Gallus_gallus Locus Q5ZKQ9_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus Q5ZKQ9_CHICK
Gallus_gallus
Q5ZKQ9_CHICK
4
SNORD61
3023..3087
12852
AGTACGTCTGGAACTTATAAACAGAACTATAACTTGGAGCAAAAATGGCAAATAGTTAA
TTCTGAGACATCTGGGGTTTTAATCAACAGCTGCCTGGACAAGAGGGAGCAGTGTGCCCA
GGTGCTATCAGAAATAGTAGTCAGCAGGAGCGGGAGGCGATTGTCTCTCTGTATTGAGCA
CCTTGAGTGGTGTGTTCAGTGTTGGGCCCCTCACTGCAAGACACAGAGGCACTGGAGCAT
GTCCAGAGAAGGGTAGCAACAAAGCTGTGAGGGGTCTGGAGCTCAAATCTTATGGGTAAC
GGATGAGGGAACTGGGATTGTTCAGTCTGGAGAAGAGAAGACTCGGGGGAGACCTCATCA
CCCTGCTGTTCCCTGAAAGGAAGTTTTAAGGAGGTGGGGGGGTTGGCCTCTTCTCCCAGG
TAACAGCAATAGGACAGGAGGTAACGGCCTTCAGTTGTGCCAGGAGAGGCTCATGTTGGA
TATTCCTCACAGTTTCTTCTCAGAGAGATCAAGTAGCAGTAGCTGCCCAGGGAGGTGGTG
GTCACCATCCCTGGAAACGGTCAAGAAAAAGATGGATGTGGATTGGCAGCGATGGGTTGA
TGGTTAGACTAAATTGTTTTGATGGTCTTTTCCAACCTTATCTGCTCAAAGCTGTAAAGT
GAGCCTTTAAAGCAATCCCATCCACGCTCCCCAAGCAGAGCTGCAAACAAAGGAAAAAGC
ACCACCCACCATAGAACAACCGCTCCAGCGAGGACCAGAGAGTCTCGCTCACTTATGAGG
GCCTGGCCCACCCTACCCGCAGCGACACACGCCGAACCCCGGACAGCTCTCGGCAGCACC
GCAGCTCCCTGCCCGCCCGCCGCCACGCGGGACACGAAGCGGCCGCGGTGAGAGCCCGGC
AGGCTGCGGTCTCCCCCTGCTGGGCTCGGCGCCGCTTGCATCCGGGGCCCCGGCCGGCGG
TGACGTCAGCGATATAAAGGGCTGCAGCTCCTTTGTTCGCTCCCATTGCGCAGTTGCGGC
AGGGTGGGAGAGGAGGTGAGTGGTGCGAGGCGAGCCGAGCAGGCCCGGGATCTGCGGGGA
GAGGGAAACGGGGCCCTGCGAAGCGAGGGCTGGATGTGGGAAGCGGCGGTGCGATGAAAG
GCTGTGCCCGCGGTGAGGAGCTGCGCTCCGCCCGTCGCTGCGGGCCTGGCGGGAGGCGCG
GTGGAGTCCGGCCTGCCGCCTTCCCTCCCTGCCCGCCGGCCCACGTGCGGGGCGCAGGGA
CGGCTGTGGCGGGGCGCGGGGGGTCCCTGGCGCGAGAGGCGCTTGGCCGCCATTTTAGGT
GTGGGGGTTTCTCGGCGTGGTCCCGCCGCGTGGGCTCCGCTTCTTCGAGGAGGACAAAGG
GAGGACGGCTGCGGGCGCGTCCTGGGGCCCGAGCAGATGGCCCGGAGCGAGGCTTGAGGC
GCGCGGTCCGCTTAGCGCTGAGGCGTTCGTCTGGCGCCGGGAGGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCGGTCCGCTTAGCGCTGAAGGCGTTCATCAGTCGCCGGG
AGGGAAAGAAGGCCCTGCTAGAGGTGGCCGCCATTTTGTGGAGGTGTGTGGAAAACGCGG
AGGGTCCGGCGCCCCCTCCTTGTTCTCTCCCTTCCCGTCCCGGCGCGCCGCTTCGTGAGG
CTCAGAGGGGGGCGGCCGCCGCTTGTCCGCCTGCGCGGTTGGGGCGGCCCGGCCGCCGGC
GGCGCCTTTTTGGGGGTTCTTTGTGTGCTGGGCGAGCCGCGCCGGCACTGCGCCGGGCTT
TCCCGCCACTGGCCTGAGGGCGTGCGGTAACGTTTGTCCGCGGGCGCCGGGCGTTCCGCC
AGACGCTCCGACTGCCCTTTTTGTCTCCGGCTCTTCTTCTTGTCCCGCTTCTCTTAGCCG
TGTTGGGCTGCGGTGTCGGGCTGGTATCCATTCAGACTATCGTGTTGTGTAGGCCTCGGC
TTTGACTAAGTATTGATGTACTTAAAATAACGTAAAAGATTGAGGTTAATTTTGAATGTT
GACCCACCTGACTTTAAACTTAACGTTTTGGTTTTATCTTAACGCTAGTCGTATTTATTG
AAATAATAAGTGAGACACTGAGCCCTAAGATTACCATCAAGGGCAAAAAGGCAGTAAGCT
TAGCTTTTCGGTGTTTGCCACTGTCGATGCTGGAGCTGTTCTCATCAGAGCCCTGCTTTG
TTTTTTGGATTAGAGTCCTTCTACTGGAAATAACTGCTTCAACCTCATAGTTATTCTCTT
TCCCTTTATGCATAACGTCTCTTCTTTTGGCATTTTGTTCAAAGAAAATTGGCTTGAATT
TGAGGAGGAGTGAGTATTCTGTGGGATTGTCCGGCAATCCGCTGTAGTCTAATATTTTGT
TAATGAGGACTGTATGCTTTCATAGGTCTCTTGTATCATCAAAATGGTTGAAGCAGATCG
TCCCGGGAAACTGTTCATCGGAGGCCTGAACACAGAGACAAATGAGAAAGCCCTCGAGGC
TGTATTTGGCAAATATGGACGCATTGTGGAAGGTAAAAACCAAAAAATACTCTTGCCATC
CTAAGATTAGAAACAACAAAACAGCTATGATGACTCCTATAATGTTGATCTTACGACATG
ATCATGTTCTCTAAGAAGTTCTGAGCTTAAAGGTTAAATAAAGGTTGAGTTTTGTTGCTT
AATTACAGCAGAGGGTAACATGGTTTTATTTCCACTGCAGTCCTCCTGATGAAAGATCGT
GAAACCAACAAGTCAAGAGGATTTGCTTTTGTAACGTTTGAGAGTCCAGCAGATGCTAAA
GATGCTGCCAGAGACATGAATGGAAAGGTAGGAATGGAGATCTGCTTTGCTGTTGCAGCT
AACCAAAAATATTGCTCTATGGAGCTATGGAATTAAATTAACTCGTAATAAGACTTGGAA
AGATAGTGGACTAGAAGATTCTGGAGACAAGTTGCAGTGTTAAATTTGTCAGGGTGTCTT
TATTTCCTCTTGTCTCCGTGAAGCTGGAATCACTTTCCTCTGACTCTGGATTTGACAGTA
GAAAGTGAAGCCTGGATGTCATTCAGTTATTTTTTAATAGGTGATGGAGAGCTTTCCTAG
TAGACAGCTTTTCACTCTTGCATGCCTCCTATATAATGCTTTTGTTTTTACTGTATTTGA
ACACAGTACTGCATAAATCATATTTTAGGGAAGTGACTTGCCTGAAAACTGTGAGTGTTT
CCCCTAATATGGGTTTGATGTGAACTGCCTACACTGTGGTGTGTTGATGCATTGTTAATT
TGTAGGTATCCTTATATGTGTGGCATGTATGTGGCGCTTCTTGCCAGTTACAGTGAAACT
GTTTTCAGTTAACCATCAATTGGGTTTATTTATACCCTGCAACAGAACTACATAGTTCAA
AGAAAATATGTACTTAATAACTAATACGTATTATGTCTTTAACAAGGAAAACAAATCTCT
GAATTTGAAACAAAATTTGAGATTCGCATCAGGAGGGCGTGTTGGAGGAATGTAGGTTAT
TGTGATCTAATTTTGCTTTAGCATGTGTTTGAAAAGCTGAATGCCAGTTTGTGAGTTAGT
GATCAACAGCAGATTTCAAAGAAATGCTCTCTTTAGATGGTGTAAGCTGTCATATCAGTT
GACTTGAATTTCAGGCTCTTGCCTGTCATGCATAATCAGAAGAGTTGAGTTGTAAAGATC
ATGCTGAATTGGGCTTTCTTCTAACAGCATCTCTCCTAAGGTTAAGAAAGCCTCTGTTTA
GAATGATTGAATTAATACTTGAGCTTTTAATAGCTGTTAGTGCGAAATAATGACTGGTGG
TTTTCTTTCAATTCAGTGTAGTCTATAAGTAAAGCATAGTGAATATTTGCACTTACCAAA
TAAGGAAATGAGTATGTAGTGTGCACAGATGTGTGCAGTTAAACTTAGTTATTCTTCATT
TTGTGTTATAGCAGACTTTCTGGTGTGTGTGCTGCTTAGTTTCTGAGTTCTTGAGGACAA
TCTGGTGGTGATTAGTGTAACTTTGTATGGAGACTTGCTTCCTCTTCAAGCTAGTCTTTT
TTCTTAGTGGGGAGAGTGACAAGTCAGATAATGTTTGGACTGGTACAGAAAGAACATCCC
TAAAGGTGCGCCTGTTAATGAATCTATCTTCCTTGTGTAGCTTGCTACAGTTGTGAAGAC
CTGTTTACTACAGTTTCAAAATCCTGATTTCCTCTGAGTTAATAATTCAGTTGACCCCCC
CCATACAGTAACTTCAAGCACCAGCAACGAATTGTCAGACTGAAAGGAGTTCAGTCCCTA
ATCCTAAGAACTGTTTGTGGAGTGCATCATTTAAATGAAGATGACTCTGAAAATAATCAG
CTGTTCTAGATCTTGAATGTTGTGTATGTATTCACATGGGAAACATTTATGAAAGTACTG
CTTGCTAAAGTAGCTAAATGCCATGTAATGCGTATCTGAGTTTGTCTGTATTTTTGGAAT
GCACCGTCTGGATCACTTAAGAACTAGGAAATACTGACTTATGGGTGATCATTGTCATGG
CTTCTACCTTCAGAGCTGCAAATCTAAACGTATTTCCATCTTCTTTGAAATTTGACCAGC
AACATATGAAAACAACATCCTCACTCAGGATTTGGGCAAGAATGGCTTTCAGAGTAAGCC
TGCAAGTGTAGCTGTGTATAGCTCCAATTCTGTACCTATCTAGCTTGGTTTAGTTGTGGA
TGTGAAAGATGGTTGTGAGGCAGTACTTCATCAGAAAGCCTTCCGGACAATAAGTGGTAC
CAATACTTCAAAAAGACTGCATTCTGCCTCTGAAGAGGAGTGATGTTTGAGGCATCCTGT
GGGAGTAATTCATTCTAATCTGTCCAAAATGGAAGTTCTTCTGACTGTTTGGAAATGGAG
TGCTCATGAAAAACCCAGACATTTCAAAGGAGGCAACAGCAGAAGCACTGCACAGACAAG
AGCTCATGCAGTCTGTAATGAGAAACTTGACCTGCCCAGCCAAGGGGAAACAGGTGATGT
ATGGGCAGTGTGTAGCTTATTCTGTCATTCCGAAGAAATTCAAAGTTGCAGCCAGCAGAA
GAGACTGAATTGGATGAACTCTGCAAGAACATAAGAATATATCTTCAGTTGCTGGAGTTG
GGGGAAGAAATGGGGTTAAGTATGGTTCATTCTGAAATAGAACAGGCATAAACTTGCTTG
TTGAAATTTTTAGTCCTGAGGAAGGAGGTCAGGAGATGATGGTTTGGGGAGAAGGGGAAT
TTTTCAGGTTAAATTACTTTCTCTGCAAAATTGAATCAGTTATTGCCTGAAAGGCACAGC
AGAAATGTTAAAGTACTTTACAGCAAGTTCTTTAGAAAAAAAATCTTAATTGCAAGGCAG
CCAAGTCATCCTCCTCATGTCATAAAATGCACTTTAAGTACAAGGGAATAATCCAAGTCT
TTAGAGAACTTTCTAACTGTTAAGCTGTTCTGTTCGTCATATTTGAAGTCCTGAGTACAA
AAATCTATAGTTAAGGAGAATGTGACTTTAGAGGAAACATCTGGGTCAAGCCAGAGATAA
AATTCCATTTGAAGCATTCCATTCTTCCAGTTGACGACCTGTCAAGCCAGTTGGAGCATG
TTAAGAGGTTGAAATGAATACTACTATCCACTACAGAAGATTATCGTCCTCTAATAAACA
AACTTATTTCCAAATCTTCTTGTGAAGAAGTGGTATAATACAGAAAAGCTCAGCTTGATA
GGAAATGATCTTCAGTTCCTTCATGCATTTGATGAGAAGTGTTCATGGTGTGTTGTCAAG
AAACACAGAAATGGTGATGGAATTGCAGCAGCATCAACAGTAAAATGGTCCATTGGAGAG
GAAACACCAGCACGGTGTTAGGCTGCTGGTTCATGCACGTGTCTTTGGGATATTTGAATT
ACAGCTACTCAAACTTTCAAATACACCTCATTTAACTTCTGTTTTGCAATGCGGAGCAGT
TTGCAGGACAATTCTCTAATTGTTTGCTTGAGGTTCCCTGGACGCCGTACAAAACTGTAT
AGATTGTTCATCACACATGCAGGAATTTTTTAAATTGTGGTTGCAAATCTACTGCTATCC
TTAAAAGAGCATATATAGTAGAATTTATTTTTTTAGCACCAAGGTAATGCCACAAAATAA
TGCCCATATCGTACTAAAAATGCTATTGTAACACTTGGAATCAAGATTATAAACACCAAC
TAATGAGTGCTTGTTTTGACAGCTGGTGTTTTGGGCCCATTGAAAATTTCTTGCTCTGAG
ATGACTTGTCTGGGTTCTATGTCATCAGTAAGATGAGTTCTTTTCATTTGATTGAAAAAC
CTATGAAAGAAGATGGTTTTCCCTTTCCAAGTTTATCATATTTGAAAACAAGTGCCTTCT
GGTTAACATCAAAAACAAAGATTTTCTTGGACATTAGACACAAATTAGACTGCTTAAAAG
CACTTTCAAAAGAAACCTATGTTTTGCCTCAGTACTCTGCATAGGTGCAGGGCAGAAGAA
AATAAGGAATAGAAACCATTAGGAAGACTGTGCCTTCTATGTTGAAACAAACAAAAAAAA
GAAGTTGGACTTCTACATCCAAGTGTTCAAAACCCTTGCTAGTGGGAAGGGATGATATTT
GGGCTCAAAAATTCAAACAAACTGTTACTAGTCTGCCATGAAACAGAGCAGCTGCAGTCC
TGGTAGCAAAACTTAAGGCTTTAAGCCTACCTTTCCTGTAGTGAGGAAGGTGACTGGGAT
ATGAGAGATGGCAAAACTAGGTATGAGATACACACTATTAAATTCCAGCAATTAGCAGTG
TTAATATGCACTCCTGGAATTTTCTGAGCTTGTCATGCCAAATGTCACTGAGAAACTACG
TAAACTAAGTCAAAACCAAGACCAATGTTATGTTGCTAATGTTTATTTTTTCTCAAGATG
GATTGAGTCAAACCTTTGGATATACACTTTCAGTTTTTCAGTAGTAGCTACAACTGTGTG
TGGTGGTGGAATATGTCCACTACTGGAGTGGATGATTTCAGAAAGGGGCAGATTTCAATG
GAGGAGGAAGAAGATTCAGTTTTACCTCCATAAATGACCACTAGCAGTGCAGAGTGAGTC
ACTTACCAGCAATTTTCTTCTTTTATTGCAATAATGTGCAATTAACAGCACTGCCTAATT
CGTTAATTGTTAAAAATATTAGCTTACAAAAGGTCAAGTAAGCTGCATTTGCCAATAAAG
ATGTGCAGTAATTTCAGTAGAGCACGATCTTGACTCTCCTGACCAAATGTGTGTTGTCTG
AAAGAGAATGCAATGGATACACTTACTGAGTTACTCAGTATGTCTTGACGCATGTTCATA
TTTGAGGTATAATAGCTGGCTGCAGAGTTCCTGTTACTGCAGGTCTATGCTCCAGAAAAA
GCATCCACTTAAAAAAAAAAAAAAAATCCACACTGGAAAAGCAAGTAATAGAGTAAATTA
TGTCAGTCACCTCTTTTTTTTGTTGAAAACTCACCTTGAAACAGTAGAAAAGGGCTGAAT
TACCATACTCAGTCTGCTTTGTAGATGCTGAAATTACTTCTAAATACTTCAGTGATCACC
GTTTAATCAGGACATCAAGAAAATGTACTTAAAACGGCCTCCCCATTGCCAGAAACCCCA
ACTGAAGCTAAGATATCTTCAGCTTAATCCTGTACTGGTGCAGTCAGTTTGGTGCAAAAG
TCCGTGGCAATTGGAAGTAAATTGGAGCTCATAAATCATATTTCATTTACGGAATAAATG
ACATGGGGCTGCCGTAGTCATTGGACACTTTTATTTTGACTGAAAGTGCTTTCTGATGCT
GCTCTGTGTTTTTTCATCAATACCACAAGAATGAAGTACTCTAGAAATTAGGCCCAACAT
GCTGCTGAGTACGTGGGGACTAATACTGAAGACTCAATCTGTTCTAGAGTTGCTCTAACT
TTATAAAATGGAAGCCCTATAATAGTGAAGCAAGAAGGGCTTAATTTAAGAATTACAAAC
GTGACTGAGCAATAAGTAAAGCAGCTTCTTCTTTAGTCATTAGATGGGAAAGCAATTAAA
GTGGAACAAGCAACCAAGCCATCCTTTGAAAGTGGTGGTAGGCGTGGGCCACCACCCCCT
CCACGAAGCAGAGGTCCTCCCAGGGGCCTTAGAGGTGGAAGAGGCGGAAGTGGCGCGAGA
GGACCACCTTCAAGAGGGAGTCACTTGGGTATGTATTTACCTATCTCATTATATACTTGG
ACAACATACAAGACAATCCCATTGGAAGATGACAATAATCCTACTGGAAAAAAAAGTGAA
ACAGCTGAATAGTGCACTCCTTGTTCGTTATTAAAATCATGAAATATAATCTCGGCAGTT
GAGTCAAATTTTTGATTAGGCAAGTACACCTTAAGAAAAAGGCTTTCAAATGTGAAGATT
CCCTTCTACATCTAACACTCTACTTGACTTTTGGCTATGAAAGAAACAAAACTCCTGCCC
TGCACGTGAGAAAGGAAGCTTTTTTGTATTCAAGGTGAAAAGGTGATTCTCTTCCACCAG
GGTAAGGGAAGTGCTTTCTGCTCTTACTAGCAAGAGGTCTAAACTCACTAAACTGTAGCT
GTTTAAATGATTGATCCTTTGGGGTCACAGTGACAAATAGGAAAGCCAAATGTTGCTCAT
GACACTGTTTTGAGTTGAAGCTCTCTGAAATGGAAGGATAGTACACAACTCGATACCGGA
TGTACTTTAACTTAGATATACCTATTTATTCAGCAACTTTTTAGTATTAAAACAGTCACT
TAAAGCAGCACGTGAGTTATAGCAGTAAAAGCTGTAGTGCAGGGGGAAAAAAACTCTGAA
AATAGTGAAAACTCTATTCTTGGAAAGGCTGTGTAGTAGGTCCTACGGTATCTCTGTTCC
CTCTTTATGTAGGATCTTCTCTAGTGAATCTTCCCAGGTGGCTTTTGTCTTCTGAGGACA
GTAGCTTGAGCATTTAACCCGAGACTAAGGACAGATAGGAGTTTTCTTTCTCCTTCGCAG
CACACACTGTGGCTTTTAGATAACTTGTATAAGACAGTTCTTAACAGGAATTTAAGCTGT
GAAAAAAGTTTATCTGGCATGCTCTCAATTCTGCCAGTAGCATCTAGTAGTGACTGAAAA
AAACAAGAGAAAGGTATTCTTAAGGTCTAATGTTAGAGGTTTACTGTTGATCACACAGTA
GTGGTAACATCAGTTAGATTACTGAAGTTGAGGCTTTAGGGACATACAGGTAAGTATTAC
AGAAGTAACAAGTTGGTACATGGCTTATCTTGTAGGGTCTTCTCGAGGGCCTCTTCCCAT
GAAGAGAGGTCCACCTCCACGAAGTGGAGGCCCTCCACCTAAAAGATCTGCACCTTCGGG
ACCAGTGCGTAGCAGTAGCATGGGAGGAAGAGGTAAGGACTTGTTAAATTGCTTTCTTGC
CTAGTCAGCTGTATTGTAATATCTTTATCATCAGAAACTGATGAAAAGTATTGATTTTTT
TTTAACTTAAATCTACTGTGGGTTAACTGGTCATTCTTACGATCTGTCAGTTCTTGTCAC
ATGGACATTCTCAGCTGTTTGGTACACCTGGTGTGATCTGTTGTGTTCTTTTTAATGCTG
CTTTAAGACCTCATAGGCAGAAAAGTATTGTGAATGTAGGCTACAGGTGATGCTTCTGAG
TCTCTGTGAACCGTGAAGTTGTAATTGCCTTGAGTCTTCTGTGTGGTTAAGTGCTAACTG
TATTATAAAACTTGTGTTTAAGCTCCTGTGTCACGTGGAAGAGACAGTTACGGTGGTCCT
CCACGCAGAGAACCAATGCCGTCACGAAGAGATGTCTACATGTCTCCAAGAGATGATGGC
TATAGCACTAAAGATGGGTAAATTTTCTTAGCAATTTGGATTGTCTCAATATTTTCATTC
TCCAGAGGATTTTGATCCCTGATTACTGTGACATAACTCAGTTCTTGTTCGTTGTAGTTA
CTCGAGCAGAGATTACCCCAGTTCCAGGGACACACGGGACTATGCACCACCTCCGCGTGA
CTATGCGTATCGTGATTATGGTCATTCCAGTTCACGTGATGAATACCCCTCCAGGGGCTA
TAGGTATCTACTACTGGATTTTTGTCTATGTCTTTTTTTACTTCTCCTGTGATCTGACTG
ATTTGTACTAAGTCTCAGTAGTCTTTCCTCTTACAGCGATCGTGATGGATACGGTGGTGG
ACGTGACAGAGACTACTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCGTATGAGAG
TTATGGTAAGAATCCATTTTGAGGATCATGCAGTAATTTGTATGGGTTTCGTGAAGCCTG
ACTTCTACGGGTTGATCGTGTTTTAGGGGGAAGTGGCACTTTTTTTTCCCCTACAGTGAA
AGTGCAGTTGTTGGTTATCATTTGATCACACTGTTAAGCTATAAGTTAAAGAAGCAAAGT
CTACAGTTCAGAATTACAGCTATCTCTGGAAAATGTGGCTGAGTTTCTTCTCTAAAATAA
CAAGCTGTTCTGGAATACCCAGTAAAGAGCCTGCCTGAATAAACACCGTCTTCATTCCTT
CAAAGTCTATTAAATCCACTCACTGCCTGATACGCAATTCCCACTTAAAATACCATTAAC
ATGGCAGATTAAATAAAGAACATCTCAATGCATACAAAAGAGTAAAAGTAAACATTTAAT
ACAGCAATTCTGTAAATTCAGATTGAAATTGTTTATATAACTTATGGTGTTGCCATATTA
CCTGACCATTGACCCTGCAGGTAACTCACGTAGTGCTCCACCTGCACGAGGGCCCCCGCC
ATCTTATGGTGGAAGCAGTCGATATGATGATTACGGCAGCACACGTGATGGATATGGAAG
CCGAGAAAGTTACTCAAGCAGCAGAAGTGATGTCTACTCAAGTGGCCGTGATCGTGTTGG
AAGACAAGACAGGGGTCTTCCCCCATCCATGGAAAGGGGCTATCCACCTCCTCGTGATTC
ATACAGTAGTTCAAGCCGCGGAGCACCCAGAGGTGGTGGCCGTGGCGGAAGCAGATCTGA
CAGAGGTGGAGGCAGAAGCAGATACTAAAAACACTCTTAACTTTTTTTGGACCAAGACAT
TACTTCTCAAACAAATTAAAAAAAAAAAAGTGGAAGTTCTATCTTTACTACCAGAGGACT
ACTAAAAGGAAAAGTTGTTTTTACCTTTTTTTATTGTTGCCTGTTAAGTTTTCCCCTCCA
TGACTTTTATGCTTTTGTGAAGAAAAGTTAAACCAGTGTTTAATTTCATTTCAGAATTGT
TAACATTTCTTTCAAAAGGCAGATGTTAAATGTATAAAATTTGAGCTGTGTACTAGTGTT
GTAATTTCCAAAGTAAAGTTTCCCTGAAATGCCACACTTCCCATCTGACTTTCCTCGTGA
ACGGAACAAGCAGTTCTTAAGATCTTCCACATAACATCCAACTATCTAATATGGAGCTGG
ATTGTTCTACATATTCAGCATCTCATTCTTAAAGTATTGTTTGTGATGTGGAGGGTGGTG
GGGATGTTCCACAAAAAAGTTCATTTTTGTCTAGAATTTCAAGTCAGTGTTTCCTGAAGT
CAGTGTTCCCAGTAGAAAATGCCTTCAGATCCTTGTGTTTAAAAAAAAAAAAAAAGTCAC
TCCACCTGAAAAAACACGTGGATAATACTATTTTTTTGCCTTCCTCCTGTTTCATGGGGA
GTTTAAAAAGTTCTCCCCATCAAATGAACCATGTACATGTAAGTCAGCTACAGTATACTG
TTTAAAAAAAAAATTAAAAAAAAAATAAAAAAGTTTGACCAATTCATCAAAGAAGCTACA
AAGCCATGCTTACTCATACTGTTTCAAATTTTTGCAACTCTGTAGTGTTTCACTTTTAAA
GGAACATCTTTGATTCCAAAGGAGAAAATAAGATAAGCAAAGAAGTCTTTCTCTCCAACT
TCTCAAAGGCTTATGGCTTCCTAAAAACAAGTGAAACTTTCAGCATTCCACAGCTGATTT
AAAGCAACAAATGCCTGTGAAACAGCAAAGATGGTAAGCAAAGCAAACTAGTTTTTCAGT
CTAAGTCAAAATTGAACCAAGTTTCTTCCTCTAGTACGGTAAAACAAGCTGCACGTCATG
GCAATGGAAGTGCTGTCTAGATTTAAAAAAATAAGGAAATGAAATACTTCAATACATTAG
AAGTTCTCAAAATTCAACATTTCTTCTTGGATAAAAGAGTTTATGGCACCAGTTTTGAAA
CTAAAGATAAGAATGCAGCTCGCTGTAGACAGAATACTGTGAAGTAGGGTTGGGAGGGGG
TATTTTGTGCCCAGTATCTCAGTGAAGATGCTCAAACAGACTGCGTGTACTGTTACTTTA
AGAAAATTAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1034, 2845..2971, 3160..3266, 8496..8667, 9755..9871, 10222..10336, 10437..10562, 10641..10744, 11240..11852
2863..2971, 3160..3266, 8496..8667, 9755..9871, 10222..10336, 10437..10562, 10641..10744, 11240..11544
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved