Gallus_gallus Locus RL39_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus RL39_CHICK
Gallus_gallus
RL39_CHICK
4
SNORA69
2430..2561
4359
AGGAGTGACCAGCATGCAGGCCTTATGTGTTCTGACTGTCTGTGCAGCCAAAGAGCTTG
TACTACGCAATCCAGAAGTGCCTTCGAAGCGAAGAAGGAACAAAGGAGGAAGAGGGGGCA
TTGTGCTGTTGGATGTTTCTGGCTAAAGAACCTCAGTTGTAGATTCGGAATTTGAAATGT
TCTCATTGTATTTTCAGTTATTTGAATTTCTTTTCCTAGCAGCTAACTACAACAGAGAAG
AGAACCTTTGCAAAGTAGAAAGACTTTGTGGCCTTAAGTGTGATAATAAATGAGCCATGC
AGTCCGGAGGAGATGACACCTGGATCTAATGCAGAGCTTTACTATAGAGCCATTGGAGCC
ACTGTACGATGCACTCGAGCAGAGCAAGCTTGCAGTGGTGCGCTATTAGCACGGGTGTTG
CCATGTCATGTGGTGCTCCTTCCAAAGCGACGACAGCTCCTTTACAGCAGTAGCACCGAG
CCAGGTCTGCCGGTGGGTGAGGTAGGGGTGGAGCAGAGCGCTCTGGTTCTGAAAAGGAGA
ACATCTGGAATTGCACAGTGACCTCAGGAGGGGAGAGCCCTTCCTCGAGAAAGAATTAAG
TTGGAGTGTATGAATAAGCTGGCTTAATATGGGATACTGCTTGAAATTCTTTTGTAAAGT
CTACCTACACTGAAATGCTTATTTTGATCAAATGTAGTTGTACAGAGCGTCCCCTTCCGT
TCGAGTCTGAAACATTTCCCAACTGCTGCCGCCCTCGGTCTGTGCTTCATCTTCCCTCTG
TTTTGAAGTGTTGTTTTACAGCCCGGAAAGAGACTTCGCCGGTAGCGGCTCCTTTAAGCT
AGCGCCTTTTAGCCGTAGCGGTTTTGTACTAAGCCCAATAAACGTCCGCAAACTGTCGCT
GCCGCAGTGCGTCACTCAGAGCCGCGCCGCAGGGGGGCGCTGTGCCCACGGGCCCGCGTC
GCCGCCCCGCCCTCGCCACGCCCCTTCCGCCTCTTTCGCAGCCGCCATCGTCGGGACGCC
GAACCGCGCAGCGCTATGGTGAGGCGATCGGCCGCCATCCGGCGCCGGGACGCGCCGCTC
CCAGCCCGCTTCCCTCCGGGGGCTCGCGGCGGGGTCTGGCGGGGCGGGAGGGCGCTGGTT
ATCGCCTTCCCGAGTCGGCGCGGGGCGCTGCGCCTCTCCCGCCCGCTGTGGCTGTCCCGC
GGCGGGGCCTGCCGGGGCCTGGCCGAGCTCCCCGAGCCCGCCGCACTGACTGCCCCTTTC
TCTTGCAGTCGTCTCACAAGACCTTCAAGATCAAACGCTTCCTCGCGAAGAAGCAGAAGC
AAAACCGCCCCATTCCTCAATGGATTCGCATGAAAACGGGCAATAAGATCAGGTAATGGG
ATCAGCCGTTGCTCTTTGAGGAGCTGTGGCCCAGCACTGCACAGGCTCGGCATCACATTC
CTGTACAGAACGGCCTGAAGGCTGGAGAACCTGGTTTGTGTGGTAACAGCGTTCACGTAC
TCAAAAGTGCAATGGTATACGGATGCAGCTTTCACACGGGTGTGCGTGGTGCAGACCTCC
CCAGGTTCTGTTGGCCCATTGCGTTTTCCTCAGTGTGGGCCTCCCAGCTCTTCCTTCACG
AGTTCATTTCAGTGTTCTGTAAGTATTTACAGGTGTAAATTAACTGTTGAGATGAGCCAA
CTTTAATTAATGGTCAGTCATTGTAACTGAAAGCATAAACTGTACCTGTGGAAGAATTAT
TCCAGAATGTTACATCAGCAGCCATTCTGTTCCTGGGATTCCTCTTCTAGCTCCTCTCTC
CAATAGCTGTCCCTCTCTTGCTGCCTTCTCAAGGAGCAGTGCCTTACAGAACATACAGAG
CACAGGTGTTCTGAGGCACAGAGAGTGCATAAAGAACCAAAGGTCTCCTTGGATGTAGGG
GAGATGCAACTGACAATATAAGGTGCTTGACTTATGGCTGAAATTAATTTGCAGTAGTTC
CCTTTTCTTTGCCTATAGCACTTGTTTTCAAGCATTAAATTCAAGAAAGCATGGTAAGAG
AGTATTGCAGCATACCAGGTAAATGCGAGGTGTGCAAAAGATGGTGCCAATGTGAGCCCT
TTGGTTTAAAACTGCCAGCCAGTACAGCCCAGTCAGTGTGCAGCCAGCTCATTGTTTTCT
CCTGTGTAGTGAGGAGAATGGCAGTACCAGCAGCTGGCTATGGCAGTGAGGCAGCACAGA
ATTGATGAGTTCTGTTCCTTTTGCTTCTGTTAACCCTTTTCCTTCTAGGAAAATGAGCAC
TGTGTGCCCCTTGTCTTTCAGTTAGCAGCATAAAAAGAGCTTCTGTTTTTGCTGTATTAC
AGTGCTTTGTAATATTTTATCATGCTGCAGAATCTCTGATTTTTGTCTTGTGGCACTGAA
GTGTTTCAGTTATCTTCCAAACTATGTGCTATAGCAGGCTGCAATTGCAGTGCTTCATTC
TGTGGGAGTACTGCCATTTTCCTGCTGAGAGTAATTCTGTTAATGCTGTGTTTGGTTTTA
CCTATATGTTGGTGAAACTGTTTGTCCTTAACATGAACATCACCTCCGGTTCATAAATGA
ATATATGTTATGAATAAATTAATATAGCTTCCCAGAAGAATGTACTTTCCATACGCTGCT
CATCATCAAAAATGATTATTTTTGTCTTAGACTACAAATTGCATGCAGGAAATAGCTTTC
ATGATCATTGGGCAGTCTGTACGTGGGGTTATTTTGTCTCCAAAAGAGAAGGTAGAACAT
TCACATGCTGGTGCTAATGCATCTTTTTCTAAGACACGTTTCTTTCTCAAGGCTTTAGAT
TCTTCTGCAGTACTATGCTAATTGGTTAGCAAATGAAGAAAGTAAACAGAGGGGAATTTA
AACTAAAAGAAAGTACGAAGTTGATTTTTGTTGGCAGCTTGCCACTGTAGCATTATGGAA
ATCCTTTACTGATGAGCTAATTAAAGGTGGCTTCAGTCCACCTAGGTGGTCAGTTGTGTG
TGTTTTGCTAACTGACATTGCTTTTGTCTTAGGTACAACTCCAAGAGGAGACACTGGAGA
AGGACCAAACTGGGCTTGTAAGAGAGACTGTCTCCTGGGAGCTCTAATAACACTTGTCTT
TCTGCATCAGATTGATACACCCCCAAACGCTGATCAACAACCCTCATGTCATTCCTTCTG
TAGTGCTGGACTGCAGTGCTCAGTTCTTGTTCCGTGAGCCAGTCCAGGCTCATGACATTA
ACAGGAATAATATCAAAGCATTTGGCATCTGAAACATTAAGACTGTGTTCTATTAGTGTT
CTTTTTTTCGGGCATCAGAAGTATTAACAGTGTACAGGCTTGTTAATAAATATGGACCTG
AATGAATTGGCTGATTTTGTGTATGTACAGTGGGATAGTAGCCCAGAAAGGTAGCGTTAC
TGCAGACACGTTCTTAACCTAGTGGGGGAAACCTTGTTAGTTCTTTCCAGACAGGTGAGG
TTGTGTCTTCTCAGTTACTGTAGATTGTAGAGCGCCAAACACACCAGCTCTTAAAGAAAA
GGAGTAAAAACAAAGCTGACTTTATAGTAGTTAGTCTGAAGAAAATCTATTATTAGACAA
ATCATGGGGAAAAAAATACAGGCTTTTGGAGGCAGAGGACCATTCACAGGTTTGAAAAAC
ACTCCATGACCCACAGCTGCTGTGGCTGAAGTAAGTGCAGTGTCAGTCTCTGATTTGTTG
ACTGGGGAAGATGGGATTACATTTTGGGTAGTTTTAGGAAATGTTACTACAAAAAGTAAG
TAGCACTGTCACCATTTGTTGAAGTTGTGTCTGTTTACCTCCACTGGTTTTATTTTATGG
AGCTGCAAAGCACATTGAGAAGGTTCCTCTGCGATAAGGTGGCCTCCTGTGTGAAGCTCT
CCAGTTCCCTTTCTCAGTTCTGTTTATGCTGGCATGCTGGATGTAGGGGTTTCCCCTGTG
ACAGAAGCCAGCCACTGATTCTTCCCAACTCCGTTGTTGCCTCCCACATAACCATTTAGA
AACATCTATGGGTAGACCACATAGTAATGCGTAGTGAGGTCCTATTGGCCATTCAGATTG
GTTGCTTCTCTCGTTTCATGATTTTTTTTTAATTGATGAAATAGCACATATGAACAGGAA
GTGCCATGCGGTCAGTACTGGTCAGATGCTGAAATGTCACATTCCCAGAACTACTATGAA
AGCACTTGTCCAGGCAGGGTGAACGTGAAGCTGAGATTGGTCAGTGAGATTGGCATATTG
TGACTGCTTGCCCTGGGCCTGAGTAGTGTGCCTACAAAGCCTGCCCTGGACATGCACCCA
CGTGAGCTGCAGATGGCTCCTTGGGATGTGGGACTTAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1371, 3032..3359
1268..1371, 3032..3077
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved