Gallus_gallus Locus NP_001006405.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001006405.1
Gallus_gallus
NP_001006405.1
3
SNORA29
1687..1824
10260
AACGGCAGCGGATACCCCTCCGCCAGGCGAAGGCTCAAGGCCCCGCTTGCCAGCCGCCG
CCCCATCCCACAGCAGCCGTTATCGGCAGCAGCACCGAGACACCCGACCTGGCAGCACAG
GGGGAGCGACGCCTCCTACCGGAGAAGACTGGTTTGGAGAGTGGCAGAGCAGCCGACCTT
ACCCGCTCCACACGCCTGGAGCCGGCCAGCCGCCAGCAACATGCAGCCGCGACCGCCCAG
CGCCATGAATAGCCAGCGCCCGCCACGACCTCAGGCGACAGTCACCTCCCGGGCGCTCAG
AGAACCCTGGGCGCCGCCATCTTGGGTGAGCCCGGCACTTCCCTCCGGAAGCCGGAGAGC
ACTTCCGCCCAGAGGGTTCTGTCACGTGATGGCAGTGGGCGGGCTGCTGCGCGCGCACAC
AGCACGGATTTTCCGGGTGGAAAGCGTGTAGTCTGCACGCTAACGGAGACAGGCCCAGGA
GGTGTGGTGGCTTTGAGTAGTGGCCTCTCGTGGCCTTTCTCTATGGCTAGAAAAGAAAGC
AGGACTTGAGACAATACAAATCTTGGTTTTGCGACCAGGAGAATAATGAATTCCATTAAA
AAGCGAAGTAACGCGTAATGCCATAGGCAAAAGTGCAGAAATGCCACGCCACAAGACTGG
CGTTAGATTTGGGCCCCTTTTCCAGCCACAGTCCAGGGAAGAGCACCGCGGTGCGCCCAC
AGAGCCGTTCCCAGCTCTAGCAAGCTCCGCCCGAGCCACTGATCCCCCGCCAACGACACC
GCTACATCAGCCAGCGCGCATGCGCAAAGCAGCCGCACGCCGCCCCAGTTTCTAGAACCT
CCTAGAAGCGCTGCCGCCTCTCCTTCCGTCCGGTGGCTTTGTTCAAAGGCAAGGACCAAT
CACGGCGTGAGACTGGGCCGCACCGCGCCCTCGGATTGGGCGGGCGGCCGTGGCCCCGCC
CCTTCAGCGCACGGCCTGCCCGCGCCTGCCTCAGGAGCAGTTCCCGGCATTCCATAGCGG
CCTGTTGGCCATTCTGTGGCTCGGCCCTCTATCTGCCTCTCGCGCCGCGGCCTGGCGGGA
AGATGGCGGCGATGGAGGGGCCCCTGGCTGTGTTCGGCGAACGGACCAGCGGCGACACCA
TCCGCACGCAGAACGGTAACGGCCGCGTGCTGCCGGCGGAGCCCGCTATGCGGGGAGGGA
GCGCGGAGGATGTAACATGGCGCAGCCATGTGCTTCCCCGCCCCGGGCCTGCCGCCGGCT
CGGCGCGGTCAGGGCGCTGCCGCCGTGAGGGCGGGCGGCTGCCGGCTGCCGGCCAGGGTG
GGTGGGCGCCGCCCTCAGCTCGTAGGGCCTGCAGGGTGCCAGGTGGGGAGGTGACTTCTG
GGGAAAGGGTCTCCGTCCGAACTGTTTCTCACGAACATCACGCGGTTCTCTGCGTTTTAC
CGTACGTCCTTCGGGGAAGGCTGCACATCCCGGGGTTGTCTGTGTTTCTGAGGTGAACGA
GAAAAGAAGCAGCTGAGGAGTTGCATTCTGGTGATTATGAGGATTGTACAGTTCTGATGC
ACGCTTAAGATCGAGATTGCCTTAGTCTGGCTGAGATGCTCGATAATGGCAGCTTCTTTC
AAAGAGCTGCTCTAAAGAGCAGCGCTTACACCGTTTGGAACTCGAAGTGAGGGCCTGCGT
TGCAGCTATTCCCATTATACTACCACTTTTTCAATCTCCAGAGGAAGTGGCTATGCTTGT
GGGATAGAGGAAAATGTTGCCACGGTCTGAAGGAAAAGGTTGATTGTATCTTTTTCCTAC
ATGAAGTTGGCAGGACATCATCTGAACGAGCTGCTACGTTAGATTCTCCATTATCATTTA
AGTGCCTGAAGGCCCCTCACTTTTGACTTTCATGATTTTAAGTATTTTGTCTTTGAGTTA
TAGAGCTAATTGCGGCAAAAAGATATGTTACTAGTTGTCTTACTATGTGTCTTATGTGAC
ATGGTTGTACCATGGTCTCTATCTACCTTGGTACATGCTGCTTATGTTTCATGCTGCTTA
ATACCTGCAAACCAAACCAGACAGAAACGTGATTGTGAGTTAGTTTACGTTATCTGAAGT
TTCTGAAGCACAGGTTTGTCATGCTTTTTGTTTTTTTAAATCTTTCTGTTCTCATTTATG
CAGTTACTGCTGCATCCGCTATTGCCAACATTGTGAAAAGTTCCCTGGGGCCAGTTGGGC
TGGATAAGATGTTGGTGGATGAAATTGGGGTAAGTAAGCTTTATTTAAGTGGAAAATGCT
AGGAAGCTTTCAATTCTTGTAGAAGTGCTTCTCACGTTCGTGTACCTGTTTGGTTCTTGT
GTTGTGTGGAGAGGGAGTGGGAGGAGGAGCATTTCAGTAAAATAGTATATTCAGGTGGTT
TGTGCTGTATCACTTGCATCAATAGCTTTTGTATTACAATTGGCCTTTTTCTCTACGTAG
AAATCACTACTTGAAAAAATTACTTGAATGAGTGTTAAATGCTGAAGTCAGACCTGGTGA
TGGTGTTGAGTTGTATACCCTGATCTCTCCCCTGGGAGATATAACATAAAAGTGATTTCA
AATAACTCAATTTTAAGACCCATGTTTTGCATTTTAAATTATTTAAAGTTTTCCTGGTCA
AATACCATAGTAAAATACTGTATTGGAGATGATTCGGTGCTGTGCTGTTAGCATAAATGC
AAAACATTTTGTGTCTAACAAAATGATCTTTGATGAAAATGAGGTGCCAATTCTGCCCTA
GTAACCATGGGTCACTTGGTTACAAAGAAGCAATGAACATTTGGTATAAATAACCATTTC
ACGAAAATTATAAAGAAAAAATAATGTTCTGTTTCATGAGTGTTGTGAAATGGGACAGGA
AAAAACAATAGACATATATTTTGTACTGATACTGGATTTCTGAAAACTAGGATGTGACCA
TTACGAATGATGGCGCAACCATTCTGAAGCTGCTGGAAGTTGAACATCCTGCTGCAAAAG
TCCTTTGTGAGCTGGCAGACCTACAAGACAAAGAAGTTGGTGATGGGACAACCTCAGTGG
TATGCAACAAGTTTTATAGGCAGACTCAAGGAATGTTGACGTTTCATGATCTCAGGGTTT
TTTTCAATTGGGCTATAGAAGAAAGAAGTCAGAGTTGTGTCTTTGTTTTATAGATGCTTG
TTTCCATGCACAGTTGGTATGCTGGAATGGAATTCGCTCACTGCTGTTAGATGACTGTTT
TTTCCTTTGTTGAAGTCAAGGATAGTTGCTGAATAGACATTCTTACTTTCTAACCACTGA
AAAGGTAAAATGCTTAAGGCTAATGGGGAAGGATGGTGAGTAAAGGGACAAGTTGCAAGG
AATTGAAAACTTCTATGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATACTTGGGTGTTTGTATTTCAAACAGGTAATCATAGCTGCGG
AACTTCTAGAAAATGCTGACGAGCTAGTCAAACAGAAAATCCATCCTACCTCCATTATTG
GTGGATACCGACTTGCTTGCAAGTAAGAAACTGATACAATTGAAGTATATTGCATTTTTC
AGGTACAATAACTTCATGCTTTTCGTTTATTTCTGGTTTTATAACTGCATTAATGAAGAT
TTCTTAGTGCAAAATGGATACGCTGGTTTCATTGTAGTTTTAGTTCTGTGTTTATATACT
GTCATGTAAAAACATCATTTTACTGTCTGAGAAGAATAATTGATTTAATTTCTGTGTGTC
TTTCAGCAGGGCTGAGGGCATCAGATTTTTGTCTTTCATAAGGGTGGCATTCTTTATTGG
TATTTTGTCTTTATTCTACAGGGAAGCAGTTCGCTACATCAATGAAAACCTTATTATTAA
CACAGATGAGTTAGGCAGGGAATGCCTAATTAATGCTGCTAAAACATCCATGTCCTCAAA
AATTATAGGAATGTATCCTTTAACTTGTTTCAGTTATTTGTGTGTTTGGAGAGCTTGATT
AGTTTGGCTAGCTTCCTTTACAGCAACAGAAAAATGATAGATTAAGTATTCTCTCATTCG
TAAAAAAAGGTGCAAAAAACATTTCAATGGTGTTGTTATCTGCCATGGGAAAGCATGTTC
AGACCTTTCCAAAGTATTTGAACCTGGATAAGGACACCATAATAGGTATAACTATTTTTT
TTTTCCTTACAGTGCACATTAGTGGTCTATGCAAAAGAACTGCATGAACAGAAAAATTCA
GAAGTCGGGTCTCTAGGGGAGTGAAACTGCAGGAAAGAAGGTTATGTTTCACTCGATAGT
CACAGGAAAACCTGTGTTCTTGACCTTTGTGCCAATAGGAGGATGCATACTGTGATCATG
GGATAGATGCTTCTGTTTAAGAACAAAAAAAAAGGGGGGGGGGGGGTCAAAACAAGCTTT
ACTCTAGCCTGTCCTAATTCTCTTACTGTTTCAACTTTGAGTTACTCATTCTTCTAAAAT
ATTTTATACAAGAAAGTTAGCTTCTTATTTTTTTTTTTTTTCCTCTCTCCATTCTTTAAA
CATAATGGTAGTTTTCATCTTCAGTTTTAACCTTAACAGCATGTTAGTGATGGTGATTTC
TTTGCAAATATGGTGGTGGATGCTGCAATGGCAGTTAAATACACAGACCAGAAGGGGCAG
GCCCGGTATCCGATCAACTCGGTCAATGTTTTGAAGGCACATGGCCGCAGCCAAAAAGAG
AGCATTCTTGTGAATGGGTACGCTCTGAACTGCGTAGTGGGCTCACAGGGTAAGAACACA
CTGTGTTTCGTAGAGCTTTTGTGTGAATTTGGTACTGTCACTCCTTGTGCATGGATCTTC
CTGCTCACTGCATTAGTTGTGGAACTTCTGGTTTTTCAATTCCAGAATGATTAAATAAGA
AAAAAAGCAAACAATCGTACCACTTCATAACAGTTTCTAGACTGGGGTTTGAGTGCTAGT
AGGATACTTAAAATGTTTGTAACTTTATTTTGCTGGGTACTGACTTGGTACTGTCTTGGA
GAATGCACGTACCTCCCTTTTTGAGAGTCATTGTCAGCTTTTACAGAGATGTTAAGTTTA
ATAGAGTACTTGTGATTAAGTAACTTAAAAGTATGTGAGACTGCTGGGTTAGTTCTTGTG
GACAGTCATGTTTTCAGAATAGGGATCCATTGAAAGGAAACTGAGGTTACACTACAGACT
TTAAAATGTATTTCTGTCATTGAAGCCTCTGTTAGTATTTTTTTTTTATACTCTGGCAGA
ACTGGAGATTGAAAAAACAAATTGAATGGATGGATACCTGAAATGTAAAAGCAGCGTTAT
TTTCTAATGTAAACTTGAGGGTCTGTTAACTCAGTTTGACAGAAGCCTTCTTCCTTCTTC
CCTTCTCTATCCTCAGGTATGACAAAGAGAATAGTTAATGCAAAGATTGCATGCCTTGAC
TTCAGCCTGCAGAAAGCCAAAATGAAGCTTGGTGTTCAGGTTGTTATCACGGACCCTGAG
AAGCTGGACCAGATAAGGCAAAGGTGCGTGGAAGGTTGACTGATAGCCGGTGGGGTTGCA
GTGGATTATTTGGCCTCTTCAGTTTTGATGGCTTGATGTAATTTTGACTGAATAGAAGAG
ACAGAAGTGTTTAAAAAGTTGATGTCTCCTAACAAATAACAAATATTAATTGGGAAAAAA
AGTCTTTATTTCTGAAGGTGAAACTTAGTGCTAAGTCCAGTTAAAGAAATCCACATACGC
TTGTGTAGTGGTTCCTTCTTGCAGAGCTCTGCATGAAGATTTCAAGACATTGGTTAAGGG
AACTTAATTGCAAGCTTCTACAACTGTGTTGGTAATTTGTTACGTTGTCCCTGCAGAGAA
TCAGATATTACAAAAGAAAGGATCCAGAAGATTCTGGCCACTGGTGCCAATGTTATTCTA
ACCACGGGAGGTATTGATGACATGTGTCTGAAATACTTTGTTGATGCGGGTGCCATGGCA
GTACGAAGAGTTGTGAAGAAGGATCTTAAGCGGATTGCTAAGGCATCGGGAGGTATGTGT
GGATGAAAATGCTTTTTCAAATAAGAACTGCTGTCACTGATCTTGGGAGTATGGCTTCTT
AGCACGTAGGCTGTGCAAGGAGAGGATGAAGAAAGCTGAACCACTCTTGTGATGTTCTAA
TTTACTGTTCCTTTTAAGTGGGCGTTCCGTCAGAGTAGTTGGTAAAAGGGTTTGCCTGAA
GAAGGTTTACAGTGTGGAAAAATAAATAATGCTTTATGCTGGGGAAAAGTACTCTGTATA
GATAATTCAAGACAAAGGAAGAATTGTTGCAGCATATAATGCATAATTAAACAACGACAA
CAACCAATCTGGCCCTGTGCGTATTTTCTGTCAGTTCTTAAACGTTTAAGAAAGTATTTT
CATTATGGTAAAGCATGGGAACTTCTGGTTTTAAGAAAAATAAGTGCTGTGAATACAGAG
CAGAACCAGCAACTTGGATGACAAACTGCAGAAAACCTCATTGCTCTGTGAGAATTAATT
AACCTTTGCTACCTGGAGTGTTGTTAATTGAATTAATATACTTTAATTTTGCTCATTCTG
CTTGTATTTACGTTTCTGATGCTCTTTCTGTGTGCTGCTTCTGGGAAGTTTGCAAAGGAT
GTATTGGAACTGAATGCTAATTTCACATCTTGTTTGTTTGTTAAAGCAACCATATGCTCA
ACCCTTGCAAACCTGGAAGGTGAGGAAAGCTTTGAGGCATTAATGCTGGGACAGGCAGAA
GAGGTGATTCAAGAGAGAATCTGTGATGATGAACTGATCTTAATCAAGAAGTAAGGACCC
TCTTTGGAGTACTCGTTTTTGTGCATGGTTTTCTCTTGGATTTGAGATAAAATCCCATTT
ATTTGCTTCCATGCCATCTCAGTGGCATGAGTAGTTATACGCATGGGAAAGAGTATACAA
GTCCACTGCATATGAGAGGTGAAAGTAACAGTATTTCATCTTGTCTGCTGGGGATGGACA
ACTGTTATATCAAACATGATGAATCAGTCAGATTGCTGATAAGGCTGTACTTAACATTTG
GTTTGTCATAGGTTCTTTAACAAGAACACGTTTGCGTGTTGACTTCTGATCTCAATATTC
AACTTACTGTAGTCTCTTTTTGTAGCTGTTTCTGAGGGAATCAAATATTCTGAATGGCAC
TTAAGCATTGTATGACTGCATGTGCTGTACTGCTGGCAGTCATGATCTCACTTCTGCATA
GCCATTAAGAGAGCTCTGCTTTGTCCTGTGCTCTCACTCCTATTCCACAACTGTCCTGAC
ATCAAAAATACTGCATTGATTGAAGTGTCTGTTCTTTGTGTATCTTTCTAAGAGGCTGCA
TCTCAATATAGGTTCTTACCTATTAGAACTTAAACTGAAATACTGCCTTACTATGTCACA
ATACACATACCCTGCAGGGAAGTATAACAGTAGTTAGAAAGAACTTCTAAATGCTGAAAA
AAATCTGGCTCCATTGAGCTTGTTTTCATAAGAAAAATGTTCAGCATGAAGAGTTGCAAT
TTGTATTTCTTTTTCAATAAGGCTGTCTTCTGCTTCCTTTATTCCACAGCACAAAGGCTC
GTACTTCAGCATCGATCATTTTACGAGGAGCTAATGACTTCATGTGTGATGAAATGGAAC
GATCTATACATGATGCTCTCTGTGTTGTGAAGAGAGTATTGGAATCCAAGTCTGTTGTTC
CAGGTGGTGGTGCTGTAGAGGCAGCACTTTCAATATATCTTGAAAATTATGCAACAAGTA
TGGTAAGTCTTACACAGACAAGTAACAACACATGTGTGCTTTGTTAGGACAGTATGAATT
TTCTTTATTCTACCAGAACTCAGTTCTGAGTTCCTTTCTCTGATAATTAGACTAAGTGTG
AAAGATGTTCTGTGTGGTTTGACCTATTGTCTTAATGCTGGCTGTGCTTTTTTTTAGTTC
CATCAACAACAGCTAGTTTTAAAACTTTGTTCTCCTTTTAGGGATCGCGTGAACAACTGG
CAATAGCAGAATTTGCAAGATCCCTCTTAATAATTCCAAATACATTGGCAGTAAATGCTG
CTCAAGATGCTACAGATCTTGTTGCGAAGTTAAGAGCATTCCATAACGAGGCTCAAGTTA
ATCCTGACCGCAAAAATCTGAAATGGCAAGTATCAGGAGGGGAGTCATGCCCAGTGGGGG
GGTGAGTGGGATGGAAAGTTGTTCCGTCAGTCTAGGGAGCCAAAATTGGCCTGCAACAAG
GTGTAGGTTATCACAGAATTCTTCTCCCTCTCATCTTCAGTTCTATGTCTGTGTCACCAC
AGCCTAGTATTAATGAAGTGATACGCTCCAGCTTTATTTCTACTTTTCCTACCTTTCCAT
CTGCTGATAGAGTTCTTCTTTCCAGGATCGGTCTCGACTTGGTCAACGGGAAGCCTCGTG
ATAATAAGCAAGCTGGTGTCTTTGAACCAACCATGGTCAAAACTAAGAGCCTGAAGTTTG
CAACAGAAGCTGCAATTACTATTCTTCGAATCGATGATCTTATCAAACTGCACCCTGAAC
CTAAAGAGGATAGAGGGTGCTACGAAGATGCGGTTCACTCTGGAGCACTTGAAGAATAAT
TAGGCTTTATTTATGTTTATCTGACTTACACTTCCCACTCTTGTAACTGAAATGTTAATA
AAACAAGTGGTTGAATGCTGCTATTTTTTTGTGGAAAAATTTATTTTCAGAAGCGAAAAT
CACCATGTAGTAACCATTCATCTTAGTTGACAAGGCAGTGATTAATGAGCACAGACAGCA
TGGTGGTAAGCCTCTGTCATCGTAGGGAAAACAAAAACATGTAAGTTGCATGATTAGAAG
GTTGCTAGTAAACGCTAAGGCAGTTATTCATCTCTCAATGCACATGGCTATTCCCATTCC
TCCTCCTATGCAGAGAGCAGCAACACCACGTTTTCCACCTGTTCGTTCCAGTGCATGTAG
CAGAGTCACAAGGATGCGGCAACCAGAGGCGCCCAGAGGGTGGCCAAGAGCAATAGCTCC
GCCTTGGGTGTTGATCTGAGGAGGAGGAAAAAACATAAGGTCAGGTTCAGAAGTCATTTA
GCTTGCTCAAGTTTTGACTGACATCACTGAGTATAGTCTCTAAAAGTGATTAAGGTGATG
TGCTACACATACTTAAAGGAAAACTAGATCCTGGGTGTAAAAGCTGTTACAAATCAGCGT
TTCTTCCCTAAGGAGCCCATCTAGTCATCTACTCTATGCCAATATTAATGGTAGCTGGGG
TGAATTTAGGAAGGAGAGAGTAATAACTGAAATTCTTAGCATTCCTGGAATAAAAGTGAT
ATGATGTTTCAGGCTTATCTACATCGAGTTGTATACACATCTATCAGAAGAAAGCTGGAA
CCTGGTCTAGTAGGAAACAATTTGCCTGCTAGCAAAGCGGGCCTTCAGCGGAGTAGCTGA
AGGAAATGCCTGATGTGTTGCCTATACCAATAGGACTGCTCCACTTCAACTCTGAATACA
ATCCAAATAGAATCAAGAAAACAAGACCTCATCCATTTATTACCTTTTCTGGATTTACTT
TCAGTTCTCTTGCTATTGCAATTGATAGTGATGCAAAGGCTTCATTAATTTCAAACAAGT
CAACTTGGTCCAGAGTCCAGCCGGCTTTCTCAATCTGAGAGAACAAAACAAACTTTATTA
G
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1154, 2163..2248, 2930..3058, 4004..4101, 4401..4511, 5147..5328, 5956..6082, 6416..6591, 7246..7369, 8149..8341, 8561..8742, 8965..9260
1082..1154, 2163..2248, 2930..3058, 4004..4101, 4401..4511, 5147..5328, 5956..6082, 6416..6591, 7246..7369, 8149..8341, 8561..8742, 8965..9175
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved