Gallus_gallus Locus EF1B_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus EF1B_CHICK
Gallus_gallus
EF1B_CHICK
7
SNORD51
2917..2999
6157
ATGCGAGCGGGCAGACCCCGCAGCCCTCCCCTCACAGTCACACCGCACCGATGCGACTG
CGGTCCCACACACCTCCCAGCGCCAACGGCCGCCCGCGGCGGGACGCGGCCGGCACCACT
TACCGCGTAGCGCGGAGGCCGGAGCGGCCGCGGAAAGGGCCCTGCGGAGGGCAGGCAGGC
GCAGCATGGTGCTCTGCGGGGAGACAAACGGCGCGGAGATGTACCGCTCGGAACGCCTTC
CGTCAGGTTTCAAACGGGCAGAGTAACGCGCGCGGCCCGGGGGTCACCTTGCGGGCGGCT
CCCGCCGGCAGCCCCCGGCCCGTCTCACGCAGCACTTCGAGCTGCGGCCGGAGGAAGGCG
CCGGGCCCACAGTTGCAGCCCAGCGCCCCTACCTCGAGGAGGAGCCGCTCCCGTTACCGG
CGGGCACGGGACGGCCGGCGGAGACAGCTCGGCCTTACCCGTCCGGCTCGGCCTCTATGG
TGACCGCCTCGGCCCTTTCCGCCGCTCCTTCGGCAATCTCCGTAAACGAGCTGCACGGCG
CGCGCGCACACGCGCGCTCGGCAATTTTCGGCACGGGGCTCTTCGGGTCGCTCCGCTAGG
CTGCGCCCGTCGGCAATTTCCGCCTCCCCGAGGAGCCCTCGCGGCCACCGTCAAACGCGT
CGCTTCCGCAAGTTCCGCCCGTGCCGCTGCCGCGTTCGTCGACCAACTCCCGCAACTTCC
GCTGGCGCAGCGAAGCGGGGGGAGGGCGGGACAGGACGGGGATCGGTATAACACCAGTCC
AACACTGACAGGGCTCCCGAGCTCCACGCGTACCGCTACGCATCTCACTCTAATACACCT
CCGCTCCCATGACGCCCAGTTTCCAGCGCGCCCTGCGCTGGAGCGGCGCTCGGCCCGCCG
GGAACTATTTCGGCACTTCCTGGCGGAAGGATACGTGTGCGAGCGATTCCGCGGAGGACT
CCGACGCTATATAAGGGGAGCGCAGGGGCTGCTGGGCCTCTTTGCGCGGCGGCGGGGCTT
GGTCGTGGGCAGGCGTCGTGCGCCGCTGCCGCCATGGGCTTTGGGGACCTAAAGTCCGCC
GCCGGCCTGCGGGTCCTCAACGACTTTCTGGCCGACAAGAGCTACATCGAGGGGTGAGGG
GCGGCGGGAGGGAGGCGAGCTGGGCCGGGCCGTGGCGAGGCCTGATGGGGGAGCGGCGGG
GTGGCCCTGGGACATGCGTGTGCGTAAACCTCGTGTCGGGTGGGCGGGCGCCGAGCCCCG
GGCCGCGTGTGCGCCCCGCGGTGTTGGGCCGCCGCGCTCCGTGCACGTAGCGCCGGGCCG
CTGCCACGGCGTGGGCCGTCCTGCGTTCGGCGGCGGGCGCCTTGCACGATGCGGGCGCTG
AGCAGGGCTGACCTCGGCTTCTTCCTGCAGGTACGTGCCCTCCCAGGCCGACATAGCGGT
GTTTGAAGCTGTCGGCGCCCCGCCTCCTGCAGAGTTGTTCCATGCTCTCCGGTGGTACAA
TCACATTAAGTCGTACGAAAAGCAAAAGGCGAGGTATGCTTAAACCACTCCGTGAACACA
CACGCGAACTGGTGTGCAAACTGTTGTGTTTGTTTCGGGGCTTCGAGAGGAAGGGGCTCT
TCCCTGGTGCTGCGTGGCTTCTTGGAACAGAAACAAGTCCAGAAGCAGAGCAGACCTGCC
ACTCAGTTACAGGGGCCGCTCAGAGTTGAGGAAGCTGAATCTGCCTTTGTGCAGGCTCTG
CAGGGCTCCTGTGGAAGCTTATAGGGAAGCTTGGGTCTTGTCGCTGCCTCCTACTCAAGT
GACTGTGCTGAAAGCTGGAAACGACTTAGATCTGCTCCAAAAGGGCAGTATCAGAATTAG
GAACTATGGGAGAAGCCTGAGGGTAATAAGGAAGGTGATGGTTCAGACTTTTAATCCCTG
GAGGTGAGGCTAAATTGAACACAGACAATGCAGAAATGCATGTAAAGAAGGGGGACTATA
AAAGCAAATGTTCTCTTTTTTTAGTGATTTTAGTGTTCATGAAAGGTGCTGTATTGACAT
CCATGGTGACTGCAGGCCTCTCTGGAAAGGTACAGCATAGGTAGTGTTAGTACTGCTGCC
TTTTTGCCCCTCAGCCCTGTTCTGGAGGGGGCTCTTGTGAAGCTGGGTGGCTCAGCCACC
AGGACATTTTTGCAGCTCTCAAACCCAAGTGGGACTGAGATGATAAAGTTTCCTCAGAAA
CTTTAGTCCACTCTGGAAACTTGAGCTAATTACTGTAAATGAAATCTAATTTTACAATGT
TTGTAACAGTAGTTCACAGTGGCAGTAAGAAATTAATGGGATACTGTTCAATATATCCAT
GTAGGTTACACAGGGCAGCAAAATAACACAGGATCCAACAGCGATTAGATATGCAGTTTT
TGTAGGATTTGCTGTAGTTTCAACCAAGGTGTTTTCAGAAGCGTTGTTTTGGGGAAGGTT
TTCAAGCAGCAAAGAACATTTTTTTTGTTCTTTTCACAGTGTTTTTGCTTTGAAGGTACT
TATGAATGACAGTTAAGTCCTACAAATATTTGAGTAGGTTCTTAATACCTGTTTTCCTTT
AGCTTGCCAGGAATAAAGAAGGCTTTGGGGAAATACGGTCCTGCTGATGTTGAGGACACA
ACAGGCGCAGCCACAGATAGCAAAGATGATGACGACATTGATCTTTTTGGATCTGATGAT
GAAGAGGTACTGGTGACTTTTTCTGTTTTAGTTTTATACATAGATATTTAAGAACCACCT
GGATAGGCAAGTGTTTACCCTACTAGTTTAGGTTACTTTAATTTGTGACCTTATCACAGA
TACTGTTCAGGATCTCTGAACTCCAATGTCTTTGTAGAATGTAACATAAGAACTTTCCAT
TAGAACGAAATATGGTGGGTTGAAATGTCTGCTTTGACTGGTTACATGATGAATAAAACA
AAAATCACCATCTTTCGGCTGACAGCTGTGATGATTTGTTTCTTTCTGAGTAGATGCCAG
TCAATCTAATAACGTTTTGAAGATCTGGGGGTTTGGTGGGTTTTTTGTGACTTTGTATTT
CTCTTTCAGGAAAGTGAAGAAGCAAAGAAACTGAGGGAAGAACGCCTGGCCCAGTATGAA
TCAAAGAAGTCCAAAAGTATGCCTTTGAATAACTTTGACCTTTGCACGCATTTGAACAGG
AGGATTAGAAATAGTGTTTGTAATAGATAGACTTCACTAGAATGAAGCAGAAGTAGTTTG
CTTCACCTGAATTGTCTGTGAGCTTAGCCTTTCCTATAGCAAATCACTGAACCTTAGCAT
ACTTCTTGTCCTGCCTATTATACCTTTGTTTGTCTTACCAAAGAAGCTATGCTTTTTCTC
TACAAAAAGAGAACCCTAGGTTTTTCTTTAGTAAAACAGATGCAAAGTAGTATAAAATGC
ATCTGCATAAGAACTCCAGCAGACTAACCTAAGAAGGCCAATCAGTAGTTGGTGAGTTAT
GAGAGGAAAGGCTGTTACATGCAAGTCTGTCCACAGTTACTGGTCTGAAACTGTTCAGGA
CTGTAGCAGTTGCAGTATTCCCTCTGTGGAAGATAAACTGTTACGTAGTATTAAGCTCCT
TCTCAGATCTTCTAAGAAGGACTTTCTATGTAACAAACAATGTTAGCTTCTGTGATCTTT
TCAGAGTATTTTTTCAAAACCATGCATCTACATCTTAAACATCAGGATATATATTTTCAG
AACCCTTAAAAATGCATGTTGGTGCAAGAGGTCTGAGTTATGAGTTTTCTTATTGAGCTG
GGAGAGTTAGTATGTGAAGTTAGTTTTGCAAGTATATTCTTGAGTTTCTGAAAGTTTCCT
AGCTTGTGATGGTGATTTTCCTCCTTTTATTCTTTCCTCAGAACCAGCTGTTGTTGCCAA
ATCATCGATCTTGCTTGATGTGAAACCTTGGGATGATGAGACAGACATGGCCAAATTAGA
GGAGTGTGTTCGAAGCATTCAAGCAGATGGCTTGGTCTGGGGGTCTTGTAAGTAAAATTC
GAAGTGGAGGGAAAGGTGGTCATGTGATCTGTTGGGGTCCTGTATGAATAGGTAGCCTTA
GGGTTACTCTTTGTCCATCTGTGATAATGTAGGTAGCTACAATAGTGAATTAACTGCCAT
ACTACATAGTGTGTAGCATGAGCTGTCCATGTGTGGTGCTCGGTGAACTAGTGCCCACTA
AATAGCAAACTGATATTCTGTGCATAGTCTCACAAGAGTGATAATCTAAAAGGGGTTAGT
CATAAAGCTGCTAGGGCAGCAGCAAGGTTAAGACTCAAACAAGCACACTTTTAGACCAGC
TTGTTGATTAATGCATCAGCCACTTACATCTTTGATTTGAATTTTCAAGCAAGGAGTGTT
TAATGCCTTTTTTTGTTTGTTTTGCAGCCAAGCTAGTACCAGTTGGCTATGGTATCAAAA
AGCTTCAGATTCAGTGTGTTGTTGAAGATGATAAAGTTGGAACAGACATGCTGGAAGAAA
GAATAACAGCTTTTGAAGATTACGTACAATCAATGGATGTAGCTGCTTTCAACAAGATTT
AAGTCCTGATATATCTAGAATAAATATAATTGCAAAAATTGGGCCATGTCTGTCGTTAAT
TCAAAGTCATAGTGCAATCCAGTTTGTTAATGTAAAATTTGATTGATGGATAAAGTAGAA
GCTAATAAATTGGATTTTAGGATTGTTCCAGCACCATAGTACCTAGCGCCAGAGCAAAGA
GAGAGTTGAAAATTGCCATATGTCTAGGCTTAACATTTACATGGCTTTAAATATCTGAAA
TGCTCTTCCCTCTTTTAGTCAGAGTTGCATCTTTGGATACTTGTAATTAATCTGGAAGGA
GAGATGGCTTTCAGGGAGAAGCACAGGGTTGTAGCACTTTTTAAAGAGGAATATAACTTT
TGTATAGGAAGGGTGGTGAATAATCCAATAATTGTATGGTGGCTTTTTTCTTTTGAAAGC
TACAGTTTACCTTTCACTAAGGGAATGAAGACAAAGATGAGGAAGTTTAAAGCGAGTACT
GCAGTGCATTGGAGATTGTGGTGAAATGTACTTTTTAATTTGACTTGAGACTGCCAGGGT
AACTTCTCACCATCTTCTGTTGTGTGAACCTGAGACTTTTTTTTCTCCTGAAGTATTTAA
AAATAAAAAATAAAACTAACCTCAAACTTTGCATTTTTTGGGGTTGGGGAGTGCTTCTTA
ATTAGTGCTCTGTAATTCCTGTGTTAAGATCAGGGCCTTGGTGTGCCTTAAACTGCAGAC
CAGCATTGGTTTTTTGACCTTGAATAGCAGGATGGTGATCCTTGAGGTGCAATTAACGCA
CAGATAACTAGGGGGCAGTGTATCCCTTCAAGAGGACCGAGGCATTGGCAGTCTTAACAG
TGCCACGTGCTTGTGTGAGGATTAATGAGGTGTGGTGGCTACATGCTACAGTTAATGCAG
GTGGATAATATCTTGTAACTGTTAAAATACTGCTTACTACAGTGTCACTGTACCTCTGAA
AAATGAGTATCTTGCACTGAATGACACATACCTATTTCAAATGTAACCTATAACAACCAG
ATCAATATTAAGTTAGAGATATTAAATACAATCATGTATAGGACTGTGGGAGGATGCTGG
TGCCTCTTTTTAAAAAGGGCTGCCAGATACCACCCTATTTTTGAAGTAAAGTTTTAACAA
AAGTGTCAGAAACACTTCCATGCAACCTTCAGAAGTCCAAACATGAAGCAGGTAAGAATA
GAACCTGCTGCTATTCACTTCTGTTGGTTTTTTTTTCTCTGCAGCATCTCATAGCAAAAT
CAGAGAGAGATTCCCTTCCTCTGGCTTTTGTTTTCACTGTAGAGCTTGGAGTGGGCGTTC
TTTCCAAGCAGTGTAGGAGAGTAATTGTTTTCTTTTGGTTATTCTTTGGAAACAGAAACT
GGGAATGCTGTCTGTTTTGATGAGGTATCTGCCGTTACTCTTGCAGAAATGAGTTGGAGG
CGATCACATAGCTGATCTTGGTATGAAGGAGGTAGCATTACCTTGCAAAGTTGTTAGTCC
ATTTTTTTTTCCACAGACCAGGACTGATGTTGGCCGGATTCTATACTATTCTGGGGGAGG
CTTTTGGTTAAGGCAGTGGTTAGATATTGGCAAGAAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1132, 1410..1532, 2582..2705, 3069..3135, 3881..4006, 4407..5157
1053..1132, 1410..1532, 2582..2705, 3069..3135, 3881..4006, 4407..4558
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved