Gallus_gallus Locus RS12_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus RS12_CHICK
Gallus_gallus
RS12_CHICK
3
SNORD101
2351..2423
5962
GGCTAAGGACTTTGTGTTATCCTCAGATGACCTTGAGAGTGAGAATGGTTTATTGTTCC
ACCCAACGCAGAAACTTCTCTATAGATTTGGCACCTCTGGGGCTTTTCAAGAACAGGAAG
TTTAAGCAATAGATGGATATAGGAAATAACATTCTCCCTGGAGAGAGAAACAAGGCGGGC
ACTATAGTCCGTGTTTGTGTGCTTTCTGGGGTCTGAGCAATATAAAGTAAATCAGAGAAC
CATTGAGGTTGGAAAAGACCACTAAGATCACCTAGTCCAACCGCCAACCCATCCCCACCA
TGCCCACTAACCACATCCCTCAGTGCCACATCCACATGGTTCCTTGAACACCTCCATGGG
TGCTGACTCCACCCCCCCCCGGGCAGCTGTGCCAATGCCTCACCAGTCCGTCAGAGACAA
AATTTTTCCTAATATCTTATACATTCCAACTAATAAAACCGCTCATTGCCCCTCCAGCAC
TCCCATCACCGAGCATCTCCTCGCTGCCCGCATTTGGCCCACACCACAAAGCATGAAGGT
AGGAGATCAGAGGGCTTTGCACCAAAGGTGGCTGACAACAATGGTGGCATATGTCCTCCA
TTACATCAGCCACAGACTATGGCTACCAGTATTTGTTGCCTATTTTCATTACTGTGTGTT
TTCTGCCACGCTCAGGTTGCCAGGTCTGGCACAGGTGACACGGAGGATCCCATCTCAGTG
ACCACAGGGGAGCAAGCAAGAAGCGCCTGACAGAAATTCAGGCTTCTGAGTCACAGCTTA
GTGCGGTGACCACCGCGTAAAGATAGCAGAGCCTGAAGTAAGGATCGCTTGTTCGCAGGG
TTTATTTTCCCCCATTTTTCCCCCTCAGTGCCGCCAACCCGCGCAGGGCAGCAGCGGCGC
ATCAGGCAGCGCGGCGGACAGCCTCCGCACCAGCGCGCGGCGGGGTCCTCGCACTCTATA
AGAGCGTGAGGCGGAAGGCCCGCCCCCTCTTTCGCTTGTGGCTCGCGGCGGCAGCGGGGT
GAGCGGCCATGGCGGCGGTGGGGCCTGTCGGGCAGGATCTCCCCGGCCGGTGGGCCATCG
TGGCGGGGGGGCGCTGGGCGGGGACTCCGGGGCGGCCGCCGGCACTCACCGGGGCGGTCT
GTATCTGTATTTGCAGCAGGAAGCCGGGCGGGAGCGGCACCCACCGAGAGGGCCATGGCC
GAGGAAGGGTGAGCGGGGCGGGGGCTGGCGGGGAGGGTGGCGGGGCAGGGAAGGAGGTGG
CGGGCCGCGCCTCGGCTCAGCGCTGCGCCCGGGCTCCACGCGTCGGAGTCGGTCCATCGG
GCCTGGCGGGCCCTACCGCGCTGCCACCACCTGCTGCATGCGGCTGGGTGCTCGCTCGGT
GTGAGGTGCGCTGGTGGCACGGCTGGGTGCGCGGCCAACCCCTTTGTGAGGGAGTATGAC
GAGACCACAACTGGCTGGTTCACCGATAAAGCTTAAAATGTCTTCAGGTTCCTCTTAACT
GCTACTTTTTTCAGTTGCTATTGTGGTTTTGCTCTTCCATTTGCTTTTTTTCATGTAACT
TCTAGCAGTTGAATGCTTGCAGGTGAATGGGAAGTTTCTGCTTACGATTGTGAAGATGTT
GGCATGGACAAAGCAATGATGTCTGCTTTCTGTTTAGCATTACTGCTGGAGGTGTAATGG
ATGTTAACACCGCCCTCCAAGAAGTGCTGAAGACCGCACTTATCCATGATGGCCTCGCTC
GTGGTATTCGTGAAGCAGCCAAAGCCTTGGACAAGTAAGTGGTGTGTTTCTTTTCACTGT
GAATAGTGAAATGGAGTGATGTGTATTGTGAAGAAGTATGTTAAGCACATTAAGGTGGAA
TGGCATTGGTTGCATGCTGCTTTAGAAACCTGAAGCTCACAAACCTTCATAGAATCATAG
AATGGCCTGGGTTGAAAAGGACCATAACGATGATGTAGTTTCAGCCCCCCTGCTATGTGC
AGGGTTGTCAACCACTGGACCAGGCTGCCCAGAGCCACATCCAGCCTCTGTTTATTTTAA
CCTTGCATTTTAAGAAAAGATGGAACTCCCTAAACTTGTTAAGAATTAGAATTGAGAAGG
CCAATATGTATGTCAGTTTTGAACTGGAAAACCTGATTTAATTTTGTTATAAAAACAGCT
TGCCTTTTTTGGTTAGCTTCACTTTTTTTGATGTGGCTGTAAATAATTGACTTGGTACTA
TATCAAAATAGTATTAAGTTTGTCATACATGTGCTAGATGTAATATGCAGCTACTATTTC
TGATACATATGTGAACAGATACAAGCTTCTAATATCAGCCTTTAAATAACATTTAAGTGT
AAAGCTACAGTGTTTGAGTGATGACTTCACAAATTGTCGGATACCCCTTCACTCCTTTTG
AGTGAGAACTGTGGTCTGACAAACCTGTATGCAAAAAGCTGTAAGACAAGGTACCAAATA
AGAGAAGGAAGGAGAAATGTAACTGATTGAAAACTAGATGGCAAGAATTCTTTTGAGTTA
AGAGACAAATCTATGTACTGTGCATTAAAAGAATAATATCTGTACAAGGCTTGGGTGCAT
TTGTGTCAAATGGTTCTTGCTTGGAAACTTCTTAAACGTTCTGGTGGTGCTCATGGTGGA
GAAGGCTGTAGAGAACATAGAATTTGTTTGCAGTGGTCACATTACATAAAGTTAAGCATA
GAAGACCTATATGGCTCTCTTTGTTGTCAGGTATCCCTTTGATATTCTTAACATTGTACT
GCAGTATACAAAGATGGTAATTAGAATTGGGGCCCTGTCATAACAGCTTCTTTGGACGTA
AGTAGAAAAGATTGTTCTGAAGAGCTTTTAAAAACGTGGCATAGAAATTCAAACTTTTGT
AATTACAATCCTAATGTTGGATGACTGTAATCTGAGGTAGAGGGCAAAAAGCAACTTGCA
ATTTTGTTGCTTTCTACTGAAGACACTAGTTGTTTATGGGACTTAGTGTTTATTCCTCAC
ACCTTTTTCTAGTGTCTGAGAATTAATATAGTGGTGTTTCTAGAAGCTTCTGAAATAGTA
TAGAATCACATAATGAAACTAACAATGCATAAGAACTGTGTTGTGTTTGAGAAGCAGGAA
GTAGTAGGTTATATGATAGGTGTATTTTATAATTAAAATGAAGTGGCTGTCTACACATGC
ATGTGCTGAATCTTGTTTGTCTTGGTTTTGATTATTAAGGAGGCTTGGTCAGCATTTGAA
GTTACATTTGCCTTTTCTTCTTTTAAGGCGCCAAGCCCATCTCTGTGTCCTGGCTTCAAA
TTGTGATGAGCCCATGTATGTAAAGCTAGTTGAAGCACTTTGTGCAGAGCACCAGATCAA
CCTGATAAAGGTGAGTGTCAGAACTTGGGACACAAGTCTGGAAGTTACTGTACTTGTGAG
CTGATCTACTTGGTTCAGAATATAAATAGATGAACCTTTGAGATCACTGTACTGTAATTC
TGGTTTATGAAAGCAAAATTTCTGACAGCAGCAATGACTTTTCAGTTTAATGGCATTCTT
AGGTGAACAGTGTAAAAGCCATGGATGTAATAATGGTTAAAGATGTGTTTGAAGTATAAA
GTCGAAGTGTATTTTTATGCTGTATATGAAGAAACAGAGCTCATTAAAAGAAGCCATTAA
ATAGTGGCTATAGAGTGTGTGTAGGGTCTTAATGTGAGTTTTCTTCAAATTAAAAGCATA
AGAGCTGTACAATGATGAGACTTTGGCTCCCTCTACTGATACTTGTGAGGAAAGCAGCCA
TATGTTACCCAATACCTCTGAGAGTACAGCAGTTTTTATTCAATATAGTTATGTTAGAAA
TAAACAGTTCTAATGTGATGTAATGTTTTATGCAGGTTGATGACAACAAAAAGCTGGGTG
AATGGGTAGGACTCTGCAAGATCGACAGAGAAGGGAAACCTCGCAAAGTTGTGGGCTGCA
GTTGTGTGGTTGTCAAAGTAAGATGATACTCCTTTAATTCTGGAAATGAGCAGTACGTGA
TTGTTTATGTTCTCTTGCCAGTAAGCATTAAAGACAAGCTTTTAACTAGAAAATAAACTT
AAGAGAAAAAACACCAGTTAATAATCTCTGCTCAACTTGAAAGTGTTTTGCAGGGCATGT
TTTAAAACACTACTGGTAAACTAAAGCCACAGTACGAGCCTTGAAGAAAATTTCTTGTCT
TTGAGGTCCCAAGAGATGGCTACATCTTCACCATAAGCAGTAATGAATTCTGCATGTATT
GCAGTAATTGTTACTGTTCTACATATTGATATATTTGGTTTCCTTTAGCAGAAATTGTCT
GCTTGGATCTTCACCAGTGGGTTATATGCTTAAATGAAATAGAATCGCCCTATATTAAAA
GCCATTTATTAGCAAACCAAGGGAAAGCAACTGGTAGATGTGGTTTCTCTTGAGGTTACA
TGTCAGAATACTAGCTGTTCTTTTAAAAGTAGGATGTAAACTTCAGAATGGGTCTTCGTG
TGTATAATGGGTCGTTTTGTGTTACAGGATTATGGCAAGGAATCTCAGGCCAAAGATGTC
ATCGAAGAGTACTTCAAGTGCAAGAAATGAAAAATAAATTTTGAGCCTGATGAGTGTGTG
TGCGTGTGATTAATGGGTGGGTGCTGGTGGGGTTATTCTTGTTATTGCAAAGGATAACAG
CAGATCTAAGGACTTTAAAGGTCTTGGAGTAGTTTCTCAATATTTGAATTCTGTTTCTTA
AAAAGGTAATGGGAATCCTTGCAGTTCTTATTCCTTGATGCTCCTTTTCCTGTTTGTACC
ACGGTTTGCAACTTGGGGAACTTCACACAGCTTCTGAATTGCAGAAATGCTGATAGTTGA
TTATGGTCTTTGCTAGCACCTAGTTTGGCACCGTGTAGGCCTGTACTTGTACAGCATTTC
CAGAGTAACTTGTCTGGGAAAGTCTGAAGTAACTGCTGCATCTGTGATGAAAATTTGGCT
CCCTCTACTGAAACAAATGAGGAGAACTGCCTTAATCGTTACCCAAATCTTCTGAGATGT
TGCAGAAATTCTTCAAATAAATCTTAATTTGTTCAGGAGACTAACTTGACACTAGTTGTG
TTTTCCTTTACTGTGCTCTGAAACAAACTGCATGGAATTACTTACCTATTTAAAAGAAAT
ACTGTCATCAATGATTGTGCATGTGTATTCTGCTGTCAGGGTAGCCAAACAGTTGAGATT
TCATTGCTCAGACAAGGCAGTGTTTAACAGTGACTTGTCCATTGTCTTTGTTTTATTAAT
AGTGGTCAGGTACAAACTTTTCTTGTTAAGCAAAACCTTTCTGGAAATCTGAGCAGGTTT
AATATCTCCTTTCCTGCATGTGTTGCATCTTCTGCAAAGTGGAACATCCCTAAGAGGACT
CCTAGGGATTTGCTTTATTATGCTGATAAATAGGACATGAATTGACTGGGATAGGGCATG
TGTACATTGGGAAAACTGGAATGTGTATCTGTTAATTGTGAACAAATTACAACTGGTATT
AAATTCATATTACTAATTATATTACCAATTACCATTGAAATCTACAGAAATTCTCTTGTA
GATAAGATCCTCAGTTGTAGATCTCATTGGATTACTGGAGGTTTCTTACAAATTGTTTAG
AATATTCCTTTCAAAATGGAATTGAAAGACTACTGCAATTTATGTTGATTTGGCTAATAA
GCTCAATTATCTCTTATAAATTGACACATTTTAAAGCATGGTTTATCCTGTGTGTAGGAG
CTGTATCTTTCAAGGGATTTTGTTCCTGTTTGAAAATGCATGAAATATCCATGCTTATTT
GGCTGTAATATTTCTAAAACGTTCCCAGGTACATGCTGGGGAAGTTGTCTGGAATGATGG
TGGTAGTGGCGATCCTAATTGCATTAAGGTTTGCTTTTCCTTGGCCCTCTTTTTTCATTA
TAGTTAAATTCACAGGGAACTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1156..1207, 1657..1773, 3267..3369, 3875..3976, 4527..4962
1194..1207, 1657..1773, 3267..3369, 3875..3976, 4527..4586
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved