Gallus_gallus Locus Q5ZK27_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus Q5ZK27_CHICK
Gallus_gallus
Q5ZK27_CHICK
4
SNORD73
4001..4071
10564
AAAAACATGAAAGCAGGAAGAGGGGAGTCAAGAGAGCTGCAGTTGGAATGCTCTGAGCT
GCTGCTCGAATGTTTCTCTTCTTCACTCTGGTGAGAAACCAGCCTGATATCTCACAGTAC
TAATTATTGCGCTTGCTTGCAGCGCTTTTATCCTAAGCGATTTCTGGTGCCTGGGTGTTG
GGATCACACGATCTCAACGCTTAATTACCTTTTAGGTTTGCTTTCTTACAAGTCTTGCCA
CACCCGGGAAGAACAGTTTTAGGCGTCTCTGAACGAAGCACGCAGAACGTACGGCAGTAT
TTGTCCCTGTCTGTAAGAAGCACAGCACCCCGGAGCTGCAGCTGCAGTTGATTACTCACA
ACGGCGTGACTACCCGGGCTGAGCTCCCGTGTAACTCAAAGCACAGCGCTTCTCCCACCT
GGCAACGAGCAACTACCGGAGCCAGAGCGCACCAACAGGGGGAGTACCTCCAGCAGTGCA
GTAACGCCGCGAGACGGGAGGTCTGTAAGTCGTTCCCAAGTCTAATTGCGTTTGGCGTTT
AAAAACGTACGCCTTTGTTCTCATCAGCCCTGCCGCGCGGTTGATTTGCAGTTGCGGGAT
GTGACAGCCCTCTGTGATCGCATTTCCCTTCCTGCTCACGGGCACAGCTTTCTCTACGGC
CCAGCAGGTCGCGCTCGTTGGATTTTATTTATTTACTTCTTTATTTTTATAAGCTTGTTT
GTTTGTAAAACATCTCTCTGGCTTTTTCATCCCAATGCACTGACGCTCTCCCAGCACCGT
GCGCTGACCACCAGGGCTCGGCCCTTCTCACTCTCCGTGCCGGCCCGTGATCTCAGCGAC
GCGTGCCGCGCCGCCTCACAGACTTCTTAACCGCTGCTCACGGCCAGCCGGCTTGGAACG
CCGGGCACGGGCTGATGACGCGTAGCACAGGCGGGTGCTGACAGCCGCAGCCCGCGAGGA
GGCGGTATCTGGGAAGAAACCGCTCCCGCCCAGTTGGTTCCGTCCCAGAGCGCAGCCTCG
CCTCACGCGGAGCCCCGTTCTCGCGAGACCGCTGCAGCGGAAGTTCTCGCGGGAGCGCCA
CTCTCGTATAATCTCGCGCGAGGGGGCGGTTCCCTCTTTTCCGCGGCGCGGTGGCACCAT
GGCGGTCGGCAAGAACAAGCGCCTCACCAAGGGCGGCAAGAAAGGCGCCAAGAAGAAAGT
GTACGTGCGGCCGGGCGGGAGGCGGTGGGACCCGGGGACGTCGGCTGGGGCGCGGCGGCC
GCAGGATGCCGCGGATACGAGGCGGATGGTGGCGGCCGGGCGCAGGCAGCTAGGAACGGC
TGCTGTCATGGCGGCGGCCGGGCCTTGGCCTGCGCGCGGGTCAGGCTGCGGCGGAGCCCA
CGGAGGGGCTCCCCGTGAGGTGCAGGCCGGGTGACCGGGGGCCGCGCCGTGTCCCTGGTG
GGCGAGGTTGTGAATTTTGCGGTTTGCACTGCCGTTTCACGGAGCATCCGAGGATGGAGT
TGTTTCAGCCAAGCTTAATCTGTAAAAATTGGTGATTTTTTTTTTTCTTGCTCTATTTAA
ATGAAGGGTTGACCCTTTCTCCAAAAAGGACTGGTATGATGTCAAAGCGCCAGCGATGTT
TAATATCAGAAACATTGGGAAGACTCTTGTTACCAGGACCCAAGGAACCAGTGAGTATTG
GGGTCGTACGCAGTACAAAGATATGTATTTGTTCCATGTAAGCCCTTCAAATGAGACTGA
ACTAAAGAAGTGCTGACAGAGCTTTTCTTGTTCAAGATGTGAGTTTTGAATTAAAAAAAA
AGATTAACTGCTTGATTACAGTGAGTTGTCTTAAGTTGACAGGTAAAACTTAGTTAGAGG
GGAATTAATGCGTTGTGGTCCTTCTTTATATAAGAATATCAAACCACGGGTAGGAAGATA
AGGATGGAGTTCCTGATGAGCCACTGGTATAAGAAGGTTAACTATTATGGAGTTGTCCTG
AATGTCAGAGGGAGATAAGGAGGCAGTGACATCTTGGTCGTGACTGAAATTCAAAGTTAT
TAAGTAGGAGGTCTTTGGAGAGAGAGAACTGCACGCTTAACAGGTGATTATCAGGACACA
TTGCTGAAATGGGTAAACTTTTTTGCTGAACTACATATGTGAGGGTAAGGAACCCTTTGA
TACAAAGGCACAGTGCTCTGGATGTAGTTAATTTTGGAAGATGAGGTATGTAGAGTAGTT
AAATAGTTACATGTTCTTGGTTGCACTTCAAGTTATGAAGGTGGTGGTTATTTTGAACTT
GGTCATGTGAAACCAAGAAAATAAAGATCGCTGTAAATTACGTATGAGTCAGGCAGCGTT
AAAATTCCTAATTTTTAAGCAAAGATGTGAAATAACTGCACTCATTTGCTTCTGCTTTCT
ATCTTGAGGATACATGGCTCTTTGGGTTTATCTTTACGTTATTCTTCCTCAGAATGGAAC
TTCGATATCTGATTTGAGTAATGCCTTTCTAACATTAATACGAGTTGCATCATTTTGTTT
CATAATGCAGAAATTGCCTCTGATGGCTTGAAGGGTCGTGTATTTGAAGTGAGTCTGGCT
GATCTGCAGAACGATGAGGTTGCCTTCCGTAAATTTAAGCTGATAACTGAGGACGTTCAG
GGGAAAAATTGTCTGACCAACTTCCATGGAATGGACCTCACCCGCGACAAAATGTGTTCC
ATGGTGAAGAAGTGGCAGGTGTGTAAAGAACAAGGTCTGCGTTACTGCTTTCCTCTTTAG
GAAAGGAAGTGGCTACTGGTGTGCCCTAAAGCTGTTTCTGATGGTATTGGCGGATATTAA
TGAATGTCAGGTGCACGTCTGGGAGGCCTGTCATGGGCATAACTGTTTCTTTTCCAGACG
ATGATTGAAGCCCACGTGGATGTCAAAACTACGGATGGTTACCTACTGCGCCTCTTCTGT
GTGGGTTTCACAAAGAAGCGTAATAACCAAATCCGCAAGACCTCGTATGCCCAGCATCAG
CAGGTTCGGCAGATTCGCAAGAAGATGATGGAAATCATGACCCGAGAGGTCCAGACCAAT
GACCTGAAAGAAGTTGTCAATAAGCTGTAAGCTGATGGTTTTTCTCTTTTATAGTCCGTT
TCTGTTACTGACTGAAGGCTGGTCCTTCGCTTCTCTGTTTGGCAGAGACCAGGTGAAGCG
TGTCGCTGGTGCTGAAAAGCTGATGTGCTTCTTTGAGCGCTCATCTCTGCATCATTTGAT
TATTAGCCATCATGTTTGCATTAATTTACAATCAGGCTCTCCAGAGATTTTTTTTTTTTT
TTTAATTTACATCTCTATAGAATAAAATTATAACTCTGATAGGTTGAATTTGCAAATGTT
CTGGATTTCTCTGGGGGAAATCTTCCAAAATAGTTTCCTTTCTTCCAAAAGTTAGATGGC
CGGTTTGGTCTCTAAGTGACTGTGCTTGCTCTGTTTGTACCAACATTGCAAGGAAAACGT
CTTGTGATCTAAGCACGCTTTGCCTTCACTCTGGCAATCTTGTTGTACTGAGGCAAACTC
CTCTTGAATGTTATGTATTAATTATTTTAAGTGTGTGTTGCTTGATTAGGAAGCGGGCAC
AGTTCTAACATTTCAGTGTTAATCTGCTCTCTTGACTGCACAGGATCCCAGACAGCATTG
GCAAAGACATAGAGAAGGCTTGTCAGTCCATTTACCCCCTTCACGATGTCTATGTCCGCA
AGGTTAAGATGCTGAAAAAGCCCAAGTTTGAATGTAAGTCAATTAATCCTCGCATCTGGG
GATTGAGGGGGTGGGGGAGGGAAGACACTGGAAAATATTTGCTTTTAGGGAAAGATATTA
CAGCTGCATCAAAAGATTGCGTTGCAGTCATAGTTAAAGGGCTTGTCCTTCTAGTCAGAT
GTTTGGCTTTCAGGCTGGGAAGTCACGTAGTGGTTACTCAGTTTGAAGCTTTTCTTGAAT
TCTAGCATGAAACTATGAATGTTCAGAGGCTCTGGTTTGGGAATGAATGATGACAAATTG
TTTCGGTCCCAGATGACACGAAATGATTTTAATTTTCCCATTTTCTGACATTCCCATACG
ATGAAGCATTAGGTTATTGAAGTATGTATATCTGTAACTTACTCCACAGCTTGTTTTATG
TTGGACTCCATCGCTTAGTTCAGCATCATCATCTTGCACGAGCTTTCTGTGATGGAGTTG
ATCGTACCTACATTACATGTGCTGGTGGTTTAATTTGTACGTGGTAATCCATTCAATGAT
TCAGAGCTGTTTAAAATAAGCGTATCTCACTATTCACAATACTTCTTTTTAGTGGGCAAG
CTGATGGAACTGCACGGTGAAGGTGGCGGTGCTGGAAAACCTTCTGGGGATGAGGCAGGT
GCGAAAGTAGAGCGAGCTGATGGATACGAGCCGCCTGTGCAAGAGTCTGTCTGAAACTAA
ATATTGACCAAAAATAAAAGTTTTATTACACACGAGAAGTGTTTGGTTGCATGTATTGGT
ACTGGATCATAGTGGTACTGGAGGTGGATGTCTTTTTTTTAATAGGATAGATCTCTCTTT
GAACTGAAAAGGAGAAGATAATTGTTTTGGAGATTTGGGTTTTTTTATGGCTGGTGTTGC
AAGATAAGTGAAAGATGGTGGATTGTCCTTTTTTGAGAGATGCTATTGGAAAATAACACT
GCTAAGATTTTTGGGGTTGTTTGTTTGTTTTTTCTTACCCCCAAAATTTTGGTCCTCTCA
GAAGAAACGGAAGTTGTGCTTCAAGGTTGTGTTAAATTGGTGAGAAGTGCTTCAGATGGG
AGCACTGTACAGAGCAAATTGATAAATGGAGGACAGGGAAACACTTTCTTTCAGCATTTC
TTTACTGTGAAGGCATCTTCAGGATTTATCACGTGACTGAATTTGGTGTTATCTCTCGTG
GAACTTCTGAACAGAGGGAGGTGTTTACTGTAAAATGGCAACGTCTGAAGTATTCATGTG
TAAGCACACAAAATCTTAGGCTGTTTGAAGTCACCATCCTAATTACTGTGATTTAATATT
CAGGTAGCTCACCTTTCTTAAGGTTGTCAGCACAGACCTTGATTTGCTTTGCAGTTTGTA
TAGTGGAGGGACAGTGAGCATGCACAACTTCTATGATGGTGAAAAAAGGAGAAAGGGATG
AGTGCTGCTTTTAATCTGCTTTGCTCTTCTGTAACGTTGAAGCTGTATCTTAAAGTGGTT
AATGTCAGTGGAGCTTTATAAGGTTTGCTGTAGTGCTACAGGACACAGGCATCCTTCTCT
TAAAGAGTTCTAAGCAGGGATATTTTGAAGCCATGTCACAGATTTCCCATAACTTCTCCA
GTAAGAACAAGAGCTTGTCATGGGAGTGAAAAGCAAACCATGATTCAGTGTGGTAACTGA
AAATCCTACAGCATTTTTAGTGCAGTCCATGTGTATACGCATATATTGAAGCTATGTAGA
CTAAGATCTGTCAGCTTTCTTGGAAGCGTGCTGTAGGAATTACTGCAAAGCAGCAAATGC
CTCCACAGAAATCCTGAAGGACTGAACTGGCCTGTGCTCACTGCAGAATAGGAGTTAGAA
ATGTAGATACTGTTTCTGAGCTCATTTGTGAAAAATTGCATCTTTTAACCCTGTTTTTCC
TTTAGTTGTTGGCCTGCACAGTGTATGTTGCAGAACAGCTCCTGTAAGAGCACGTTGGTA
AAGAACAAAAACTTGCTTTTTTCAGTTGCTCGGAAACCACTGACTGTTTTCTACTCTTTC
CAGCTGTTTTTTTTTTCTGGTGTTTTCAGCAGTAGGCTGTTGACATTATCACAGAGAGCT
ACAGGTACATTTGTGCCTTAAAATCATTTCATGTGCAGTAGAACAAGTAGTTGTGTCACG
GAGCACTGCCCTTGTTGTGACACTTGCCGTGCTGGGTGGTTGCTGCAGGCAGCAATTGAT
AAATCCTGCATGTGCTAAGTGTGAAAGGTACCTGAATCCAAAGGCTTGGCTAAACTGTTG
AAGCCATCAAGATTATCTGAGGGACTTGCACTGCTCCTAAAGAGACGAAATACTGTTGCT
GGGGTTTGTTTAATGCTGAGTTAAACACACAAGCAGAACATGATCTGTACCCCTGTCACA
TTGAGTGGAGAGCTTAACTCTACAATGTAGGATGATAAAAATGGAATCAACATAATTATA
AAAATTTATTGGTTAAATACATTTTTAATTTACAGAGGTACCATAACAAATGTACTAGAC
TTAACAGATTTATTTACGACACTGTTATTTGCACACAGAACGAAGTCTTCTTCCTGAAGA
TAGTTCCAGAGGTGGGGCAAACAATAAAAGCCTTGCTTATCAAAGCATTTCCTATTACAC
TGGATGTATGGGGCTCCATTTGAATGTCATGGTTACAGCTGAAACTTGCTACTATACTGC
AGTTAGGAACGGCGTTCAACTTCGTTCTTCCTTTTCTGCAATGTACTGTACACCTTAGGA
ATTCTGGCATTTGTATGCAGTTTCATGGTGATAGTAGGCATCAAGTCTTTAACTATCACT
TCCTTTGTAAGGCAAGCCACTAATTACAATAGTTTAGCTGTCTGCAGTAACATAAACAGC
ATGTAGGTGGCACTCCTTGCCCAGACTTTTAAGGCTTTGCTGCTTTTCCTTCCCAGCAAG
AGGGGGAGGAGATGAATAAGAGTGAACTTACCTACTGACAGGCACTGACTTGAAACATTC
AGTGGAAGATAGAAAAACAACTGGTCAATATTACAGCTATAAAAATGTGGGAGAGGAAAT
TGAGGAAAAAAAATTACAAAAATTCAGTTCTACTTGGAGACTTGTATCAAAATCTTAGAA
AACTGCCAGGCAAACAATAAGTAAACATTATACACTTAAGCCTCCTCCCCCACCACAGTG
ATTGTATATTTTCTGAAGACCTGGTATTCTGTTTGTTGGAGTGGTTTTGTTTGTTTTTGT
TGTTCTCCTCATGTTCTGCTCACAAGAGATTGAGAATTTGTCTTGGTCATAATGGAAGAA
GCCTGCTTTAAGAGGGTGGCCTGCAGTTTAAGTTGAGAAGTTAGAAATCTCTCTTATGCA
TTCATTTCACTGGAGAAATCTCTCCTATTTGTTTTGCCATAGTCCTGGAGAAAGCAAGGG
CCAGCTTATCTGTATAAAGAGCCATGGGCAGCTCCAGGCAGCAGAGCTTGGAGAGAGTTG
TCCTCAGAGGTGGCCTGCAGTTTAAGTTGAATCCCACAGGAGTTCAGGACAGGCTTGTTG
GGACGTTAAAACTGAATAACAGCTGTATAGACAGTGATGTTTCCATCTTTATAGGATAGC
ACATACACTGTAATGGTTTTTATAATGTTAATCTCTTTAATGCAATTAAACTGCCCTTCA
GCTTGGTTCTGACTGGAAGCTTGTGTTGCCTGCTTTGCTGAAGAGGAGGGAAGGAAGAGT
TTTTTGCACCAGTAGGTACTTGTTGCCATAACGTATGGGTCTCCTATCAACAGAACTGTA
AGCCAACACAAAACTAAGCTGAACTATCTCAAGGTGAGTCACAATCATTCTAGTTTCCAA
ACTCTCCATCAACCACTCAGCTGCTAGCGTTCTGGCAACTAGAACCTTAAGACAGAAAGA
TCTTGTATTACGTTGTGGTATCTGTGCATCCGTGCTTCTGAAGTAAGGACTCAGTAACAA
TTTGATGTTTCTTCTTTTTCCCATATAGTACGAAAGTGATAGAATACTGTCAGCACTGCA
GTGAAATTTTTTACTCCTCCAGTCTGCAGTTAGCTGCTAATCAAGACTCATTTAACAACT
CTGTCAGAAACGAAGTGTCACGAAGTGGTGGCATTTACTGCCAGAGGGTCCAGATACCTC
AGCCATGGTCAGCTGCTGTTGCTCAAGTCATGCTGCTGCTTTTACTAAATGATTTTGTTC
GAGCTTCTTTGAAGTAACCTCTTGCAAGATGTTTTTTCCTTAAGGCTGTGACAGACCATT
TATAATGATGCTTGGTATAGCTGGTACGTGCTAACAACCTGAAAGCTAACCCTGTGCCTG
CTGAAAGCCTAAACCAAGGCTGCATAATATCCTTCAAGTTAGGGATAGGAATAGTGTTAC
TGAAGTATGTTCCAGTGCTTGAGTGGTAAACGAAATGTAGACTGAGTGAAGCAGGCTTTC
CACTTACATAAAAGGGGGTGGAGGGACAAATAGTTGAAATAGTACAGCTATGCTGGGAGG
GGAACTGAGAAAGCTGAGTAAATGCTGTCCGTCACAACTCCTGCTGGGAAAGAAGGGTAG
GGTGGTGCTTGACAAAGAGGGGGTAGTAGGAAAACTAAGGCTCTATCTGGAACAGATTTT
TGAGGTGGGTGGAAAGGTCTAGCATGGTTCAAACCAGTGTAAGTGCTATTAGTTAAGAGG
AAAAATACTTAAGTCTTTTCTGATCTCCCTTTATGAGCTGCTTGGGCTAATCTACACAAG
GATTTGCTTGAGTTTTCCCTCTTACCGGTTTAATTTGACATTTTTCTACTGTTATTATCT
AACTCATAAGTGAATTCTTCTGCTAACATGGAAGTCAAGCAGTAAAGAAACCTGAATATT
CAACTTGATCTACATATCGACTGCTGCAATTATATATTAAAAACATCACTTTAAACAGTT
CTTAAAGAAGCTCAAATAAGCTTACTTTCTGCAGAGGTTGTGCATGATAAGTGTAATACC
AGATAGTAAACATGACAGAATACTATTTAAGTTAAAATGGTGTTGCACCACAGTATCTCC
CTAGCTGGAGACCACTAAAAATCGTGCCTGTATTTGCTCTCAGAGCTTTCCTGAAGCATG
GCTAAGTACATGGTCACAAAAGACTAAGATCTTCTTTGACTGCAAGATACTAGTATGACT
GTCCAGAATAAGTAGTGCAAAACATAGATAGTCAGAATACATTGATGTCTTTGCTGCAAA
CATTCTCTCCCAGACACAGGGAGTACAAAGACAGGCAACACTTCATGGTGTGTTTAAAAT
TTGAACAAAGTTTTTGGGAAATATCCCAGCTCTTCCTTGTATTTCTCCTCTCATCCAGTC
CTCGTCTACAGATTCCAGCTCTGTTATAAAATCTCCTGCCTGTAAAAGAAGGAGTAACAT
GAGCCATTACAGCTTTCCATGTAATATTAAGGCATGCACTGTTCATGTTATTCAGAAGCA
ATTAATAGCAATCAAGCAGAATGGTAGTTGGAGATGGTTGCTCCTGTTAGATTTCTTTGA
AACTACATTTACCCAACTGTCTCTTAGGGTAAATACTTGTCAAACACACCAGTTTGTGGG
AGGGGAAAAAAAGAGTTGCCCCATAACTTCCTGAGATGCTTGAGCCCTGCAAGTAGGGAG
GTGTGTAACAGAGGTGGCTTAGAGGCTGCACTCCCTGTGCATGTTCCTGCTCTGGTATGA
GGGTTTTTCTTCAAACATTTCAAAGATTTTTTTTCAATTTAGTCCCAGTGTTTTCCCCAA
CTTGTATATTTCCCTCTTTCCTTTGGAAACTTGCTCAAAAAGGAATGCAGTTGAAGCTCA
GCGTGGCCTTGAAAATAAAGTTTATCTTCCATGTTTGATCCTTAGTCCTGCTTTCATCTT
CCCATGCCATACCCTTCATTCAAAGTATTGGCATAGCTCTAGCCTTTCTGCCAGTACCTC
AGTTCCCTTTTTCTGCTTTGAAGAATCATCCATCCTTCCATAAGGCAAGCTGCTAATGCA
GAAACTAATTATTTTCTCTTTCTAACGTTCACAAAGCAATGTGTTCCAGTTGATAAATGC
AATCTTGGACCTCATGCAGAAGTCTGCTGGTTCTTAGAAACTTGCTTTTGAGGACATTTA
CTTAAATATGATTTTTTTTAATTATAAAGACATACGGTTTCTTTGTGTATTTTCATATTA
TCTAGGCATACAGCAAGTACTTCATTTTCCTTTTGCTCACATGGCAACTAAGGATTGTGC
TGCCAAACTTTTAGGTCAACTTTTAGATTTTGCTGTACTAGGTCTCTCTTAGAGATAGCC
CTGCTGTAATGCTGCCACTTTATCATCACACCATCATGTTGCTGTCATTCCTGTCAAAAA
AGAGGCTCCTTTGACCTTATTAACTGATAAAGAACTGAATGTACTACAAAATGAAGTGTT
GGTCTTGTCATACTTAGTGGATTAGGGAAGTCAGTGAAAGACTATAGTTTCTGACTTCCT
TTCAGTGCCCCTCAGTGAAGATTTTGCCAAGGGTAAGGACCAAAATTTTTATAGTTGCTC
TATATCAAATACATTAATAATTATGTCTGAGCTCTGTTTTTTCATGTTCCAAAATTATTT
TGGGTAATTAATTTTTTAAGCATGCCTTAGGAGCGCAAGATCTGCTGAAAAACAAGACTA
AAAAAAAGAGGCACTTACTTTGAAGGAAAGCTCATCTTCATTTTCACCATTAAAATCATA
GAGAGCTTTGGCTTTTTTCTTCCCTCCCAGAGACTGTGATGTCTCCTCTCCTCTGGCTGC
AGAATACGGAAAAGATGAGTTATTTGGATTTGAGTGAAATACATCTTTGTTTCTGGAGAA
GCTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1199, 1566..1669, 2530..2717, 2877..3085, 3643..3752, 4312..4452, 9555..9564
1138..1199, 1566..1669, 2530..2717, 2877..3085, 3643..3752, 4312..4430
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved