Gallus_gallus Locus DKC1_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus DKC1_CHICK
Gallus_gallus
DKC1_CHICK
4
SNORD83, SNORD83
3567..3642, 6317..6392
10085
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTCCTCATCAAGCCCGA
GTCCCGCGTGGCGCACCTTTGAACGTCCCAGTGGCCGCTGTTGCTGAAGGTAACGAGCAT
AGAGAGGGCGGTGGCTCTCCTCCTTTCTCTTCGGGTTCCGTTCGGGTTCCAACTCCGTGA
GCTGAAAGCAGTGTGGCCCCGCCGGGTTAATTTGTGCTGCTCCGTTCTCTGCCCCTCATC
TTTGCCATTTTAGTCGTTTTCCCTTTGGAAGCGGCTCGTAAACCTGAATGCAAAGCGCCC
CTTGTACAACTGGGAGCTGTGCTGGGACAAAGCTCTGCTGTCCTCGGTCTCACCTCCATC
TCCTGGTACTTACAATCATTCATTTGCTTTGCTGTTGTAGAACTTTGACAAACTAAACGT
GCTGACAACACACTACACACCCCTCCCTTCCGGCGCTAATCCCTTGAAGAGGGAGATCTC
TGACTATGTACGGTGAGTGTAACCATCCAGGGTGTTCTGTTTCTCTTCCACAGTTAGCAT
CTCGCAAGCACGTTCTGTCCCAGATGCCTTTTTCTTTTCTCTTGACTCTGCCTCACTGTT
CACCACTGAATGTCTGCCTGGGACCTGCTGGCTGCTCTCTGTGGAGGTGGCTTTGTTCTG
GGCTTGTGGCTGCTCTGCAGGTAGATGTACAGCAGAGGAGTCCTCAGTGGTTCTCTGGAG
AGCCATTCGGTCTGCCTGGGGCTTTGGGTCTGCTCAGATCACGGCTGCAGCATTTTACAC
TGAGCAGTGGTAGCATTCTGGAGTGTACTGTTCAATCGTATGAGCTGCAGTGCAGAACAG
CTCTGTGTGTGCTCGGAGGAGCAGCTCTGTGGCTCAGCTCCTGTCTAGCTGTTTATTCAG
GACCCTTTCTACGTTACCATGCCAAATCTCATCCTGTTTTTCACATTACTGTTGTTACCC
CGACACGTAGCTCTTAATCTGTCATCTCACTCTATAGGTCTGGCTTCATCAACCTGGACA
AGCCTTCCAATCCATCTTCCCATGAGGTGGTGGCGTGGATCCGACGCATCCTTCGAGTAG
AGAAGACGGGGCACAGTGGCACCCTGGACCCTAAGGTGACCGGATGCCTCATTGTGTGCA
TTGAGAGGGCGACACGGCTTGTCAAGTCTCAGCAGAGTGCAGGTAGGTCCATTGCTGTGG
GACCGTGGTCAAAGTGGCTGAGGAGGTGCAGAGGTCTTTTGGAGGCGAGGAGGTTTGCGT
TCCTGTCTTTGAAAGGCCTGCCCTAAGCTTTCAGTGCCTTGAGCTCAAGGATCATTCATC
CATCTTGCTTCCAGCCATTGAGGGCACATCCATGCTGTCTCAGCTGGTTTTTCTGATTGC
TTCTCTGGGATTTGTGCTCTTTTAGGTCAGTGAAAACAGGTCTGAAAGACAGGTTTTGTG
TGCTAGCTGAGCTTAAGGCACAAGTCTGCAAGTCTCAAGAAATAAAACGTGGTGAAGAAG
CAAATATGCAACTTAGATTGTTTTGGGGGGAGAATAACCTACTGCATAATGAGTGGTGTG
TACCTCCTAGGAGAGCTGTTTGTGTGGCAGTGCATGCCTTGAGGTCAACATTAAATGCAA
GTGGCCGCTCCTGACTGCTCTTGTCGTTCTTTCAGGCAAAGAGTATGTGGGAATTGTTCG
GCTGCACAATGCAATTGAAAGTGAGGCTCAGCTTGCCAGGGTAAGTCTCAGCACACCGCT
GGCCACTCTGGCACTCTGTGCAAAGAGTTGGGCTTCTGTGGGAGATGAGGGGGTAGGAGC
AGAGCTCAGGTGTGCCGTGTGTGAGGTGATGATGAAGTTTATCCATTCTCTGAGTGCAGT
GGCACTGCCCTCCTGCAGCGCCCCGATTCCTGTTCTAGGGTCTGGGTGCCGTGCAGCCTC
CAGAGACCCTGCAGTCTCCCAGTGTGCTGCTGGGGGCTGCTGTGGTGTGTGGCTGGCTGC
CTGCAGGAGCCAAGCAGTGCCGGCCGGGTCAGGGCCCCTCTGTGGGGGGCTCTGTCACCA
CTGAGACGAGGGATGACATCTGATTGCATACTGCCACCTGATGAAAATCCCAGCTGTGCC
TCACTGGCAGCTGCAGGAGCGTTTTGACCACATCAGTGGTTCACACCAACTTTCTTAAGT
CTGAGATAGCTACATGGTGATGAGCCTGTCACTCACTAAAAAGATCCTCATTCTTGGAGA
CCCTGAGGCGCTCACGAGTCAGCTGTGCTAATGGCCCAGCCTAAGCTGTTATTTCTTCTG
CTTCTACCTTCAGGCAATAGAAACTCTGACAGGAGCACTCTTCCAGCGACCACCTCTCAT
CGCCGCTGTTAAGCGACAGCTGAGAGTCAGAACCATCTATGAGAGCAAGCTGGTGGAGTA
CGATCCTGAGAGAAGATTAGGTAAAATGCAGCTTTCCTGCCTTTGTCTGGTTACGCTCAC
AGCTCCTGTGCTGCTTCCCATTCTTTGCAGATGTACTGAGATACGGCTCCTTGCACGCAC
TGAGCAGTAAATGCTCCATGCGTTGTTTATGCTGAGAAACAAATCTCACCTACTTTTCTC
TGCAAGTTTTGCACCGTTCACTGAAGAGCCAAATGATGTCAGCTAGATGGCATTAGCACT
CAGTGCAAAGATGACCTTCATCTATCACCCCATGCTGATGGCTCTGTGAGGGGCTGGACG
TGGAGCCTCTGGATGTGGCTCGCTTGTAGCTATACATGTAAATTCTCTCTTGTGTTTCAG
GTATCTTCTGGGTGAGCTGTGAAGCGGGCACGTACATCCGAACGCTTTGTGTTCACCTTG
GTTTGCTGCTTGGTGTTGGGGGCCAAATGCAGGAGCTCCGGAGAGTGCGGTCGGGCATCC
TGGGAGAGATGGTAGGGTGGTGATTCTGACTGTAACCAGCAAACTAGAAGTTGGAGATTG
CAGGAGTTCCCCAAAATGGTCTTTCTTTGGTGTTGGAGAAGGATTTGGGTGCGCAGTGAC
TGGGAAGTGCTGTGAATAGGCCTGGAAGTGTGGCACTTGCCATAGGCAGTCCAGAACCAA
AGTGTTGAGTTCAGTTCAGGGTCTTGTCCCTGTTCTGGTAATTAAGCTTTGGGACAGAAA
GGACTGGGAAGTGCATCCTGGTGACTGAAAGCCTGTTTTATGCCACCTGTGTTTCTCAGC
CTACAGACCACATGTGTGTCTTGAGTTCAGGCACAGGAGCTGTCTGCTCAGCAGTGTGAT
CACTTGTTGTCAGGGTGCAGTGCAGGGAGTGTGCCTTAGCAAAGGGCACTCAGGATGTGC
AGTTTTGTGTGATCTTCAGCACTTTGCACAGTTTTCCATCTGGTTGCTCCTGGATCCCGC
TGCCCATTCAAACTCCAGGACTAATTTATCTGCTTGCAAAGCTGGATTATCAGAGTGAAG
TGCTGCCCTATCTGTGCTCTTACCAGAGGTGCAATCACTGGCAGTCATTTCAGAATCCAA
GGTGATGGATGGCTGCAGCTGCTTCAGTAACTTATCCCATGCTACAGATTCACGAGCTGA
TTAATTCAGGCTTCTACTCACTCACCTACTTTGTCTAGAAGTCACAGCTATTTAAGCTTG
GTCACACTTGGAAAGTGTTTAATGTAGACAGAGCTTGCACACTTGATTCCAGTGCAGTGT
GACATTGGGCAGGTGGAAGCCAGAAGCAGCAGAGATGAGACTGACCTCGAGCTGCCAGCA
GAACATGCTTGTTCTCGCCTTTCCTATGGAGATGTTGTTTATGTTTCTGAATTGGGCACC
AGTTTTCCCTCCCTTCCAGCACACTATTTGCCATTAGGCTCCAGCTGTGTCTTTTGTGCG
TGTTTCAAGCTGGTGGCTGTTTGGGGGGGGGTTGTTCAGAGGGGCTGTGTCTTTGCAGGA
CAACATGGTGACCATGCACGACGTGCTGGATGCACAGTGGCAGTACGACAACAACAAGGA
TGACAGCTACCTGCGGCGTGTCATCCTGCCCCTGGAGAAGCTGCTCACCTCACACAAGCG
GCTCGTCATGAAAGACAGTGCGGTGAGTCCCTGAGGTAGGGCTGCTCGATGCAGAGCTGG
TGTCCTGTCTTGTGCAGCTCGTAAATGAGGGATGATGGTCCTCGTGATGATGGCACTGTC
GTGTCACGTGCTGTGTAGGACCTGGTGTTAATAGTCAGCTAGAAACACGTTAGTGTTATT
GTTAATAACAGTAATGGCAATGGGAAGGTAAAATATTGGAGGTACTTGCATTGATTTTGT
CCTCCAGTCGCTTACGGGCCTTTCTGTTCCCTTCCTCTTCAGGTTAATGCCATTTGCTAT
GGAGCCAAGATCATGCTGCCCGGTGTCCTGAGGTACGAAGATGGTATTGAGCTTAACCAG
GAGATTGTAGTCATCACCACAAAAGGAGAAGCTATCTGCCTAGGTATGAAGCTGCTTATT
CCTGTGCCCACCTATGTGCAGAAATAACAAACTACGTTCTGGTGAAGGTGTAGCAGATGG
GACCCCCTACATGGGAGTTTGAAGTAGTGCTTCCTTAAGAGCTGTTCCTTGGCAAGGTGT
GAAGTGTTCCTCGGTGTTTCAGCTGCACTGAGCTCAGGTGTGCCGTGTGTGAGGTGATGA
TGAAGTTTATCCATTCTCTGAGTGCAGTGGCACTGCCCTCCTGCAGCGCCCCGATTCCTG
TTCTAGGGTCTGGGTGCCGTGCAGCCTCCAGAGACCCTGCAGTCTCCCATTGTGCTGCTG
GGGGCTGCTGTGGTGTGTGGCTGGCTGCCTGCAGGAGCCAAGCAGTGCCGGCCGGGTCAG
GGCCCCTCTGTGGGGGGCTCTGTCCCCACTGAGACGAGGGATGACATCTGATTGCATACT
GCCACCTGATGAAAATCCCAGCTGTGCCTCACTGGCAGCTGCAGAAGCGTTTCCAACTTC
TGATGTGGTCACATCAGTTTGCTGCCTTTGAGCAGGGCATCTTTCTGAAGCTTTAGTCCA
GAGCTTTCCTCCACTGAGGTTTTCAGGGGGATATGGCATTGCTGGTGGTTTGTCTTTTCT
TTGTGCTGCCAGAGGAGGAACAGCCTGAACCCAGCACATTCTTGCATCTGTAGTCTCACA
GTTCTGCTGTTTTAAAGTGTTTGTAAATTCCCTGCTTGCTTCTGCAGCCATTGCCTTGAT
GACCACTGCTGTCATTTCTACCTGCGACCACGGCGTGGTAGCAAAGATCAAGAGAGTAAT
CATGGAGAGAGACACATATCCCCGTAAATGGGGCCTCGGTCCCAAGGTGAGCAGCTGGGG
ACTCAGTGGTGTTGGTGGGAGCCCAGCTGTGGGGCTGCAGGCACCTCAGGTCTGCTTGAA
CCCTCCTCTGGTCAAGAGCCAAATGATGTCAACTGGTTGGCATTAGCACTCCGTGCAAAG
ATGACCTTCATCTATCACCCTATGCTGATGGCTCTGGAGGGGCAAGGAGCTGTGCAGTTG
CAGTGCTTCAGCTGAAATGTGGTAGGTCATTAGGCTGGAGGAGAAATGATGGCCAAGGAT
CTGAGTTCAGTGATACGCAGTCGTCTGCTGCTGTTACTTCTCTCACAAATCAGCCATTAA
TTATGGATAGGGCACCTCCTGCCTGTTCCTTGTCTGAGACACATAGGCTGCTGTGCAGTG
GGCGTTTCCTGTGAGCCATCAGAAGGTTCTCAGAATGGTTAAACCAGAGACAGTGTAGTT
GTTGCCTTGGCTTGGTCCTGGGTTATTTCTCAGGGTGGGTGGCTGAAGCCCAAGGGATGG
TTTCTCCTTCATGGAGCTGTGGTTCTGACCTTCTGCCCTTTGCTCTCAGGCCAGTCAAAA
GAAGATGATGATCCAGAAGGGCCTGCTGGACAAACACGGAAAGCCCAATGAGTGCACACC
AGATTCCTGGAAGAAGGAATACGTGGATTACAGGTGGGTGCAGGGTGTGCAGCTTCAGAG
CGGTGGGCGCAGTGATGGGTTGCATGCAGTGAGCGCTGTTATGGGCACCAGCTTTTGTGC
TTAGCATGTCAGACCTGCCCCAGGGTGAATTTGCTGTCTGGACCCTTGGTGTTTAGCTGT
GCTCCTCAAAGTCACAGGGAACATGCTGGTGGTGTGCCAGGCTGGAGTGAAAGGCCCTGA
GCAGACGGTTATCCCTCTGTAGCCTGTGTCTGTGGCTCTAGAGGGAGTCAGTCTGCTAAA
TGAAAGAGGGGAGGCTTTGCTGTCGTCCTGTCCAGGTGGCACTGGTGCAGGCTGCAGGTC
ATTCCCACACTGAACCCCCCTACCCAATGCCTGGCGTGGGTTAGGTAGCCCTTGTGAGAA
GGGGCTTTGTACTTGTGGAAGGCAGCAGCAGTCCCACTCAGCCCGAGGTCTCTTCTCTTT
TAGGGAGTCGTCCAAGAAAGAGGCAGCTAAAGTTCCCCAGGCTGTGTCAGAGGTGGAAAG
GGCTCCAAAAGTGAGTATTACTGCTCTCTGGTTTAAGGCTGTTTGGGCTCTGAAGGCTGC
TTTGGATCTTGTGCTGACTTCTGTGGTAGAACCTATCTGTGTGAGAGCAGAAAGTGCTGC
CACTGCTCTGTCCTTTTGGCCCCTGTCTTTGTATATGAGTACTGCAGCACAGTAAGAGGG
AATGAGGAGTACTGTAAAAGCTGCAGCATCCAAAGAAATACACTGGATGGAGCTACAGCG
CCGGGTCATTGTGCCAGAGAACCCTTCTGGAGATTACAGGCTGTGAAAGTTCATCTGAGG
AGTCCATGCAAACATTGAATATAGAGTTCCCTGAGTTAGGACTTCTGCACTCATGTAAGG
ATCTCAGTCAAGGGTTGCATGTAGTGCAGCAGAGTTTCAAATAGGAGGACTTGAGGGAAC
ACTAAGAAGTTGGGGTGTAATTCTGGCAGAAATGAATCCCTGTGCTGTATGATAAAAGGG
ACTTCTGGCAGTCTGTAGTTCACACTCTGTTTGAAGTGTTGCTTACTGAGAAGTTTGAGT
CGGGGGAAAAAGCAGTTGTGCTGGGCTTGCAAACAGCTTTTCCATCACTGGAGCTTGTTT
GGAAAATGGTCTGACAGTGTGCTCTCCTAACAGAGGAAGAGAGAGTCAGAGAGTGAAAAT
GAGGCTGTGAGCCCCCCACCATCCCCAGCCACTCCACCACCAGAGGAGCTGAGCAAAAAG
GAGAAGAAAAAGAAGAAGAAAGAAAAGAAAGCCAAAGAAGCAGCTGAAAGTGGGGAAGAA
CAAATAGAAGTGGTACGTAACGGTGCTGCCGTGGGGCAGTTCAAGCATTGGGAAGAGTTA
CTGTCTGTCCTTTGTGCACATGGGATGTGTGTGTGGTGTTTGGACACCTGGGGCTGTGTG
TGAAAGAATGGGAGGTGAAAGAGATTTCCAAGAGTGCTGTGTTAGCCTTGATGTGGATTG
TCTTCCTGACATGAGCAGTGAGTGATGCCTTTTTGATTAAATCCTAAACTCTCAATCCTC
TTTGCAGATCAGTGAAAGCAGCGCCAAGAAGAAGAAGAAGAAGAAGAAACAGAAGGAGGT
AGAAGAGAGCTCAGAGTAAGCAACTGGATCTGTCCAAAGCAGGCGACCTCATCATTAGGG
AGGGAGAAGTCTGAGACCTTGAGAAAAAGAGGACTGCCCGTGCAGCTGAGGGGCCAGCGA
GTTCCAACTTCCTTTTCTGCTGTGCATATGAGTGAGAAGTTTGCCCAGGACGTGCCCTGC
TCCAGCACCCCTCCTCATCCTGTTTTAAGGGTAGCCAGAGGAGAGTGGTGCCTGACTGCC
CCTGCACTGAATTGTTCTGTAAAGCTGGACACCTTGATGCCAATTGAAGTGGTATCTTCA
GGGAGGATGCAGCTCCTTGCTCTTTGGGGTTTGTTTTCACTATGAAAGGGAGGAGTAACA
ATTTCCCTTCTCTCTTCTCCTGCCTCTTCCTTCTCTTGCAAGGTCGAAACTGTTACCCGA
CAGTTACAGAATGTGTTTGTGTCTGGAGGACTGGCCTAGCTGTGGCCCATCTGGAAGGGT
TTGGCACCTCTGAATTGGTTATTTGAGGGGCTCTGGTTGGTTTTAACCTGGCCGTATGCT
TGGCCTGACCCTCAGCTAGTGGAGAGCAAACGTCCATTCTTTGGTACCTCTTTTCAACTT
TATCATAAAAGGATTAGAACGTGAAATTCCTGCTTTCTGCTTTTTAGTGCGGGGACCTGC
TTGTTAGCTGTGAGCTGATCCCAGAGCCAGTGATGCTGCCAGTGCTGGCTCCAACCCAGT
TATTGGAATGGGGTTGCAGCCCTCTCAGGTGCTTCTACTGGTTTTTGGTATCTCATATGC
TTTGGAGGCGTTAGGGGTGCAGCTGCAGGAGGAGCAGAGGCAGTAGGTGGGCATAATACA
GGGCTTGTGAGCACACAGTCTTGGCAGCTATGCACGGGGCACTGAGCGTGAAGCCTGAAT
GATTTCAGGGTGATTTCTCCCTGTTTCTTTGGGATGGCTCAGTGGGATCAGGTTACTCCT
ATTATAGGAACAGTGCTGAGCCAGGATTTTAGCTCCTTTTAGTAGGGAAGGATCCTGGCT
GCTTTGTTCTGAGCTCTCCCTGCAGAGATCCTGTAACATTTGTCTTACCCTCCTGAATTG
CTTTCATCTTAATCATCTGCCTTTTCCCTTCAGTGCTAGAGATGCAGTCAGTGCAGACAG
CAACCGATGGCTGTCAGAACCTGGGTTGAAAAAAAGTTCGTTTTTATTCACTTTTTTTAC
ATAAAAAAAAAAAGAATAAAAGCCCTATTTTTGAATGGGTGACTTTCTTGCTTACCTGAC
TCCTCAAGAAGGGGGAAGTGTTCTCAGACCACTGGGTCTGTTTAGGGGGAGGGCAGGCAG
TAAACATGCACAGGCTGTAGGTGCATGGAGCACTCACCAGAGGTGTTTGGGGGTAAAACC
CAGTGGGACATGTCTGGAAGCTGACTGCTTTTCTGCTGTACTTGTCCTAGAGAGGTCTGG
CAGCACCTGGAGAGCTTTTTGGTCCTGCCTGCCTTACCTTGGGTGCCTCCAGCTCAGGGA
GGTGGGAGCAGACGTCCACCTGTGCTCAGCCTGAGGTAACACACCACTCATGGCAATGTT
TCAGCACACGTTTATTGCTGCTCGTTGTTTCCCTGCAGTGGATCAGAACAAAGGTCCCTA
TTGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1068, 1360..1451, 1957..2141, 2615..2679, 3253..3379, 3720..3850, 4858..5001, 5262..5382, 6107..6225, 6769..6872, 7323..7389, 8013..8171, 8407..9085
1042..1068, 1360..1451, 1957..2141, 2615..2679, 3253..3379, 3720..3850, 4858..5001, 5262..5382, 6107..6225, 6769..6872, 7323..7389, 8013..8171, 8407..8475
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved