGCTACAGGCAAAAGTGAGTAGCCAGTG
AATTTGTTACTGGTAATTACTGTGTGCATATGATGGGGAAGTGACTAGATGTTAGCCTCT
AATTGTGATGCCATCTTGTAGCTGCAGGATTATTCTCTACTTCCTGCAGTAGATAATTCT
ATAGCAGCCATCAGGCTTCACCTGCCAAGGTAGTCTGTAAACAATGTGATTGTACAGACA
GGCTAGGCATGTCTTACAGGGTTGTAATGATGTTGTCAAATGTCTGACCTGAAACTACTA
ATGTAGATTTCTTTTTTTTACTGAAAAACCCTGTATCTGGCAGTAGCCATAGCTTTGCTG
ATGATGACTAATAACTTGAAATGGGAAGGAATTCTATGTGGCAATGGATATAAAGGGAAA
CAACTTTTCTTTGAGGTTTTTACAGAGGTTGATATCTAGGGGGGTATAGAAAAAGTGCTA
CCTATTTTTGAACTTTTTTTAGTTTAGGATCTCTCCTAGAGGAGAATGCTTTGGAGGTAG
CTTTGCTTTTTTTTTTTTCTGGGGTGGAGTTGTGGAATCTGAGTGCTTCTTTGCTGTCAG
ATAAATGGCAGGTGTTAGTCTGCTGATTGCATTTGTGAGCACCAGTAGCTTCAGTTCATG
TGTGGAACCACCAAAGATGGGTAGTGATAATTTTAATGGGGGAAAAAAAGAAGGACTTTC
TGGAAGTCTTCTGGTTGCAATACAACACTAGCATTGTACTGAAACTTATATTCTTGTGTT
TATCTTAGATTTGAAAATGGAAGAACTGACCAAGGTTTTGTGACAGATACTTGCTTGGTA
AGCTCTTTGCTTCTCAGTTGCCATAAAATTTTTAATGAGATGTGTAGACCAATTGAAATA
TGTAAGTGCTGTGTACTACTTGAGTTTCTATGGCTTGGAAAGAATGCCCAAGCCTAGCAG
TGCAGAGCTTGCATCAATGACTGCTGCTGATTGAAAACAGTAAAGTTAGTTACTGTTTAA
CTGTTGGTTAAATCATGCAGTGAGTTTTTGCAGGGATTATTACTGAATAACGTGTAACTT
ACTTGTCTCTGTGGCAAGATAAGTTTTTTATTTGATGTGAATGGGGCAAAGTCTGAAATA
CCGAGCCTGTCCCATAAGGGAAAAACAATAGTAACAGCTTCAAGCTCCTCTAAGCATGTA
CTGTTCATGATGATTAGTTCTACACAATGGGAATCTCTCTGAAAGAGACTGAGGAGGACT
CTTGATCTGAAACAGTACACGCATTTTAGGCTTTCTTGAAACACTGCCAAGCGGAGTGTT
AATTAAAAAAAAATCATTGTTACAGAGTGAAGCTGAAGGGGAGTGTGTGAGAAATAACAC
CAACTTTGAGGTAAGTTTAAACTAGAGTATGTTTTGGATGTTACAGAGGCCCAGTAATCT
CTGGAATGTTGTGATAAGGCTAGTGGTGCATGAAAGTAGTTGTGTGTGTTTTGTTGTGAG
TCTTGCACTCCCAGCTGTTGGGAGAATAAAACTGTGCATGGAGCAAGAATGACCTTTAGT
TCTTCAACTTTAGTCACTGGAAAACTTAATGTCATCTGTTTGTATGAAGAAAAGACTTGG
CCACAGTGGCTCAAAAAACCACGTTTTTTATTGCTTGGTATCTTCACACAGTAAAAATCA
TAAAAGCTGAATCAGTGGGGTCTACTTAAGCCAATGTGTTGACAATTTAATACAGCAGAA
TGCACAGCAGCAAGCATACAACTCCTGTCATAACGCCTACCTACCTGTATGGCTGTTCTG
TGAACTGACACTAACACTGCTGCACACTTGAAGTGGAAAAAAGATATCCTGTAGCTGATA
AAATCTACTAAGAGTAGCAATAATCTTGCTTATGTTGGAGGTATGCAAACTTAAGATTGA
GTTGAAGATGTAGGTTGCTGTAGCACTTTGTTCCAGAGGTTTTATGGGGCTTGTATTTTA
GGTATCAACTCATTCTAACCAAATGACTTTCAGTTGGAGGGACAGTATCATTAAGCATGT
ATAGCCAACTGTTTTTCTGATTCCTCTGATGTTAGTGATTCTGTATTTCCAGTTCATTTA
GGATTTATAAGCTTTTTTAATATTAGGTGTTACAAATTGAAGCTGTCAGTTGACAGCTCA
AATACAGCCTTTTTACAGGTTAAAATTAGTTTGATAGTTTGTATACCCACATATAGTGAT
ATCTTACTCTGAAACAATTTCTCTGTTTCTCAGGAAAGGACTGCTCTGTCTGCCACCTCA
CTGGGTAAGATAACACAGATTAATTCTCTCTTCTGAAAGTATTGGTAGCCACTGATGAAA
CTTGATTCTGCCAGATGAGTTTCTGTGATATTACCATTTCCGTTCCATTCTTTCTGAGGT
TACACAGCTGCTGAGAGGAACTCTTAGCAGGTGTGCCACTGCATGCTAAGTGTGTTTTCC
TGCTTTAGGTGAGGATGTGACTTTGGAACTGTATGACCAAACAGAAAGGTGAGTGTAACT
ATTAATCACACTTAGTTGCTGGAACAAATGATGATTAAAACCTTAGCTTGAACTCTCTCA
CTGAACAGAGATGAAAACCTAAGGTCTGAGTTGTTCCAACAAGCTTCTTGTACTGGTTTG
ATGCCTTGTAACAATTCTTATGCCTTACTTAATAGGTGGAAGATCCCAGGATAATGGGTT
GCACTTGCATGAACAGCATTAAAACAAGACTTTGTGGTGTTGATTGGAGCTAATAAAATC
TTGTAAACTCTGCCTGTTGTTGTGAACTTCTTTCTGATTTGACTGCTTGCTATGAAGTAG
CTCGCGGGTGTCTGATAAAAGCTACAAATACTTGGTTTAGGACAGGGAGCTAACAAGTTT
AAGGAAATGCTAGTCCTGCAAGTGCTCTCTGCTGTAGGGTGTAGCTGATCATAGAATCAT
AGAATCGCTAAGGTTGGAAAAGACCCACAGGATCATCCAGTCCAACCATTTGCCCTTGAT
CAATGGTTCCCGCTAAACCATGTCCCTCAACACAACATCCAAACACTCTTTGAACACCAC
CAGGGTCGGTGACTCCACCACCTCTCTGGGCAGCCCATTCCAGTGCCTGACCACCCTTTC
AGAGAAGTAGTATTTCCTAATGTCCAGCCTGAGTCTTCCCTGATGCAGCTTGAAGCCATT
CCCTCTTGTCCTAATACTAGTGTTAAGGCAGACTGGAGTTGACCTGAGCAATGCCTTGGT
TTGGGTAAAGCTTAAAAGAAAAATACTATAATTTTTTTTTTTTTACAGAACCACCATAGG
GCTTGGATTCTGTTAACACTTTTCCACTGGATTAAGTTTGGTCTGGTCAGTGGCATTAGT
ATGGGGCATGGCAGTGTCCACCCTCCATGAGGAAGGAAAAATACTAGCAGAGGTGGGAGA
CTGGGATAATCCTATTTTAAAGGTAGAAATGCTTGTATGGTACTAGGGCCTGTTAAGGCA
TATGACTGTTACCAAAACTCATTAATACCATTTTTTCTGAAAAACTTATGTTCTTCCTCC
ATCTTGTTGTGATGTTAAAGGAGAAGTTAGTGCTGTGAAGAACTTGCTCGTCATAACACT
TGAGCTATTGTATTGGTACAGCACTTTTAAGAAGAAGAAAAACTAGACGTCTCAACTCCT
ACAAGAGATTTTCTGATGCTTCCCAGAATTTTTCATTAAGAGGAACAAGATTGAGTTTCA
TCTCCTTCCCACTCCAGCTGGCATGAGCTATGTGAGTTTTTAGCCAGAGTAACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 1257..1347, 1939..1964, 2396..2445, 3188..3236, 3745..3789, 4653..4907, 5075..5173
1302..1347, 1939..1964, 2396..2445, 3188..3236, 3745..3789, 4653..4712
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved