Gallus_gallus Locus NP_001006488.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001006488.1
Gallus_gallus
NP_001006488.1
5
SNORA28
4974..5097
9117
GGCCTCAAGTTCATACTTTCGAGGCGTACCCAAGCCCAGCTAAGGGTCCCAGCAGGGCT
GAGGGCCGGCAGTGTTTGACACTGAGAACATGAACTGCACACAGGGACGTGGGGCACCCG
CGGCACCCAGAGGTGGCCACAGCACCCTGAGGTACCCAAAGCTGAGTTGTTATGGCAGTG
ACTACAAATCGGCGCTTTCCTGCTCCCTGAAAGCAGCCTGTACGGGAAAGACACACTGTG
TTCAGCGTTTTAATTGTTTAAGTGCTTGTAATACAAATTAGTTGCTGTGATGTCACGCGT
TTGGCCCTCGCCGGTGTATGAAAAGCTGCAGCCCATCCCCAACTCCATGCCTGCTGCATC
GGATTCCTGTCAGAGGACCCGACCAGCACCGAGGCCTTTCCTGAGGTCGCCTTTGTAAGA
AAGCCGAGGTGGGAACAAGACCCAAAGGGAAAAGCAGGGCAGGGGGTGGCACCTCAGCAC
AGGAACAGAGAAGGAAGAGACGCACAGCCCGAAACCCACCACACTGACTCAGCCCCGCGC
TCGCCCCTCCCCCCAACGCCATCCCGTGCTGTCTCGCGAGACCCGGCCGCTGTAGACGCG
ATGTCCTTTGGGGCACTGGGGGGGAGGGACGAGGGAGGGAAGCGAGGCGAGGGGTGGATT
GATCGATAGTGGCTTCCACCAATAAGAGTAGGGGACGGGGGGCCCTGAGCCAATAACTTC
GTCCCAGGGCGAGCGGCGAGCCAATGGAGGGCCTGGGGAGGAGGAGCGCGCCGCTGGCTG
ATTGATCCCAGCTTTGGCGTTGTTCAGTCAGAGCGAGAACATTCTAGAGGTGAGTACGGG
GCAGCCATTGCTGGGGTCCCATCAACCGCCCCCTTCTGCCCGAGCTGCGCGCCGGCCGCC
GCAGCTCCCTCCCCCCACCCTCCCCTCTTCTCCCCCCTCCTCCTCTTTCCTCTCCTCACA
GGTGCCGTAGCTAACGATGCCCCTGATTGTGTCTCCTCCGCAGGTTGTCCGGCACTGCTG
TCCCTGCTGATAACGCCCGTCACAGGACGCCCGGACCCGGAGGCTGCGGCGTCCGCCTCC
GCCTCCTCCCCCGCCCGGATATAAGCGCCACACGGCCTTGTTCTCCTTGCACACTCGGCT
TCATCGCAGCCCAGGGCGAGCAGCGTTGGGTTTATGTCTTTATTGGACGAAAACGGTGAG
TGTGGGTCTTGAGGCGGAGCGGGTGAGGGCGGCGGGGCTGAAGGGGCGAGCGGGCTGGGC
TGGGGCTGCCGTTGGTGGGTGGCTGCGAGGAGTTGTGCCTGGGGCCCTCCAGGAAGAGGA
AGGAGATAACAAAACTGACATATTAACGTCTCACCTTTGTCGGTTTGATGTTTCTGGTGG
CTGTTTTTCCTCCGCGTTATTTTTTTTATACTCGGTTAACTCCCCCCCATTCCCCCCCCC
CTACCACCACCACCCCCCTGCGCCATGCGACGAGACAAGATGGCGGCGGCCGGGCCGCGC
CTCCCCGCGCTGTGGGCGGTTGGGGGGGGAGCGCCAGGCGGGGGGAGCTGTGGCGCAGTT
ACAGACACTGCGGGGGGAGGGGGCGCCCGCTCCGCCAGCGGAGGGAATGGGGGGGGTGGG
GGGAGGAAGAGGCGCGCTCGGAGCATCCCCCCTTTAGATCTGGGGAGCGCATGCGCAGTT
GGAGGTTTCCCCCTTCCCCCCCGGTCTGTTCCAGGGCTGAGTCAGTGCTTAATTGCTGCA
TTTATGACTCATCACAGGCCCGAGTGGGGCGGGGAGTTGTGTTGCTGAGCGCTCTGCCTT
CCCGCTTCTTTCTCTCTGTGCGCGGCATATTTGGGGGAGGGGGGGCTGCTTGCTTGGGAG
GAGGTGTCCCAGGGACCAGGAGAGGGAGCTTCAGCCTACAGCACGCAGACAAAAGCTGGG
AGCTCGAAGGAGGGGAAGCGACACGTTAGCTCTGCAAGCTCACACAGAGAGGTACTGCTT
CCTCAGCGCTTCTCAGGCGCGTGGTCGGGTCACGTGGGGGCTCTTTTTTAGCCATTCTGG
GGAAGGAAACCTCACGCCCGAAACAAAATCCTCAGGGTGGCTTTTGCTGAAGAGGGGTAA
AGCTGCATTGGGACTAATGTGGAATACGTAGTGTGCACGTATCTGTTTGCTTCTCGTGAA
AGGATTTATAAACCTGAGCAGAGGGACTCTGCATGGAATCGCACTCTTACACAGGAACAT
GGAGGAGTCTATTTTAACGTGTCAACACTTCTGTCATTAACGATAACATGGTGACGTGTC
ACAGCGAGCGTGCTGCAGGCAGGGCTGCCAGTCTAGTCAGCCAGTTGTGGCTTACATAAC
CTTAGATCTGATTACAGGGGCACATGTTAATTTAAATATGTAAATACTGCTTAAGGCAAC
TTTAATAATAAGACTCATCCTCCTTCCCTTAAGAAAAAAATTAACTGGAAAAGCTGTTGC
ACTGCTCTGTACCTCTCTGCATTGCTAGGCTTTCTACAGTGAAGCAACTTATGTCAGACT
TAAGCAGGCTTCTTGTTAAGTCAGAATTCCACAGAACCTGCTATGAGAATCCGTAGGTGA
GAGGGAGAATTACTTAATTTTTCACTCCGAGCCAGAAAACTGGTAAGCCATGCAAAAGTT
CTGTTGGACTACAGACAGATTGCTGCTGCTTCACCTGAAGGATATTTCTCAGCATTCTGA
CAGACTACAGTTTATGTAATAGGTTCATGCTATGATGTGGAATTTGGAACTGTATTCCAG
ATTTTTCTCCCTCTTCCCTTTCCTCTTCAGCCTGGAACGTACCACGTGACTTTAATGTAA
GAGCCTTTGGTCTTCATTAATCAGGCAGTGTTTCTTTCTCTTCCTTACTGATCATGACAG
TCTTGGGAGTTAATTGTACAGAAAATACTGTTTAGTTGCCCGTTGTTTTGCAGGGAGTAA
AGTGGAAGAGGGTTTAAAGCTCTGTAGTGTAGGTGAGGAAAAGCTGTTCAGCAGTGCAGT
TCAAGGCTATTGTCTTAGCTTCACAGGTTGAAGAAAGGTGTATTGTAACAAACTTAGTTC
TCCTACCCATAAATATAGTTCCTCATATGGCAGGATTTTATTGGTGTATATTGAGATAAA
CTTCTTACTTTTCTGTCTGTTAATGCTTGCAGAGCTGTTGCGCAGCCACTGGTACCTGTA
TTGGGGAAACATAGCATACAAGCAAGAACCTTACAGCCTCAGTGGCGAAAATTTTTTCAT
GTCAGAGACCGAGAACTCTTGCAGTCGTTTATGTCATCCCGTCTTCTCCAGACAGAAGAT
ACCAAAAAACTGCAATCAAAGATCTCTTCATCTTATTGATAAAGCTACTAATAAGGCAAA
ATGTCTGTCAACGTCAACCGCAGTGTTTCAGATCAGTTCTATCGCTACAAAATGCCCCGT
CTGATTGCCAAGGTAACTTAATAGCCATTAGTGATAAGTAGATAAGGTTTCACATTGGTT
GCTTTCTATATAAAGGAATTGAGGTAATGATATCAACCCTAGCCAGTCATAGGGAGCGGA
TGTCTGCATCTGTCCTAACTGTACATTAATGCCTCTTAAGCAGACCCTTCAAAGCAGAAC
TTAGTGTAGTAAGCTGGGAAATATACGCTGGGTTGGGCTGTTGTCGTTCTAACTTAAGCC
TTTTTTTTTTTTAAAAGGTTGAGGGCAAGGGAAATGGAATAAAGACGGTTATAGTCAACA
TGGTTGACGTTGCAAAGGCGCTTAATCGGCCTCCAACGTGTAAGTACTCTGTGCAGTGAT
GCTGCGTGGTTTAAAATGTTTCTAACGCTTTCACTTCTATTTGAAGTTGTTAGTACTAAG
GGGTTTTTTTCTAAGACTTGTTAGGAAAAAAGTAAGGGGGAAGTAGGAGAAAGCAGCAAT
GGCATATTTGCTTGGTTTTTTTTTAATTATTATTTTTTTTTCAAGCAACAATGACAACTT
AAGGGCCCTGGTGGTTATTTTACTTCATTTACAGATCCTACCAAATTTTTTGGTTGTGAG
CTGGGAGCACAGACCCAGTTTGATGTTAAGAATGACCGTTACATTGTCAATGGATCTCAT
GAGGCGAATAAGCTGCAAGACATGTTGGATGGATTCATTAAAAAATTTGTTCTCTGTCCT
GAGTGTGAGAATCCTGAAACTGATCTGGTGAGTGCTCTCTATCTGCATGAATAGTAACAG
TACAAAAACACTGTTTTTAGGGTTTGTGGAAATGCTGTGGATTTTAAAAGCTGACTGAAA
TATCAGATTTCTCTGAATTACTTTCTTGCTATTCAACCCAGGCTGTAGGTTTACACTGGT
TCAAAACTTCTTGGCTAAATTGCTTGTTTAGACTCAGGCTCTCTTAGGGCTGATGAAAGC
ATGACTTAATCCTAGGAGATTACAAGGTAAATACCAGGTGTAGGCTTTAATGTGTATCTG
TTTTGTATTTTTACTGGAATTTATTCTTTCTTACAGCATGTCAATCCTAAGAAACAAACT
ATAGGTAATTCTTGCAAAGCCTGTGGCTATCGAGGCATGCTTGACACAAACCATAAACTC
TGCACATTCATTCTCAAAAACCCACCTGGTAAGTGTGTGTTCCCTTATTTGTGGGGAGGG
GGAGGTGATTAAAAAGGAACTCTTTCCAGTGTGAGTGCTGTTAATCAAGTAGAAAAGCAA
ATAGCTGACTTCTGAGTAAACTGTAAAAATGCTTGAGTGTACTGCTAGTGTGTGTTTGTG
GGTTGGGGTGAAGTAGCTGTGTTCATAGTTGAAATGTGAAAAGGATGCAAGAGAACTGGC
TGCTCCAGTAGAAGTATCTGAAGAATTTTATTTGCCTAGGCAGGACAAAACTTCCTAGGA
TGTTAGTCAGCAGGTGCTCGCTGCTGATTTCTGGTTAAGTCAGCATGAAGCAGAAGGATA
GGAAGTAAAAGCCATGTAATACATATGAACTGCAGTAAACAAATTACTCTGTGCAAGCAA
CACTCTGTAGTAAGCATTTGGTTGCCTGCTGCAATTTAAGCTTGCTAAATCAGAAAAGTC
TAACCTATTCCAGGGATCTCTGCTTTGTGAGGTCGCTTGTTATATAGACTTGTACAGCCT
TTGTAACGAGAAGCAAGGCTTTGCTAGAACCATGGATTTTTCTGAACAATATACGCTGTC
TCTGTACGTATTCAGAACAGTAACCGTGCATAACCTGCTGCTAATGCAAACACTGCATCA
GGTTCCCTTGGGAGTTCAGTAGCAGTGCAGTAGTGCAGGGACTCCATGAAATAAAGGAAG
CTAATACACTGACGTTCGTTTTCAGAAAGTGGTGACACTGGTACAGGGAAAAAAGAAAAG
GAGAAGAAAAATAGAAAAGGCAAGGACAAAGAAAATGGTTCTGTGTCCAGCAATGAGACA
CCTCCACCTCCACCACCAGAGGAGATTACTCCTCCACAGGTTGTGGTAAGTAGAAGGGAA
TGTGTGGAGATGAGGATGTATGGTGTCTTGCTCTGATATCAAACTGAAAATCACTTCCTT
CCTAGTCAGCATTGCATCAAAACGTTACTATATTTGAGAAATTTGCAACTGGAATAGAAG
TAGCCCTGCACCTCCCCTGTAGTAACTCTTCAGTATGCATGTTCCTTGCTGAGTACGCGT
TGCATACTCTTTGCTCCTCAAGAGATCTAGATTATCTATTACAGCCATTTAGATATAGTG
GTGAGACAGTGCTTGAAAGTAACCGCACAGCTGACTGTAAATGCATGTTTAGTTAGCATA
ACTTCTGCATTGGCTTCCTCCATTTCTGTAACACGTAGTTAGAAGATCAGTTGTGTTTCT
GTGGGGAGGAGTCAGAAATACTTGATTATAAAGTGCTCTCAGATCTGTATCTAGAGAAAA
CATTCAACTTTTTAGTAAGCTTGTGGTAGAACTGTATGAATCTCCTGGACTTTTTCTTGT
TTACTCTTTAAGGAGGAGGAGGACGATGATGACTGGGGTGAAGACACAACAGAAGAAGCC
CAGAGGCGTAGAATGGATGAAATCAGTGACCATGCAAAGAACCTCACACTTAGTGAAGAC
TTGGAAAGAACAGTGGAAGAGAGAGTCAACATACTATTTGATTTTGTGAAGGTGAGTATA
TGTGAAAATGCTCATAAGGAGATGAAGAGTGAGCTGCTTTTTTTTCTTCTCTAGAAGTCT
TTCAGCCCTTGAGTTGAAGCTGCTACAGAAGTACTGCTTCCAGCGTTAGTCAGGAGTGTC
TTCAAGCACTAATGCAGATTTTAGTGGTTTTAAAACATGCTGTTCCTCTCTTGCAGAAAA
AGAAGGAAGAAGGTGTCATTGATTCTTCTGACAAGGACATCGTAGCAGAAGCAGAGAGAC
TGGATGTTAAGGCTATGGGCCCTCTCGTTCTGACTGAAGTCCTTTTTGACGAAAAGATTC
GTGAACAGATAAGGAAATACAGGCGTCACTTCCTTCGTGTAAGCAGTTTCCTGTTCTGTA
CCCAATGTAACGGCTGTTCTGGTTTCTGTGATAACTACTTGAGATGGTTGTGAATGGCTT
GGTATTGCGGGAACATGACTTGTCACTTTGAAACCAGCACTTCCTAACTAAGGAAGACTG
GGAGGGATGATAAAGCTGTTGTAAACTCTGTCACCTCAGTGAGTTAAGATCAGAAGCAAC
AGCTCATCCTGGAGAGGAAAAGAGCTAATTTATGTGCTCTTCTATCCCCGACTCTAGTTC
TGCCACAATAACAAGAAAGCTCAGAGGTACCTTCTCCACGGCTTCGAGTGTGTGGTGGCT
ATGCATCAGTCTCAGCTTATTTCTAAAATACCACATATTTTGAAGGAGATGTATGATGCA
GATCTTCTAGAAGAAGAAGTCATCCTTGGCTGGGCAGAAAAGGTAAAGGGAAAATATTTT
GTGCGATGCCTGCTTTGTACTTGAATGTAGCATAGTGCACCTGATCTTACCATTCTGGTA
AAACTTGGCATGTGGATATCTTCAGTTGTTCTCGGGAGAAACATCTCCCAGAAACAGCCT
GTAGAAGGTGGTAGGGTGAGGTTTGGCTTGCTCTGTTTTTTGTATGGCCTGGTAATTCCT
TCAGCGTTATAAGCAGAATGTCCTTCTGTTTCTCAGGCCTCAAAGAAATATGTTTCAAAG
GAGCTTGGCAAAGAAATTCGTGTCAAAGCAGAACCATTTATTAAATGGCTGAAGGAAGCT
GAAGAAGAATCTTCCGGAAATGAAGAAGAGGATGAAGATGAAAACATAGAGGTAAGGCTT
ATTTCTTCTAAATGAATGTAACCACAGAACCCTGTGTGCTCCAGTCCTGAGGCACTTGGT
GCACTGCGAAGTAGCTCACTTGACGTATTGCTGTTAATGTTGGGAAGCATGAAGCCTTCA
GAAGAGCAAGTGCTTGTGTGTTAGAGAAGTCAGTTAAAGGAGAAATGGCTTTTTTTCTTC
ACAGCTTAGGCCTAGGTGAATCTGTTAGCCATGTCCAGCTGATTGTTGTGCCTGTATAAG
CTGAGGTCTCAATGTGTGTTAGACTTCATATGCAGTTAATGGTCTCATGGGAAGCTGTTG
GGCACTACATTTGGGCCATGCGGCAGCATGCTAAGCATTGTTGACAGACAAGGGGAACTG
TAGAGCATGGAGATATTGGGCACTTGCAGTGTTAAACCAAAATTCACGTACGATGCCCAC
TGCCTCTAAGCACTAGTAAAGGTACATTTCGTGTCTCCACAGGTGGTATACTCTACAACT
GCCAGTGTACCTAAAGTTGAAACTGTGAAGCCTGCAAACAATAAAGATGATGATATTGAT
ATTGATGCCATTTAAAGTGACGCAACGTAGCTTCCAGCATAATCAAACTTCTCTGCGTTT
TCTGCCAGAAGTGTGACTTGTATGTGCACAAACTGAAATGGCTTAACATCCTGCTACTCT
TTGTACTCTAAAATGTATCTTTTTACTGTGACTGGTCTTGTGTAACTAAGCCTAATACCC
AAGGAGTCAGCACATCAGTGAACTGATCTAGTTTGCAAATGGCATGTTCTGTTTTGTTTT
TCTAACTTGTGTTGGACACATACTTGGAGCACATTTATACAGTTACGGAAATAAAGGATT
TGGTTTTGGTCAATCTTCACTCGTGCCTCAGCTTTGTTTATTTTCCAAGTAAGTATTTAC
ACAACTGGGTGCAACTTCTGTGGAGGAATGAACATTGCAACAGGGGTGGGTGTGATAACA
AATTACCTTGGGCCGAAGACATGCAGAGGTTGAGAGAAAATGTTTTGTCTTAGATTTAGC
ACAGAATGTCTAAGAGCTTTTCAGTAACTCCACTAAATCCATAGGTCAGTGCTTTGAGCA
CTGCTACTGCTGGTGGCATGGTATTACAAGTCCTGAGAAATCAGTAGTGTGAGCAGAGAG
GGGGTTAGAGCAAGGAGAAGATCTTATTTGCCATTTAAGAGCTTCAGGTTTGACTCCCCG
CAGTAGGTGGGTGTAGGGCTGTGAACTGAGTACTGCATTGCAGGTGATATTGGATTCAAG
TTGTCAGTGCTTATGCACTGGGCAGGCCGTGTTAGAGAGGTGGGGTGATGTTGCCACGGA
TGCCAGGGAGGTAAAGTTACTGCGGTAACGTAAGAGCGTGACTGGTAATTGTGAGGTTAG
TCCTGGCATTTTTCCTGCATTTCAAAAATAATTGTCAGTTGTCAGACTTGTTGGGAACGT
GGAAGGTGAGTTACTGATCCCTGTGTGACCTTCCCAGAAGATATTTCCCTTTCCTGCTAA
AGGCACACACCTCCATTGTGTGATAGTTGTGAGCACATCCTTACCAGCATTTTGCCTGCC
AGGCTGGAGTCGGGTGGGGAAAGCAAAGATCAAATACAGGTGTACATATTAGAGGGTAGC
TGTTGCAGAGCTAATGATTTTTGCCTGCTACTACAGTAGCAAATTATACGGGCAATTTTT
GGTTTATGTAGGTAGCAATTAAGAGAGTGGAATTTGTATTACTTCTTTTATAAAAGCAAA
AGGCTAGGCCTGCAGGGGTGGTGACAGAAGCTTAAAAGGAAATTGTTAATAATGCTGTCT
AGTTTCCAATGGAGTTTCAGCTTGGTCTTCGTGCTAGCTTGGATCAGCAGGCTTTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1194, 3152..3431, 3674..3758, 3994..4166, 4476..4587, 5305..5444, 5952..6110, 6296..6457, 6717..6881, 7116..7250, 7722..8117
3360..3431, 3674..3758, 3994..4166, 4476..4587, 5305..5444, 5952..6110, 6296..6457, 6717..6881, 7116..7250, 7722..7811
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved