Gallus_gallus Locus NP_001006469.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001006469.1
Gallus_gallus
NP_001006469.1
5
SNORA54, SNORA54
8522..8650, 11901..12021
27654
AAGCAGGAGCACCGAGTGCATCTGTTCAGCAGTTCTGCCACAGTCTCTGTGCTCAGCGT
AGGTTCTCCAGGCTCTCCTTATGCTAGACTGCGTGTTAAATCAAGCCTGGGTGATTCAGC
AAATATCTTTTTGCAGCTCTCTGCAGGGCAGGAACACCTGACAGACAGCAAGATGACTCC
ACAGATTGTGCCTCACCCACAGCCTTGTTAGTGCCTACACCAAGGCACGGCAGTCAGCAG
AAATCCCTCCTCGCTGCTCGTGGGAGACGGACGCCTTTGGGGGGCACTGACACCCACAGT
GTAAGGTGATGTACATCTCCTTCAATACACACCCAGGCGCAGGCAGAGGAAAGACTTCTA
GCGGCTCCAGCCTGCTTCAAGGCTTTAATTATCAGTCCAAAAGAAATCAAATTCATTTTT
ACCAGGCCATATGAAGCCTTACTATTAGGAAGCGCTCCGCATTATGATTTACCTAACTTC
TAACTTTGAAATCTCATAATACGCACAGAGGCTTTTACATCATGGGCCCGTTTCTAATCA
GTCATAACGGAACCCTGCAACCGCAAGCCGAGGCGCTGAGAGGACGCCGGGGCAGCGCAC
CAGGCCCGCCTTCAAGGGCAGGACCCCGCGGAGCGCCTTTCTCCGCCGGCCCACAGGGGA
TGACCGCGGCCATCTTGTCCAGCCCCCGCCCCCCTCCTCCGCACGCGCTCGCTGCCGCTT
TAAGGTTACAACCGCGAGCCCCCCCACCCCCTCCGCCATCACGCGCTCGCCCCGCGCGCC
GACAGCCCCGCGCACGCCTCTGCCAGCGCGCACCGCCCTCCCCCCCCCGCCTCCGCGCTC
TCCCGCTGATTGGCCGAGCGCCGCGCCGTCGGATAGTCAACATGTCCCGCGTGCGGCACG
GCGGCGGTGCCGTCGCCAGCTCCAATCGGCGGCGATTTTATTGAAGGAGGCGCTCGCGCT
TTGGCCAATGAGAGACGGCTTTCTTGGCGGCGGCGCAGCCCGAGTGAGCTTGAGAGGAGT
CTGGCGCTGCTGGGGGGACGCGGCGCGGGCAGGTGAGGAGGCGTGTGGCTCCGGCGTTCG
GGCGGCCGGCGGGGTGAGCAGCGGGCACGAGCCGGCCGCCGTGAGCACGGCAAGGGGGCG
GGGTGCGTGTGGGGTGGCCGTTAGGGCCTGCCGCGGGGTGGGGCTCGGGCGGCGGTGGGG
GCCGCCTGCAGCCGCCTGGCGGAGAGGGGCGGGCCCGACCCGCTCAGGCACCATTTTAAG
ACCGCTTGGGGAAGTTTATAGCGAGGGTCGCGGTCGCCGTGAGGGTTGCGGTCGTTCTGG
CCACATGGATGACCGCGCTCGCTCGCCTCGCGTTGCCTGGCGTTGCCTGGCGGCGGGCCC
AGCCTTCCCCCGCCCTCCCCGGGGAGTGGGGGAGGAAGCAGGCGGGAGGGCCGTGTGCGT
AGCGAGCGGCTACTGCGGCTCTCGGCCCGCAGCGCTCGGTTCCACTCAGACCCTGCAGCG
CTTCAGTCGGGTGCGGCTCTACCGTTTGACCTCAGCCGCGATCTTCTGCCTCCTCAGTGT
GCTCCTGCGGGTTAGCTTTCCCCTTTGGAGGCCCCCGTTCTCCACGTGAGGGGCCGTTTC
ACGTTTTTGCTGCTCCAGCGGGTGTTTACCATACGTAATAATACCGCTGGTAGAATTTGT
CTATTACGTTCTGTAACATCTCTACAGGTAGGAAGGTAGGGAAGTGAGTGTGTAAATTGT
GTAGGTGAAATTAAAACCACTGGGAAATTTTTATTAAGTCATCTTTGGCAAAAATAATAT
TCCCTCAATACAGCTTTCAGGGTGAGCTGAAGTGCTGCTGATGTTCAGGGCTTGTGGATC
TGGTCAGCAAGTGACATTTCATGGTTGCTTCTTGTTTTGCTTGCAAAAAGAATCAGTGTT
ATGTTTGTGGCTGCACACAGAGCTGCTTCCCAGCAGGTCTGAAACGGAAGTCATAGCTTT
CCCTCCTGATTTGTTGTAGATACAAAAGCAGTAATGTCTGTGGGTGGAAGGCTTCCTGTA
AGTTCGGGAGCCCATTAGCTCCTTGCTGTATGTTCTAGTTGTGCTTAGAATGGCTTTTAC
AATGAGATGTAGGCTTCTTAGTGGAGAGAATTTATTCTCTATGTTCTCAGGAATGTCTCC
TGCCATTAAAGCTGCCTTCTTTGAGATGTCACTTGCCCTTAGGGTGAACTTTCACTATCT
TAGACTGTTGGAGATGTATGACTGTTTCCTGCTGTTTTAGGTGACCAGTGCTCAGTGACA
TTTGTTGTAGACAAATTGCAGCAGCGTCTCTTGTGGGACAGGTGGTTGCTGTAGGCTCCT
CCTTCCCCTGAGCTTTGCATCTGTGTTAGCTACTTGAAAATGGTGAGCTGTCCAGAAGCA
TGGATTTGGCCTCTCATTGGTGGTGATAATGGTTATAATAATACCTTACAACATTCTTTT
CTTAGAGTTCAGTAATGCTATTATTTTTTTTCTTCATTGTCTACACACTGAGACTGGGGG
GGAAAGAAGAAAAGTGAAGGCTCAGTGTTTTGTGTCTGTGCTTTTTCAGCGAGATGTGCA
TCTAATGTTTTATCTGAAATCACCTTGCTTTGTCCTTCCCTGCTCCTGCCAGCTTTTACT
GAACAGTTCTATTAGTAATGCTGCAGCTGCTAAGTCATTGGGAGGCAGCTGTAATGCTGC
TGGGAATTATAAGCTGTTTTGGGGAAAGCTTTTAATTTTTTATTCATATGCTACTTTTTG
TTTTTCAGGGACTGAAAGAAAAACTTTGAAGAGACAGACCGGTCTTAAAGTATGTATTTG
TACCAGCAAACGGTGTCTTACCAGTTTTTGTTTCCTGTTACTTACATGAGTGGTCTTTGT
CAGAACGTGCCTAATTGATGTGTTCCAATGGAGCTTAAGTCAACTGCAGTTTAGCACTTA
TGCATATGGCAGAACCTTCATTCCATGTCCCCCAAACATGAATGGCAAGGGAATGAGAAT
TCTGTTTTTCCTCATCAGGGATGAGAAATATTTCCTTGCAAGAAAAGCAGCACAAATAAC
AGAGGAAAACATTTGTGTGTGGAATTATGCTTTTCCATTGGGCCTGTGGCTGGTCCTGGG
TTGGAAGAGATGAGTCTTTAAGGCTAATTTTTAAGTAATGTGAGTCTGCATTTTTAGTTG
CTTACTGATGCTGCTTCTAATAGTGGCCAGGATCATGTAACTTGTTGGCTGAACTCTGGT
ATTAGGTCAATTTGCTCTCTTACCTTTTTGATCATCATTTTTTTTTTCTGCCTTCTGTAT
GCTATGGAAGGAAAGATTTGTGTATGCTCCTTTATTTCTTCAGCTGTAGGATAGCTGAAT
TCTTTCACTTTGCTTCACAAGGTGATTGCTTTTATTGTCACTTTCTCTTGTTGTGTTTAG
GGCAAGAATAAGTGTTGCCAAAACGTGTGTGGGTTGCTGACACAGACCTGGTCTACAAGA
AAGAAGGCCCTTTTTCCTGTTTCTGGCCTTAATCTATAGGATGGGCTCAGGGGAATTTTT
GGTACATATTAGGCAGTTTTTTTATGGAATAATCAAAAGAGTACTTACAATCTAAACAGT
ATATACCTTTCAATTCAATATAAGTGCTTATAAGTACTTGTGAAAGTGTTACTTTTCTAA
CCTAAAGCAGGAATTGGCATTTTCCAGGTGCATTTTCAGATCCTTCTTTTCTAACTGCTG
CTCCAGTGCCATCAGCTTTGCGTTCTCCTGTGGTAGCAGTCTTAGAAGCTGGTCTAAAGA
TCAGCCTGCTTGGGCATTATGGACAAGAAATCAGACCTGATTACTCCTAAGAACGATGAA
AAATTCTTCTTATTGTTAAACCTGACCCATGTCTGCTTTCTTGAAAACTTGATAGCATAA
AATCAGCTGTACAGTCTGTAGTGACTGGGGGGTTTGTAATGAACTATGCCTAGAACTGGG
GAGCGTGGGGAGAGAGGAGGGAAGGAATGGGGAGAGGTGAAAACCAAAAGTAGATCTCTT
TTAGTTTATGACACCTTGGTAAAGAAATACCAGCAAAATAATTTAGGTAGTGTGGCCCTG
GGGTCTCAGCAGGGCTAATTTAGATCTTGGGGGCTGGGGTAGCTGTGTTAAACTTGGTTT
CAGCTGCTGCAGGTACCAGGGTTTCTACTTGTATGGTTCTTCTTTGTTTTCTCACATGCA
TTCAAGCCAAATCCTTAAGTAGGGGATTTTTTTCCTTTCAAACTGCTGTCAAAAAACCTC
TTATGTGTAAATAACTTCTTCAATATTTTGCTTCTCCTTACTTAGTGTGTTTAGGTTGTC
GTTCTGTATATCACAGCAGAAGCAGCTATTCACAAATAGTCTTGATTAGACAGACATTTT
TCTGCTCAAGTCACATGAGAAAAAAGTCTTTCTGATGCTGTAGTTCATTTGAACTTTCAT
CATTTTCAGATCAAGCATTCTAACACAGATTAAAAATTCATTATTTGCTGAGATGCTGTC
AAGGAATTAGAAAATGATATGCTCATTTCTTCCTCTTTGGGTTTTTATTTTTAAAAAAGA
ATGCAGAGCAGTCCAGGAAACTGTGACATCTGTTTTTAGGATGAGGACTTACTCCCATTT
ATAATGTTTCTTCCAGTTCATATTTAACAGAAAAAATGTTTTAAGGGGTGGGATGAAAGC
ACTTAATGTATTGTTTAAAAAAACTGAATCATTTAGATTGGATGTTATGGAAGCTGTTGC
TTCACTGCATGAGTTCATCTATGATGACTTTCCTAGCAGAACTAGCAGGAGCTGATTTAT
CTCGAGGTCTTAAGCATTGCCCTATTTTATTTTCACCTTTATGTTGAGGTAAATAAGAAA
AGGTTCTATTAAATCATTTCTAAACACTGTATTTCAATCTACAGGTGGATACAGGCAGGC
AGATGGCAGATAACAGGTATGTTGGACCCATTTCTTGAAATGAAGTCTGGTTACAGAATT
AATGTGTTTGGTCTTGTGGGAGAACTTACCTTTCTTTTTTAAACCTATGAAGAATATAGT
ACTAATCTTGGATAAGAATAAAATGGCAATATTTTCTCTAATTAGACTGCTTTTCTTTAC
AGCAAGGTGAATATGTTTGTTTGATGCACTGGAATCTCCGAGTGTCACCTGTTGGCTATG
GAATTGCTGTTACTGGGTTAATGTCATCAGTGCTGTCTAGGCTCAGTTTTGCAAGTTCAT
TTTGAGACTTTGTGAAGACTTGAAGAGATCACAGATCTCTCTTTGTTTTGCTGATCTGTG
TGACTTCTGCATGCAAAAGACACTTTTTTTTTCCTAGCTTTCATACTGTTTTTAGAACAA
ATGACTGTTTTTAAGCTGGTGTAAATACATACATGAAGCTGCTCTTTCAGGGCTTGCATT
GCACCAGGGTAAGCTGGCCTATCCAGCAACTGAAAAATAGTCACTTGCATATGTAGTGTC
CTTTCTCCTTCTGTATCTGAGGTAAGATTAGTTTCAGCAATACTCAATCTGTATTTTGCA
ACCTCTAAACTGGCAGGAAACATAGGGAATGCTTGCCCACTGTTGACTCATTCTGAGCCC
TCTGTTTTTCCAGCACAGGAAGAGTGATGGAAGACAGTGTGGGGAAGGCAGAAGCATCTC
TTTTTGGAGTTTAAATGAACATTTTTACTACTAATCAAAACAACTGATTATAGGAAATCC
AAGGAGCTTTGAGCACTTATTTTAAGACTTCTTCTAACCTGTTTCTTTTCTAATGTTTTT
TTCTCTACCCCTTACACTAAAAAGGTGTCTCAAGTTCTCACTTTAGTAATAACGTTTCCA
TGTCCAGGTTGACTCAGTACATGTTTAAGGGCCAGTTGTTCATTGAATGAGATGAATTCT
ATCAGTCAAGGTAGCTTTTGTTCTTTCAGTGTTGTTTTTGTTTGGCAGTTAATTTTTGCC
TTTCTTTTGCTTCCTATTCATCTTGGGAGAATTAATTCCATATCCAGACTTTAAATTTTG
AAAAGCCTGAGGATATAAACATGTCTTTTCTTTGCTTGTTCATAAAACTTTACATAACAC
TGGAAATCCAGTATTAAGCATTAACATTATTGCAAAGTGATGCTTATCTCATGTTATGTT
TTAGTTCTAGTAAAGCAGAAGATACTGCTTCAGATTCTGTGGAGGCTGCTAAAAATGCAA
GTGACAAAAAAGGTAAGAGGTGCATAATGTTAGACAACACTACAAGGGTGGAGTAAAGCT
TTTGCCTTCTGTTTTGAAGCTCCTTTATCTACATATATGCTACTGAAAACAAAGCAATGG
TTTCTAGGCTACATTCTTTCTGTTATTCAGACATATCCTTCCTGTTTGTTACAAAGAAGA
GTGAAATGAGGGCTTCATGAATGTAACAGTGAAAATGTTTTTGCACATAGGATTAGGATG
GTTTTCTATTGCATGAAGTAATAAAGTAGACACTTGCAATGAAGTCTATACAGACTAGTT
TTGATTATGAAGCTATATCAGCATAATCATTAAAATGAACATTCCTGCAGCTCTCCGCTG
TCACGTTTGTGGGAAAATGCATCATTTTAAGAGTGTCTTCTTGAAGCTTTTATTTTTCAT
TTGGAAGGTCTGTTGGATAATGCTGCAGTTCAGTTTTCAGTAGCATACTCAAATTTGTAA
ACTAATGTGGGACAGTAGTATATTTCACTATGTGGTCTTTATATTTAACATAAACTAGCA
GACACCATGGAATAATATAATCAAATTATTTGAAGGAGGGGGAAGAAAAAGAACCAGTGT
CAAACTTCACCAAGTTAGTGTGTGCTATGCAATTTATTAATTGCTTTTGTTTCATGTCTG
TTGAGAAGAGCAGCAGGAAAGAATGGAAAGATCAGGAAAGCAAATGTATTTGTGTTATGT
TTGCCACATAAATCCTTTTAGTGAGGATTTTAACTCCTAACCAGAACTAGTTTAGGTCTG
ATATCTGGTTTAAAGAAACAAAAACAACAAAACCCCACATTCTTCTGACCACTCTCTTGA
TGACTCTTTGGGAAGTTGTGTAGGTTGTAAAAATATCTAGATGGGAAATAGTGTGTATTT
TTGCTGTGATGCTACAAGACTCATAGTATAACATAAGTGCTGTGAATGTACTCAGATTTG
TTTTAAGAATGGGTTCCTGTCTTCATAGAAAAGCTGGCAGACCAGGTGATGCAGAATCCA
CAAGTCCTGGCAGCTCTACAGGAACGGCTTGACAACACAGCACTTACCCCTTCAAGTTAC
ATTGAAACGTAAGTACAGTGCAAAGCAACATTCTTGGAAGACTGAAAGCATAATAGAAGG
TTATTACTATATAATTAGGGTCAGAAATTTGAACAAATGACTCATTAAGTAAAATTGTTG
ACTTCAACCATGATTCAGTGGCCTACATATGGAGTGAAGAGATGAGTTTTAGTATACTTG
GACAAACTTCAAAACAATATGTTGCCTCATTAAGTATTTTCCATAGCTTTTATTTGGTTT
GAAATAATTATTCCCTCCCCCCCTCCCACATTTGAAACCTTTATTTCGATAGATGGGTAG
AATTACACTTTAAAAATCTTGTTTTTAGCAAAGACTTGTGCTTTTATTTCTTGACTGGGG
GTAGCTGGGGGACTTTTTTAACTTTAAGATCTATCAGTTGTTCAGCTTACTTTATAGAAG
CACCTAATTGCTTGAAGTACAGTTAGTATTTGTCTGGGTATGACCCATGAATCCATGAAA
CTTTCCCTTGAAAATGCAGTTTGGGGGGGAAGAGAAATTTCCCAATGTGCTTGAAAGAGA
TATTGAAGAAATATATATGTATTTGACATAAGCACTTAACAATTGCATTTAGCTATAAGC
AGCTAAATGCTACATTATTTAACATTTCAGAATGAAATTGCTTGAGGCAACTAACTTTTA
AGCTTAATTTATTTGTTTTTTTAGTTTACCAAAAGCAGTGAAAAGAAGAATTGATGCCTT
GAAACAACTCCAGGTGAAATGTGCCCACATAGAAGCTAAATTTTATGAAGAAGTACATGA
TTTAGAGAGAAAATATGCAGCACTCTATCAACCTCTTTTTGATAAGGTGAGAAGACTATA
AATGTATCTTTGTTTCCTTACAACTGTGTCAGTTTTGTTTGCTTATATGTAATTTTACTT
CTATCAGTAATTCATCCAGAGAAAAAAGTTACATTTTTAGGTGGCTTTTTCTTTTAGAGG
AGAGAGTTTATTAATGGAGAAGCAGAACCTACAGATGCAGAGTCAGAATGGCACAGTGAA
AATGAGGAGGAGGAAAAGCTAGCAGTAAGTATTAATTGGGGTAATGAACTACAGATACAT
CTGATTTCTTCAAAATAAATCCCTGTAAGCCATTTCCCTTCGAAAAATTAATATTTTGGA
GGGGGGGGGGAAGCTTTTATCAGTCACACACTGCTGTGATTAACGTTATCTCCCATGGAG
GCTTCTACATTCACAATTTAGTGTTTTTCAGGTTTTTAACTTGAGCAAATTGTTGCTTTT
GGATGCACTGTTCGTAACCTGTTAGCAGTGTAATTCTGTTAACGGGTTCCATTCCGGTGC
TACATGATAACCCCAAGATAACAGAAGGCTGGCTGTTTGTTTGCCTGTTCCCTTTATTTT
GGGGGACATAATTAACTTAAATGACCAAAAATATAAATTAGACCTTCAGGTGCCATGTAG
ACACAAAGTGGCATGGACTTAAATCATGCGTGCTGGCTTGTGCCTTCTTACTTTCCTCTC
TAATAGTAACTATGTAGATTTACAAAGAATGATCTACTAGGAAGATTGCCTTCCAGTTTG
CTGTCATTGTTTTTGGAGAAGTATACACATCACTTGGTAACTTTTTCTCTTTTTAAAAGA
AGCAACCTGTTTACAACGCTGTCTTTTCTATTCTGCTAGACTTCTTTGGCATTTTTCCCA
TGTTCTTTTTCCCTTTGATTTCCTTTGAATAGCAAAGCAAATTGTTCTTTTTTTTTTTTT
TCCCCCTAGCTGGTCTCATGAGATTTAGTGTAATGCAGAACTCAGTGTGCAGAAGCAAAA
AGCTTTCTGAGGCATGAATGCATAATTGACTGGCAATATTCTATGAAGTTACAGCTTTGG
AAATGTCTAGATGGCAAGTGAACTGCTGCTTCCTATTGGCTAGGCGTAGCCCGTGAAGCT
GCTGTTTGGAAGAACTCGTTTGTTTGCTGCCATCTAGTGGTGCAAAAGGAAAGGTGCAAT
ATGATTAATTTAGACGGCAAACTCAAGTTTGAGAGCTGGAGAATTTGAGTCTTTTTTTGT
ATTCCATCAGTTATGTGTATGGAATCGAGATAGCTTAATAATGAAAGGTCACAATGAAAA
ATCAACTTTGTCAAGTATTTTGTAAAATTGGAAAGGTAGAACAGTTTTAAAGGGCAGATC
CACTTAGATTTTTAGATGAGGCACTGTAAATGGTATGGGAGTCTACAGGGAAGAGATAAT
AGAAAAACATGTGCTTTTCTACTTTTATGTTTGTAGAAAGATAAACATTTTAAACTTTTT
CTTCAATTGGCCAAATTACTGCAACTGTCATTTGGTTATTTAGTCCTTATACAGAGGAAT
TCCAAATTACTTGAAAGTAAATCTGAATTCATTGTGTATATGTTTAGATGTGTAAATGAA
CCTTGTGTCTCTTAACTTCATTTGCAGAGGAAAAACAGTTCACGTTTTTTAAATGTCTTA
AATGCAGCTTCAGAGATAGCAAATTCTTTGTACTTCTACCTCTCAGTGTATTGAGAAGTC
ATGATTTCATTTCTTAAATGTTTCTGTATATTTGTTTCACAGGGAGACCTGAAAAATGTA
GTGGTAATAGAAGAAAAAGCGGAAGCAGAAGAGATAAATGTCAAAGGAATTCCAGACTTC
TGGTTTACTATCTTTAGGAATGTAGATATGCTAAGTGAATTAGTACAAGTAAGTTTCTCT
TTTGAAAAGAGTAACTTCTGTCATATGATAAAAAGCTGCTATTTTTTTTTTTTGTTTGCT
TGCTAGTGCTTAGAACCATGTGAAATTCATAAGGACCAAGTGCAACGTGCTGCATGTGAG
TCAAGGCAATTTCAGACATTAGCTATAGACTGGAAAATGAATGGGTGTGGATGCTGAATA
TTGGATGTGAGCCATCAGTGTGTGCTTGCAGTCCAGAAAGCTTTATGGTATCCTGGGCTA
TACTACTATCAAGTAGTATAGCTGGTAGGGCGAGGGAGATAATTCTTCCCCTCATCTGTG
CACTTTTGAGACCCTACCTGCAGTACTGTGTTCAGTGATGTGGTCCCCAGCACAGGAAAA
ACATGGACCAATTAGAGTGGGTCGGAACTCTGATAGAGCCCATGATGAAAGGCTGAGAGT
TGTTTCACCTGGATAAGAGAAGGCCTCCAGAGAGACCTTTTTGTGGCTTTTCAGTACTTA
AAGGGGACTTTGTAAGAAAGATGAAGAAGCTTTTTTCAAAGGCATGTAGTGATAGGACAA
GGAGGTAATGGCTTTAAACTAAAAGAGGGTAGATTTAGATTAGATGTTAGGAAGAAATTG
TTCACTGTGAGAGTGATGAGGCACTGGAACAGGTTGCCCAAAGAACTGTGGATGCCTCAT
CCCTGGAAATGTTCAAGGTCAGATTGGATGGGGCTTTGGGCAGCCTATTCTAGTGGAAGG
TGTCCCTGCCTGTTGCAGAGGAATTGGACTAGATCATCTTAAAAGGTCTCCTCCAAACTA
AACTACTGTATGATTTGTTCTCTGATTCTCTGAACATGTGAGATGGTAAATCTTGGGGGT
CTTCTTGATCTCTGATACTATTCCTGAAGACACTTGAAAGGCTGGTGATGGGCAAACTGA
ACAGCAGACTGAAGCTGCCAAGGAGGATGTGAATTTTCTTAGGGTCTTGTAATGACTTCT
GAAGATTGGAAAATGGAAGTTCAGAGCTGTGTAAGAAATGAAAGTTAAGAACTTACAACA
GCTTTTCATCTGTAGTTAACTTAGTTTGTAAAAGGATTGGTTTTTTTTCTCCTCAAGGGT
ACTGCTGCAGGTGTACCTGTGGACTGTTTAAGTTCATGTTAAGTAGCTGAGGACCACGCA
GCGTATTAATGTAATTGCTTCTATTGCTGTTCAGGAATAATTCCCTGAAGCCTATCTTTC
TGTAAATCTCATCAGCAATAAATATCCTGAACTTATCACTTTCAGAAATGGTCATGGAGC
CAAGCATGATAGCTGGATACAAGGCTTTTTGTTTGAGAGTTTTGTGTGTGAGGATTGAAA
AAAGAATTAAGAAATCTTGATCCAAATCTGAACTTGAGTTGCAATATTTAAATAATTACA
AGATTTGATTCATTCTTAAGGGTAAATTGAACAAGCCAACTAGGTGTAAGTTTTGGTCTT
TTAACTATTGCCTCCTCAATAATAAATTGTTTTTGTCTTTTTAGGAATATGATGAACCAA
TCTTGAAACACCTACAGGATATCAAAGTGAAGTTTTCTGAACCTGGACAGCCTATGGTGA
GTTTCCCATAGATGCTTCAAGTGAAGACTATAATAGTGATGCGAGCAGCATTTTGAATCT
TTCATTCCATCCTCTTTGGTTAGAATATATAAGGTGTTGCTTATTTTTTCTGGGCTAGTA
TCTTCATGCTTTGGCTTTTAAAATTTATTCAGCTTTCATGACTGCTTGCTTTTTCACCCT
AGGCCAAATATCTTATTGTAGTTTTTACACTGTAAAAATGTCATTGTAGCTGAAATCTGG
CTAGTTTTTGCATAAATGTTCTGCCTCAAATTTCAAGTAAACTCATATTTATATGGAGGT
TATGTGGCTTCTTTTGGTTTGGAAGTGGACGTAGGTGTAAAGTGTGGTTGCTGCTTGCTA
TATTGAACTTGCTGTCTTGTCTCGCACTGCTCGTAACCTTTTGACAGCATATTCCTGTGA
ATAGGTTCCATTCCAGTGCTACAACAAATCCAGTAATGGAAGGCTGACAGACTCCATGTC
CCTTCCGTATTTGGAGACATTCCTAACCACTTGACTGAGAGCTTTTCCAGTTGTTTGAAT
ATCTTGTCTGAAATCTTCCTTAAAAGTTGTGGTGACAGTGGTAGCTTTGTACTGCAAAAA
CGTTAAATTACAGCTGCCTAACACTGATTCTGTTGTGGATTATGTTTTGCAACTAAAAGA
AATAGGCAGTAGGAATTATTCATTTTACCTGGTGCTTTCACAGGCTGTAACAAGCAGTAC
TTTATATAAGTTTTTGTCTGCAGAAAGTTTAAGTGATTTTTGTTGTATCTGCTTTTATTT
ACACTTGTGGAAATGTATGTATGTTTAGATAAGTAAAATAGGTAAGATAGATACTTTATA
AATATCCATCTGTTTGGTCATCAGACCCTTTGCTAGCATATTCAGACCTGGGAGATGAGT
ATGGGTATGATTTAAATCTTCCTTTATTTTAAGCTATTTATTTGTGTATTTGAACTTTAT
GAGATATGTTCTCTTAATATAGGAGAGCTGAAAAAATTCGCATTGCATAGCTAATATGAT
ATCGAGAACAAAGATATCCAAATAAGGTTCCTGGAGGGGTTATTTCAGCTCTTCAAATAG
TACTTGAAACTGGAAGCTTCTTATTGTCTCATAACTGGCAGATATGAAAAGAAATGCTGA
GATGTACTCTTTGCAAAGAAGTTTGCCTTGCTAGTCCCTGGGATGCTGCGTGCTCAGTAG
TGCCACTGGTTACCTATTTATAACCTCAGTGACGTTTTGTGGGATTATCTGGGTCTGAGT
GTTCATCACTGGTGTTGGATAAGCTATGTTTGTGACTCTTCCCTTGAGCACGTGTGCCAG
GGAGGGATTTGCCTTACTTTAAAGAACACTTCTAAATCATACCTGGGTGTTTTGACTTGC
TTTAAAAATGGAAGTAAAGCTGAAATAGGCTATGAGAAACCAACATGGATATTCCAGCTC
ACATCTGGTTCCCAGCGCCCTCCTTTCCTTAATCTATAAGCATTTGAGTCGAGGAGGCTT
CTGGTGCTACCAGACCGATCACTCCTTGACTTCTATCCTTCCAGCTTTCAGTCATGTGAG
GAGATTCATGTGGCTGTAGAAAGCAGATGGTGAGGCAGAACTAAAGGGGCCTTTGGGAGA
TAGATGAGGGAGATGAGCCTAACTTGGAAGCCTTTTATTTTCCACGTAAGATGTTGAATT
TCTGCAGTTTCCAGGTGCTGCATGACTGGTGCGAGCAGAAATACCTGCTGCAGGCTGCCA
ACAGTTAAAGTATGCATAACCTTAGGCTTCAGTCAGGGTTCTTCTGCAGGATTTTCTGTT
ATTAAATGAACAAATACTCTGGTTCATGGTGGAGTGCCCTGTTTAAATACAGACTCATGT
GCATGCATACTTATTTTTGAGGAAAAGCCAAACTTTGTTTCAGTCTTGTAAGATCGTATC
ATTGACTGCTCAGAGCAGGTGGAAGAGCAGAGCCTGATGATGCTATTCTGAAGCCAGAGC
AACTTCAGAAGAACAGCTGCATCATCCCTAGTGAAGAGATGAATAATAGATGTCTATGCT
TCCGCTGTAGCAAAAGATATGTTTGTTTTATTGTTGTTAATTCTGCTGATGCACTGTTTC
AAAGATAAAAATCAGTAGTAACAAAACTGTCATGGAACTTTCTTCTAGTCTTTCTCATTA
GAGTTCCACTTTGGGCCCAACGACTACTTTTCTAATACAGTCCTGACAAAAACCTACAAG
ATGAAGTCAGAGCCAGACAAGACAGATCCGTTTTCATTTGAAGGACCTGAAATAGTTGAT
TGTGATGGGTAAGGAAATCTTGAAATTCAAGAACTAGTCAGTATTTTTTCAGATTTTTTT
TTTCCAGACTGTGATAATAATTAATGAAGATAAAATAAAGATTTTGCTGACTTAAAAACT
AGGAATGATGTAAGGACGGTGATGTTAGCCTCAACATGCAGAAGTATGTGTCTTTGTGTT
TAATGTGCATTTTTATTCTTGTATCTTTCAAGTTAAATAGATTATTAATGAGGTAACAAG
CCTTTTACTTCCAGGTAACTGAGTGAATGAGCTTTTGTTGTATTACATACTCCTGGACTC
TTGCCCATCTCAGCAGTTTTAATTCCAACAGTACTTTTGAATCTGGCAGGAGGTGGTCAT
ACGTACGATCTGTTCTCTCAGCCTAGAACATGTTGGCCATGTATTTTGGTTTCGGCAGTC
TTGGCTGTACACTTCCAAATGAATTCAGGATGCAGCTTTCTTGGCTTCCTGGTTGTTGGT
TTGGTTTTTTTTTTGCTTTGATTTTCCTGTCCAACAACTTATTCTTTTTTTTTTAAAAAA
AAAAGCTCTCTGTCCCCATCCAACACATAAGAGATGCTAAATAATTGTTTTCTTGAAGGT
ACCCCGATAACCTCAAAACATTTTAGCATCTACTGCCAAATACTAGTTTTAGAATTGAAC
ATTTTGACTGCGTTGAGCCAAAATACAGTCCTGTATGTCTAGCAAAACTTGCCTCAGTGA
ACAGTTAATCCATTTTGGAGATAACTTCAAACAGCAAACACTTTGAGGATGAAATGTTTT
GGGGCGCCTAAGGACTACTATGACACCATACTTCACTTAATTATTTTTTTTACCCTTCCC
ATTAGAGGAGATCTGACTGTCACTCATTCTTTGCCATGTGTAGTTTTGAGTAAAACTACA
TGTGCATGGAGAATGACTCTTAATTAGGATAAGTATCAGTTTGCACAGCAATGGGAAGGA
GCTAAGAAGTTTGTTCTTTCTGGCTAGCTGTATCTGACTGCCAAGTCAATCTGAGCACTG
TTCTTTGGAGAGCTAAAATGTGCCTATTGTTGGCTGCAGTTCTTGCTGCATTTATTTTTA
GTGTAACCATACACTTCTTGACCTGCAGTGAAGGTGCATAACATATTGTTTTCCACTGGC
CAGGCTCTTGGAAGAAGCATTCTTAATTGTTGAGGTGTTCTGGAATACCTGGGTCACATC
CTCAGTTATAAAACCCAATTAGGCCAAAGAGGTGTTAAAGCATGGATGGGTTGGGGGGGC
AGTGATTACTCCGAGAATGAGGTATTAAGCTTTTTCATTAAGGGAAATACTTGTTATATC
CAGTATGTGCATAGTCTCTAGCACTATGAAGCATCCTGAATCCTCAGTCAAGTAGATTGA
GTCACCTGTGTGTGTAGCTTTAACTAGGAAACTAGAATCCGTGTTGTTTTGATGCTTGTT
GTTTCAGTGCTTCATTCCTTACTGACACTGATGTCTTGTGCTGTTCCCCACGTGTTGTCT
CTAGGTGCACTATTGACTGGAAGAAAGGAAAGAATGTTACAGTTAAAACAATCAAGAAAA
AACAGAAACACAAGGGTCGAGGCACGGTTCGGACAATTACTAAACAAGTACCTAATGATT
CTTTTTTTAACTTCTTCAATCCAATAAAGGGTAAGCCTGGAAATTGAGAATTTAGGATTC
TTATTATATGCTGTGTATTTTGTAGATAAATACAGCTTAAAGCTACAGACTGTATTTGTT
CTGCTGCGCTGTATGCTTCTTACTGGGATAAGATAGCCAACTGCAGTCCATCAGAAGAGG
TCGTTTTGGGTTGTTCTGTATACTTTGACAATTAGGTGTGCTGCGTAAATGGGATTTCTT
GTGTGCAAAGTCTCTCTTAGAATCTCCTAAAGAAGTTGACTTCCTTTACCACAGGATGGC
TCCATGCATCAATTTGAGGCTTTTAGCTTGTGAAGAGCTCTCTTCTAATTCTGCTCAAAG
TTCCAGCATAGAGGTTTCAGTGAAACCTTTGTGTTGAGTGACAGAATATTCTGCAGGTTC
TCCTGTGATTAGTTAGTGATCCACGATGCTCCACATCGTGCCTTCCTAGTTTTCCTGCTT
TATTTAATGTTAGATATATACTTAAGTATTTAAAGCAATTCAGATATATTCAAGGAACGT
TCTCTTTCATACATCTCCCACTGTATTCTTTTTTCAAATGTGGATGGAAGAAACAGTTTA
TAATCAGAGTAGTACTGAAGAAAAACAACATTAGGACCTGTGATTCAGCTGTGGGCTTTT
ACAAAACACCTGCCCCTTCTAAATCCCATTGCAAATCCCTGTTTGCATAGGAACAAAACA
AGTGTTTAGCATTCCCAAAGTTGGTTTATTTGGTACAGAAATATCCTTTAACTTATTTTT
TTCTTACATGAACAGGTATGTAGGTGCTGTTTTGAGAAAGGGATAGTGATTAGTTAACCT
CACGATGATTTCATACTGGGTTTTTAATATGTAAAGGACTTATTCCATAGCTGTGCAAGA
AATATCGAAGCTATGGTATCTGTTGGCTGTTGATAGCACATTTTCAACTTGAGAACAGAC
AGAACCAAATGATACATTTTGCAGTAGGTTCACAGTACCTGTGGCACTTGAATGGGAGGG
TGGAAACCTGTGGGATTTTCTGTTATTTCTAAACAAAACGATAACAAATAAAACAACAGA
AGTCCCGTTCCTTAATTCTGCGCAGCGCACTTATAACTGTGTTTTGATCCAGTCTGTCCT
GGTTGTAGTATCAAGCCTTTTCTCAGAATACTTTGCCAACTCCTCATGACACGTCAGCCT
GCTTGGGAGGATCTGTGTTTGGGGAAAGAAGATTTATGGTGCTTTAGCAAAATAAAGCTG
CTGTAATTTCAGCATTTGTGCAGAAATAAGCAGTGTTGCTATTTAAGGGGGTAAATGCAA
TCTGTATGCATTTGTAGGAAGGTTATTTCCCGTGCAAAGATCTTTGATGTTGGGATGGCA
GCTTTGGTGCTTCTATTACAGGACACAAAGTGCAGTTCACAGGTTTGATTTTTAAGACTG
ATTTGAATCGTCATAAAGGTTTGATAGTTAGCTTTTGAAGTCTTTAATTGCACCAGTATT
TCCTGTTGTGAGAAAGTGTATTTGTGCTGTATTTTGTCATCTGGAATATTGAAGAGGGCT
AGACTATACAAAAGTGCTTGTATTTACAGCCTTTTTTTTTTCTTTGCAGTATCTGGTGAT
GGAGAGTCATTGGTAAGTTTACACTTCTGAAATGGTAGGATTGCTTTGCCATATCTTTGC
TAGACATCTTCATATCAACTATTCAGATTCTTTAATTGAGGTTTTGGTATTTTTGCTTTT
GCTGAGGTTGAACTTCACCTTGATAAAATGAAAGATACTGTTGCCTTATTGGAGTAATCC
TGTGACGTTTTGCTGTTGCATGTCTTGCAGATAGAGTATGTCTGTGACTGTCACTTTTGG
GAAAAGGTCATTTACTTTTTCTAATCGCTCAGCTGATAACCAGCTCTTCACAAGACTGAG
GCAGTCTGAACAATTCTATCATGTCAGAACCAGCAAAGTCAGTGTGAGCTTTTATTTAAT
TGCATGTTTTAGCAGGCCAGTAACCTGTATACAGGCAGTGAACACTTCTAAATGGCAGTT
TTGAAAATCTGGATTTAGACTCAGTATTTCTTTTTCTGTTGCAAAGTTAAGTACTGGTGA
CCAGAAGGTTGGTGTTGATGGTCGTGTGATGTTTCTCAAACCTGTAATGTTTTTCTACTG
GGGGAAAAAAAGAGTGATGTGCTGGAACAAAATTATTTCAAACTGGTTTGCTTTGCAGGA
TGAAGATTCAGAGTTCACTTTAGCTGCAGATTTTGAAATTGGTCACTTCTTCCGTGAAAG
GATAGTCCCTCGTGCTGTGCTCTATTTCACAGGGGAAGCTATAGAGGATGATGATAATGT
ATGTATACATCAGCATTTTGTTTATTAGTCACTGTGTACGTGGGAATAGTCTCTCACTTT
TGTGATTGGTCTAATACGTAGTATTATGTGAGAACAACAAAAATATCTGAGGAGGTTCCT
GTTGCTTGGGAGTAGGAAAGAAGCATTCCATTTATTGTAAGCTCTCAAATCTTGTTTCTG
GAAGAAGCTTAGCTTCAGATATTGCATTTCAATGTACTAGAACTGTTGCTGCAGAAGTTT
TTATGCAAATATCAGCAGGTCTAATAAGATCTTTTTGGTCTTGTTTTTCAGTTTGAAGAA
GGTGAAGAAGGTGAAGAGGAGGTGAGATGCATACTACATCTTTTATAGATAACTAATTAT
TTACTGTATTCCAGTTTCTGAAGTTGTGTATGATACTTCTTTCCAAAAGAGTTCAGCATT
CCTGTGTTGTAAAGTCTGTGTATGTTTCTTCAAAAAAAGAAAAGAGAAAACCATCCAGGT
TTTTTTTACTATTTTGAAAACTACTTTGACACCAGTCAGAAATAGTTGTACTGAAGCATT
TTTTTTTGAGTGCTGCATGATAAGACCTTTCAATATTATTTTAAAATATCTATTATTTAG
GCAGTAGTAGAACTTGTTTTTCAGCTGTTGGTTGTCATAAGCCTTGAGACTGATCATTGC
CAAACATAAGGTAAAAAAACTTAGGCTAATGGTTTGATTTAGAATAAGAGTTATATTAAG
GGTTCTGATCCATTTACTGCAATATTAAATGAATACAAGCATACCATGAAAGGCTTTGCA
CAAAACCAATGAATAACCTAATATCCTTGATAGGTAATAATGTTTTTATTTTACTATTTT
TGTGTTTTCGCTGACTGGTTAAAAGCGCATGCCTGAATGTCATCAAGATCACCAGAGTAG
AATTAATCAAAAGTAATAAAGCTGGTGGTCTAATGCAAGCTGGCAGCCTTCAGCATGCAG
TTGCTTTTCTCCCTTTGTAAGTTAAAATACAGACTTCTGGGCTGTCAAAGGTTAGCCATG
GTGGTTTCTTTTTTTAAGCTGGATTTTGTTACAATTGTGCATGTTTTTAATCTGTCCCAA
ATGCCAGGTTGGTGTTGGGATAGTGATACTTGGTTATAGGCACGTGTACAGCAGCACACA
AATACTACAAAATCCTGCACAGGAATACCAAACTTAGCCACAGTGGTCCAAATAAGCTCT
TTGAGAGGAGGTCAAGAGAAAGAAGAAACTCAGACACAAATACTACTTATCAGAATGCCA
AACAATGCATCAAATGAGACTTCAGATATTGCTAGGAGACTGCAGCAGCTTAGCTAGAAA
GTCTCACTGAATCTTACAAATCTCTGTTTTAAATCTTTTTAAAAGCTTTTGCATAAAGAT
TTCTGAAGATGCTGAATTCTTTTATCCTAGCCCGACTAGTTTTAATGTTGACAACTGAAA
CACTCTGGCATACAATGGTAATATCACTTGCTATTTTGTTTTTTTCTCCATTGCAAAAAG
TTGCACTTTTAACCTGTTTTAATTTTTGTTAGTTTATCTCTATTTTGTCATAGGAGTTGG
AGGGGGAAGAGGAGGGAGAAGAGGAGGAAGATGCAGAAAGTGATCCTAAGGTAAAGACTT
CAGTGTGTTTAAGCATAGTACGGGCCATAATTAAAAACCATAATTAAGCTTGCAGCAGTT
TGTGAAAACATTAATAAATCAAGCAAAAACCCTTGGCTAGCTCCTGACTGTATTGTTTTC
ATCTTCCGCAGTACTCAAATTCCTCTTAAGTGAAAAATTAATGTTTAGATAAATATAAAT
TAAGAACGATTTTTTTTCTGGTCTCCCAGACCTGCAACAAGGGAAAGATAACTTCTTAAC
TTTGTCCCTTTACTTCTTAGTACTACCTCTGTGTAGTAAGTATCTCTCTTCCTTTAGGAA
GGTCTTATTGCAGATATTTTTCTGTGGCTGAACTTTGACTTAGAGTTGGTCTGACAAGTC
TCAGCTAGCTCATTTACTTATGTTCTTTGTTCAGAATTATTCTTTTTGGTTGTTCTAATG
ACTGCGGGTTAGATGGCACGTGTCTGTACTCAGCTAGAAATCAAAAAGTTCGTCCCCAAC
TTTTGCCTTTAAACTTGATGAGAGCTGGTTTGAAATTCAGCCAGAGGAATAGTGCTCCTT
CTGATAGGTATTTTTCAATCCTTCAGTCATATTAAAGCTAAAAATTAGCTTTAGTAGAGC
TGGGACAGTGACATACTTCAATGCATTTAGTTCTTAAAACATCAGCTTTTAATCTTTTAT
TTTTTAAGGTCATAGATGAAAAAGTGCTTGATCTTTGGATGAAAGTCTTAAAGCAGCCTA
GCATGTCGCTCTTCTGACTTACATACATCATATTGCTAGTAAATGCTTATTGTCACCATG
TCGAGCATTGAACTTATTTTTCATGGACAAGACATATCGGTAAAGACAGTCTGTATTGTG
GAGAGACTGTACAATGACAGGAATGCTCTTGCTGTGTTCTGAAGGATCAAAATGCAGTCA
TGTACCTGTAGTGGGAGAAGGTGGGACAACTGGGAAACCAAATGTTAGTTGTGAGTCAAA
GTATATTCATGCTGAAAAAGACGTAATGGAGGAAGTGTGAAATCTGGCATCCTGTAGGAA
GAACTTTTGAAATACCTTGGAAGGTTGTAGTTGTTACCTCCTGTATTATTTTGTACATTT
CACTTTTCATTCATGCTGACAGTTCCTTTCAATTTTTTCCCATTCAGGTGTAATTTAAGT
CTGTTTATCATTCATACATTTCTAGGTAAGGTGGAATTCCATTCATACCTAACTTCCAAG
AGTCCCATTGTAGCCATGCAATGTAGTTTGTTTGCTAGTTTTTGTTTTGTTATTTCCTTG
TATTGGGTTAAAGAAAGGGGGGAATGGAAACTTGAGGTTTTACTAGTAAAACTCAATAAT
AGAAATAAATGCTTACAGAGATGAATGCCTTTTAAATCATAATTAAAGTAGATTTTTTCA
GAATGACCTCCTTGCCTTCCTGGCACAACTTCTGTTTTGCCTTTGTATCAGACAAACTGT
ATATTATAGACTGAAGATAAAAGATACTGAGACTTGTCAGACTTCATTTTTCCTTGTTTC
TGATTTCATGTTGCATCTCTTTACTGTTTCTAGTGTACTTGCAAATTCTTAAATATCTCC
TCTGCTCTCCTTGAGAACTCTTGTAAGTCATTGACTGACTTGGTATGTCCTTTCCAGCAT
TCATATTTTTACTGCCTGACAAATTCAGTCAGTCATTCTGAAGAGACCTTTTCTTCAGTG
CTTGTGATTCCAAACAGGTTTTGTTCTCTTGCTCATTTATCTCTTTTATTTAAAAGAAGT
TTCTTCCATTCTGTCTTGTCATCTTTCACCTCTCTTCTCATGCCTCATACAGAACACTAC
CTGCAACAGGTTCAGTGCTGCTTTTCTTGTATTCTAGGCTCGTATGTTTCTTTTTTTAAT
TGCTTATGAGGAACTATATTCTTTCTATCTCCACATAAGTATTGCCCTTCTTTGCTGTTG
CTCAGTTCAGCTGTTATTTTTTTATTTCCAGTCTGATGTGCTTTGAAAAACCAGCCACGC
TGCCTCAGCATACTTGCGCTGTCTGTTCACATGCTGTAGTAAGACCTCAGAGCAACATTT
GTCATGCCAGCTTATCTGGTGTCCTGCTGCAGTCTTACACAGCTGTTTTCCCTTACTACA
ATTAAAAATTGTTAGCTGCTGGCTTTAATTTTCCAAGTAAACGCAGAATTCTGGGTTTGC
CTTTTAAGGCCAGTGCCCCTAATCCTGTTCTCCATTGCTGCTGCTGTTCACTGTGTTAAC
TGGGCCTGTCCCTCCCCATCACTTGCCCTTCTTTGTCTCTCAGTGTCCATCCCCACAGCT
TTTCTTGTATCTAGAGTAGCTTTCATTTTCACGTACACCAAAATAATGGTTCTTCAGTCT
ACTTTTGTTTTGTATCCAGTTTTTCCTCATCAGTCATTCCCACTTTACCTCCTTTTATTG
TTGTATTTCGTTTACTAGATAAATGTCGACACTCTTCTCTTTGCTTTGTCAACTCTTTGT
CCTTAATCCCTCACAATCCTGTCAGATTTAAGTACACTTGAGGTGTTCAGTTAGGACCAG
GTCAGTATCATCTGTTACACGAAGGACTTATTCTCTGCTATGTCTAAGTTGTGGCTTTGG
AAGACTGAGCAGTCGTATAAGTGGAAGTAACTTCAAAGGATATTTTGACTAGTTTATTAT
CTTGATAAGCTATATTATTCTGTGTGCTTGCATGTCCTGTTCGTTTAACTGCCTTTATTT
AACGTTACTGCCTCTGTGCTTGAATAGAGAAGTAGTTAATTGGGTAATTTAGAGCACTGG
TATGAACTAAAAATCTGTTGTTGGGTAGAGACCACTCTTACATTGATACACTTGGTCTAT
CTTTTCAGTAACAGCAGCAGAGGGACTTGTTCTGAAAATGTCTGTTGCTAACCTTTGTAG
CATTTTCTCTGTGGAAGAAGTAGTTCAGACCTCCTCCTTGCTTAGCTCTGGTTGGCTATG
AATTTACCTACAGTATATGCATTTGATATCCTTGCTTTCTTTTCAAGAACGTAAAGAAAA
GGAGCAAAGATGAGGTTTAACTCTAGGACTCCAACCTGGAGTTTATTTCATACTGAAACG
ATTGAAACCTTGAAAGGCTTTCTTCCTGCTGAGCTAGAAGGATCATCAGCTTTAGTACCT
ATTGCCCATGTTGATCCCAGTGTTGTTGGCAGCAAGATGTTTGGGAGTCAAGGGAGATAT
TGACAAGCTACCTGGCTGCTTTAGCAGATGGAAGCTTCCATTACACAAGAATCTGTAAAA
AGTGATCTGTAAAAGTAAGGAGAGTGAAGGCCTGATTGTTCTTTGATTCAGCTGGAATAT
GTCCTGCCTGTTGAAGATGAATAGAAATTTGGGTTGTTTTGTTTTAAGTAATGACTTCAC
ATGAAATAAAGATCTAGCTTGAAAGCATTAAGTCACTGAGGAAAATGGCATGGCTGTTTT
GGACATATGCCCTACTCTCTAGGACACCAGGTTAATTGGATGAGTAAAAGCAGAAGGCTT
GGTGTGTGAAAGCTATGGAAGCAATTGTGTAGAGAAGTCTACTACTACAGAGCTGCTTTT
CTTCCCTATTTCAGCCCTCAGATCCTACAAGATTTTGGTGAAACTTCCTCATGAAATTTA
GTGCTTGTCTTCTCTCCATAAGCAGTTAGTGCAGTTTAACTGATACGATGGCTGATGTCT
GAAGAAGCAGTCTGTACATAGGCGTGTTTCTTGGGTTGATCTCCTAGTTAGCAAAGGAGG
AAAAAAACTAGAAAGTTTGAAAGTAGGTGGGAGTCTCACTTCAATCGCTTGTGTATCTCC
ATTGGAACAGTTTCTCAAACTGGAATTAAGGGCTCAAAGTAGTTTAAACTGCTGCTTACA
CATCATAAATAATATAAAATGAAATACTTTAAAGATGTTAAAAAAAATCCTGTCACTGTT
CATTTGAACTGAAGTCATTGCTCAAGATTTGTATAGGTTACATCTTTATGACGAGAATCC
TTGCATGTCCATGTAGCAGTGGTAATGAACCTCAGCACGTATTTACTGCTACACTTAGTT
TAAAGTAATTCCTTCTCATCTTTGTCAGTTGTGGTCTTGTTTTAGTCTTCAATACCTGGC
TTGAATTCACCAGTATTTCTAAGATACCTTGGGAAGTTAATTTAAAGACAGCGTGAATGG
AAATCTTGCTAGAGTGGGGGGAATAAATAGAGCAGAGCCTCTACAAGGCTGGTAAATGGA
TTTTGATCATAGCTGGCTGTCCAAATGTCATCAGCAACCTGGACACCATGGGAAGAGCAA
GCTCAAACTCCTGGCTTTGCCTGACAGAGTACGGATGCAGTATCTCAATCACAAGAGTCT
GGGCCTGGATCCTCAGAGATCCATTACATGCCAAAAATAAGTTTCAGCTTTTGTGTGCCT
GGTGGGGCAGCTGTAACTTGAAGAAAGTGCAGTCATAGCCCGTGCTGGTGCACCTTACTG
TTTAATCCTTAGCTGACTGAATTTGTGTGAGCCATCACAAAGCTCATGTACTGGCTTGCT
CAGCATGAGTCGTGTGATACTACTGAAACAGTGGAAGAATGATAATGCTGGAATGTGGGT
CTGAGATACTATCTTGCTGCTTATGCCCTGCTTAAACAGTTGATAAGCATTGTTAAGATA
GTTTATAACATTCCTAGCTTACAGTTGACAGCATATCTGTCAACATTTTTCTTGAAAGTC
TCTTAACAGCTGACGTGTATATGAGAGCCCTTTTAAACTGTACTTTCTTTTTCTGTTTGA
GAGTAGTAATCAACGCTGAAAGGTCGTTGAGAATCTTTGAAATCTGTTTAATTCAGAATC
TAACAACATATGTAAAAATGCTTACAGAAATAAAGACAAGTACAAAGAAATTTATTAGAA
ATTATGAGAGTTTGGGTTAAAATTTGGCCAGAATGTCTGCAGTGGTCATTCTAATAGCGA
TACGTAATGTTGTGTAAACATGTCTCTTCTCAAGAAGAATTCCATGCAGTCTTTAGACCT
GGATCACTGAGAATGAGTTCATGTTACTTGGGAACCCAGGGAGATGAGAAAGTGCAAAGC
TGAAGTTAGCCAGATGTGCTGGGGGGGGGGGGGGGAACCACAAGAAAGAAGTCTGGAACA
TCTCTGGTGTACCTATGTAAAAGACAAAAATAGGCTGTATTTCATATTACTGCTGTAGTT
CAGATGATGAAGGCAAAAGTAGTGAGGTTTAGCACAGCAAACGGGCAAATGTTCTGAGAA
GGAGTCTTAGTTACACTGCTTCATCTTCAACTAGGCAAAGAGCTTAAGTTCTTTTAGCTC
TTGGTCACTTGATGCATAATTAACTCTTGCATGCCTACTCCTTTTGCAACATACAAACTC
CTCCAGGATAGTTAACAAGAAACATCTTGTTTTGAAGTCATGGTATTCAAGGTGTCATGT
TTTATAGCTGATTTTTTTTAATACTAGAATTGAGAAGCTTTTGGTGACTGTTATTTTGTT
CTTAGTAAACCGTAAGAACAGTCAAGGCAGAAGCAGACAGCACTGGAAAAATTCTTCTGC
TTTGTAAGAGCGCTGATTTACTACAGCAACAAAAAAAAGCAAGATGTACAATGTAAAATG
TGAAGTTCTTAGCTGTTAGAGTACTTGTTCTCTTTCCCAAGTACACTTCCTTTTGCCAGA
GGGGAAATTGATTTACTCTCTAATGAAGGTGTTTCTACTTTTGCATACTCAATTAACATA
TGGACTTCTTGCCTGGTGTTTAAATTGTTGAATAGTTACCTGCTGGTGGTGCAGAAACTA
GAAGAAACCAGCACATTAAGTACGTTTTTATCACCTTAACAAAAAGGGCAAGGCTATCAA
GTAAAAACTCAGTCATGCTGCAAAATAAGCAGCTCGACTTCACTGCTTGCCTCCCTCCTC
CAAGTTGGTGAGGGAGATGGCAGTTTATTGCTTAACAGTTTAATATGAACTGAAAGTCAT
GCTGAGCCTCTAGTTGGGGAGGAATAGGAAATGATTTGCTTTCAGATTTCTTTGAACCTT
GACCTACTAGATGGAGTTTAGAGAATGCAAATGTAGATTAAAAAATAGTATCAAGTAGTT
ACAGAGGGGGAGGGAAAGAAATTATGACTGCTGTTCAGACCTTTATGAACTAACCTGAGT
TTACATAAACTTTTCTTGTATGTTAATGATCTCTAGTTAGTTTAAAACCGTGTGCTCTGG
TTATTTTATTCATTGAAGTGCTTTATTGCATGCTGTTTTGTTTTCTAACTTCTCTTCTTT
TTCCATTTAAACAGAAAGATTCCAGCCAACCTGCTGAATGCAAACAACAGTAATAAGGAA
GTACCACTTCAAAGTGATATTTGAACAACATGTAACAAATATTTGGATACCTGGCCTGCA
GTTCAGGATACTTCATCGCTGCAGCACAATCTTATTAACAATGCTTAAAATTAATTTGTT
TTAAAATGCATGATTTTCACTAACTTTTCTTTATTGCTTAACATGTACAGTGGCAACTTC
AATGCATTTGGGAAATAAGAGGTTTAAATAAAGCACACTCTACAGCCGTTGGTACACTGT
AGCTTAGTATGTCGGTAGGCCTTTTAGAGCCTTTTGCCCTATGCATAGGGGAATAGTCCA
GACTACCAAGTGAAGATTCTCCATTTTCTTGTTAACCTTGAAAATTGTGGAGTAGCAATG
TGCTGAGGAGCTAAAGTGAATGGATTACATGTATGGTAGCTGAAACAGAGCAATATGAAC
TTTTTGCTAGTTCCCTCTCCCCTTTTTTAATGTTTCTTGCAACCTACAAATCGAACTAGT
GCTTGAGCAGCTTTAAATGTCATATTTATTATCTCAGTACAACCAATTGAATTGAAGTAA
TTTTACTTCATGGAAGGGGGTGTCATATTTGAGACTTAGTTGTTCATCTTACTATTTATT
TATTCATGTTTGTAAGTACTTTGACAGAATTAGTGCTTTTTAATAGTTTTTAATATACTT
GAAAATATTCTTCCTGTTTTGCATAAAATATGGGTACTTTTAAACAAATTTTTTTAATTG
GTCTCAATGTAGTAGCCTAGACAGAAGAAATGAACTTACATCAGAATGACAACTCTTCTG
GATGGAGATCAAAACACAAAGGCCAAACTGTTGCTGTTGATGGAAGTGGGTTGCAGCCAA
AGAACCAGAAAAATTCCAGTAGTCTTATTGCTTAGTGTCCAGCATGGGAAGACCTTATAC
TCCGAACACAGAAGCTTAACGAAATTGAATTCAATAAATCTGAAGTTTTGGTGTCTTACT
AGCAACACTGAAATTATTTCATTCCACAATTTCTTTTATTTCAAGCTCTGAAGTCTTCAA
AACTACTTTCTGTTGTTGTGCGGCACTTCAGGTACATGTTTCTAGTTTCAGCATCCATTG
CCAACCTCTGGCAGCAGTTGAATAGCAGCTGTATCAACACTGTGACCAGGCATGTAGAGT
GCTCCAGCCTTACCTTACACATTTGTAACTTAATACGGTGTTTTCAATTTGTACAGAATA
GATAGAATATTCTATTAAAGTTGTGAAACATTAACTTTGGTGCCTGTCTGGTCCGTAATG
CCTCTAAGGGTCAATAGAACTCCCTTCGCTTGTTGTAGTTAGTTCTGAGGCCTGTAACAA
GGCCATGCCACCTCTTTGGCCTAGCACAGCTCTTCAGTGAGTGTGCATGCAGGTCGTTTC
CTTTGCAGTCAGAAAACAGTACCTAGAAGTTGCATTAGAGAGTTCTTCAATGTAAAGCAG
AACAGACTTGCGCTATTTGCAAGTAGTTTCCTTAACCTCTAGGCAGCTGGGCTGGCTTGC
AGTGTTTGGGTGGTGTTATGCACCAGTGTTTTTAGAGATTCCATAGAGTAATGCAGGTGG
TTTTCCTTTCTTGCTAGGGTATGAAAACTGATTTATGGCATACTAAGATGTCCCCACATC
AGTACTTTCCATGGTGCTTAAGTCAGCTGAGGAAATTGTTGAGGCAGGGGTAAGGGAAGG
GGGAAGATGGGGGAGGATGTGGATAGGTTCTGTGCTGCTATGTCGAGAAGGGGGGAAAAG
TTTGTAGCCCATCATCACTGGCTGTGAGGCTCCTGAAGGAGTTGGAGCGTGGGATGTGCA
GATAGGAGTCACAAGCAAGGCTGCTTGGGAAGGATTATCCTAGTGATAAATGGCTGTCAA
GAGCAGGAATAATTGGAGTCTGCACGCATGCAAACTGCCTAATAGCAGTGTTAGTGATGT
GAGGGGCATCAGATAGTTACGTGACTGGTTGTCAAGTGTATTTATATATAAATAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 2768..2808, 4904..4935, 6124..6191, 7168..7267, 7944..8085, 8217..8303, 9822..9947, 11444..11515, 13668..13807, 15304..15449, 17029..17051, 17638..17757, 18051..18080, 19313..19369, 20507..20544, 25634..26654
4922..4935, 6124..6191, 7168..7267, 7944..8085, 8217..8303, 9822..9947, 11444..11515, 13668..13807, 15304..15449, 17029..17051, 17638..17757, 18051..18080, 19313..19369, 20507..20509
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved