Gallus_gallus Locus NP_001006396.1
snOPY snoRNA Orthological Gene Database
Gallus_gallus NP_001006396.1
Gallus_gallus
NP_001006396.1
3
SNORD53
14786..14864
23750
CTCCCCGGCGCGGAGAGGGATGGGGCGCGCCGCCATTTTCTTCTCCGGGGATCCCTGCG
AGGAAGGCGCCGCGGTGGGCGCCGCGCTCGGCGCCGCCACCGCCATTTTCTCCTCAGCAG
GCGCCTGCGGGGAGGCTGAGGAGCGGGGCTCCGCGTAACGCTCCACCGCCGCCGCCTCCT
CCGGCGGCAGCAGCCGCTTCACTCTCTCCAGGGGCGACAGCGAAGCCTCCCACGCCCTCC
TCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACTCGGTGGGCAGCCGC
CTGCAGCACGAGTACGTGCCCTCCGCGCACCTCAGCGCCGCCTGCACTTGCCTGGCCTGG
GCCCCGCCGGGGGGACGCCCGCCCCCCGACAAGGTACGGGCGGTGGGGGGGGGGAGAGGG
GATCCGCGGGGGGAGCGCTCGTACCCCGCGCGGCCTGGAGGTGCGGCCGCGCCGCTTCAC
CCCGCCCTCCCGGCGCCATGCGGCGGGGCCCGGCAGCGCCAACGGGACCGGCCCGGCCCC
ACGCCACGTGTGGGGCTGCGGCGCGGGGCTGCTCGTCAGGAGGGAAAGCCCACCTGATGG
CGGGGAGCGCGGCGCTGCGCGTCTTTCTCTCTCTTTTTCTCTTCTGAATTAACTAAAAGC
GCTCTCAGCCAAAGCACTGACGGTGAAACCCGTTCGCCTTTCGTGTTCCCTGCGTGGAAG
GAGCGCGCCCCGAAGCAGCGAGGTATGTGGCACGCTGCGTGGCTCCTCTCCCCGCCTCAG
GACCCTGCGCCTCGTGCTCCGCGCTCGGCAGCTCCTCCGCACACCTCGGGGACCTCCGCC
TTCCAGCTAAGCTCACTGGGACGCTGCAACTGAAAGCATCTGTAGTACATGCGTTAAGTC
GCTTTTTCGGCTTCTTTATTTTTGAGGTAGTCCTTCCTTTGCTCGCTGTAACATCCAACT
TCCTGAGCAAGATGTGTCCCTTGGATGGTTTTGTGCCCCTGAGTAGCAATTCGTTAAATG
TGTTTTGGTAAAAGCTTGTTAGAAATACTGCAGCAGGTATCTTGAAATGCTCCGTGCACT
CAGATTGCCCATCCAAAGGAAGGCTGTGTTGCCCCCTTTTTGTCATATGAGCGCCTTAAT
CCCTGAGCTTTATACAGTGCACTGGAAGAAGGAGTTAGTTTCAGATTGGCTTCTTCCTTG
CTCGTTTTTATTTCAGCTTGGAAGAAAAAAAAGATGCATGCATTAATGGGAAGGCTGAGC
AGGTTAACAGAAACTGAAACTGGTGCTCACCTCTGCTGTGTGCAGTGCAGCTTCAAAGCC
TGATGTACCACGCTGCCTTAGGTCAAGCGCAGAAGGTTTTGAATGGCTTTTAAACGTTAA
GGTCTTTTTAGACAGCCACCCCTAAAGACTACAGATGCACCAACATAGCTGTTTTTAGGG
TTGTATGCAAAAGGGATTTCTTCAGGCAAGCTTTGGCTTCCTCTCGTTTTTCCTATGGCA
TTGTTTAGTTCTTATTCTTTTTGCTGAAATGTAATGTTTCCAGGTAGCAATAGTACCTGG
TGTGCAGGAGTAAAACCGTGCCAGTAGGTTTTGTCAGGTTACACCTCAACTGTGTTTTGG
TCTACTTCTGTGTTAATGAAGGCCAGGTGTTTAGAGGGGAGCATGAGGAGTGTGGTGTTG
AACTCCAGGCTCTGGAATTGCTGATGCAGTGGTGACTTATTGGCATGCTCTCTGCACACG
TGCTTTTGCAGCGTTAGTGCTTCCTGCTTGTCCTGTTCACCACCTCCCCTCCCACCAAGT
GGTGTCTTTTGCAAGAGCGTGTGGACCACCAGCTTTCAAAGTAGCTTCTTCCACCTCCTT
CCCAGTAAGTTGCAGCTGTTCTGTTATCTTCAGTTCTTAGGGCTCTTCAGGGTTTTAAGA
GCTTTACTTCTCATGTTAGCAAGAAAGATGAGGTTTCCGTTAATTAGAAGAAAAGTCTCG
TTCTCAACAGCTGCCCTACACAAGAAAGAACATTATGGAAATTTTCATGTGCAAATAACC
TTTTCTAACCATCTCTGCTAATTAAAACTAAGCTTTTTCAGTATTTTTAAATAAGTTTGG
GTTTCCATAAATATGAAAATATTCAAAAGAAGCTGACGCTTTATACGCTTGAGCTGCTCC
GTCCTCTCCTTGAAAGCTGTGTGCTTCTTTGGAGTCCCTTCCAGCATGAATAGGTGTGAA
TTTTCCATCGATGCTTCTTTCAAGCAAAAACTTCAGACAGAACATCCCACTAATAGTGCT
GATGAAGACCGTTCACTAAAGAAATGGATGTAAAAAAAGTAATTGGAGAAAACTTCACTA
CCCCTAGCTTTCTTCATGGAAGCATTTCAATGCTGGAAATGATGTGGACCTCAGTGGGGC
CTTGTTACACTCAGTGATGCCTTTGGTTTGCTTTAAGGGAAGTCAGTCATAACAAACCAT
ATGGAGATTGAATAAGCTTTAATTAAAAGCTCTATACGAGAAGAAAATCTGTTCTTAATT
GTGGGTTTGATTCCCAGTCTTGATTGGGAATGGTAATTAATAAAACTACATATATAGACT
TTGAAAAGTCCCTGAAAACATATAAACTTCACTTGCATCTCCAATGGCAATGTGGTCCCT
GTCTTTGCCTTTCTAACAACTGTTTTGAGATGGCTTAGTTGGCACTGCTGCCAGAAATTT
AACGAGTTTATTCAGTGCATGAGTCTCTTCTCATATTATCTTAAAACCTGGTTGATTAAT
CAGTTGTGCTTTGTAACTGTGGCGATTTCTCAGCATTTATGTTTTCATTTCCTTTTTTGT
AAACACTTTTCTTTCCCAGGGAAGATGAAGCCTAAACAAATCCTTGCAAAAACCAACGTC
CTTACTTTTCTCTAGAGCCCGCTGTTGTTTTTAACAAGCAATATAGCATTTTTGCGTTTA
TTGGCTTCGAACGAAACCATTTTCCTTGGGGGGGAAGGAAGTGCATATGTTAATTATGTA
CAAAAAGAAAGCCCTACTACTTCGAACAATGAAGCTATTTACCCTGCTCTGTTAAAGCTT
TTAGTTTTAATTTGCTGGAAACTCCCAAAGCCTGATAGCCGTTACATCTCTGGGCCTGTA
GAAATTATGTACGTTGTATGATGTATATTACATGACAGATGAGAATCATAGAATCATTAA
GGTTGGAAAAGCCCCCTAAGATCACTGTGTCCATGTCAACCCACCCCCACCATGCCTACT
GACCACATCCCTCAGTGCCACATCTCCACGGTTCTTGAACATATCCAGGCATGGTGACTC
CACCACCTCCCTGGGCAGCCTGTGCCGCTGCATCACTGCTCTTCTGGAGAAGAAATGTTT
CCTAATACCCAACCTGAATTAGCCGTTTTATTTTGGTGATTAGTTACTTGGGTTTACCCA
GTCATAATAAGCATAGTTGTTTTTTCTGCCTTTGTTTTAAGTTTTGCATGCATTTGGTGA
AATTCTTTGTTGAAGTGGTTGGTATCCCTTGCAGTGCAAGAGGGTGAAGACTTGAGAATT
CCTTGATAGGCAGTAGGAAGACCTCTAGGAATTGACTCCAGGACTTGGATAGATTACGTA
GTTTCAATTCCTGGTTGCTTCTCTCTGCTGACTGTGATTGCACTTTCTTTTTAAGAGGCG
TTATGGTTACTTAGTATTTGCAAGACTGATGGTAAACTGATGATTCCTAATAAAACTTAA
CACACATTTCTGTTCTGGGAACGCAATGAATTGGTCATGTTAATCTTTGCCTCTACCTCT
GGGAAGTGAACTCTGTGAAAAACAAATGTTTTTCCCTCCATGTGTGGTCATGAAGTTAAC
GAAATGGCCTCCATTGAGTATTGACAAGAGACTCAGCAACTTTGCTACCTTGTACGTGGA
GGTGTAAGATGAACCTCTAAATTGCCACATCTACATCTTGTGTCTTTGCAGAATTTGTGC
TGGCTGATTGGATCTCAGACTTGGAGAGGTTTCTTCCCCCTGCTTTAGCAGTTAAGAATA
ACAGGTCAAACTAATTAGTTCCATTTTTTTCTTCTCTGTTTTGCAGGATGGCCCCCAGAG
GAAAAAACGGAAGTCTGAAGCTGCAGAGGTGGACAAGCAGTTAGATATCCTGGCTATTGG
CACAGCAGTTGGTAGCATTTTGTTGTACAGCACAGTAAAAGGAGAATTACAAAGCAAGCT
AGTAAGTTACACACTCACCATCACATGCTGCCAAACAGTGGTGGTTTCAGTCGCATTATG
CTGTTCTTTCTGTTGCTTAAAAATGGGCTAAACTGGCCTATTTAATCAGATCTTTTTTTT
TCTTGATGGCTACATATATGAATATAATTGCAATAATTTAGATTTTTGGGAATCTTTGAA
TGGTGGTACTTCTGTTGGCAACACATACACTTTGAGAACTCTTGGTTTGGCAGTATCCTA
ACGTTGTATGTGGATTTGTCATTTTACATCAGATATGTTCATAATGATGAAGTGTCTAAC
TGAACAATTAAGTTCTCCATGGGATTATCACCTCATGTGCCTCTCCAGGGCTACCTGAGA
GGAGGGCAGGATTGAAGTATTCATCAGCTCTTGTTAAGCTGTTGCACCGGTGGACTCTTC
TTACACCCTGACTGTACTTAAGCAAGCAGGCACTTAGATAACTATTATCAAGACACCTGT
GCTAACTATTGTACTGCTAGACAGCTTTGGCTGTGTTTGTCAGTAGTGTGCAGGACAACT
TTTTGTTAACTGAAGTACTAGAACAATAATTAAATACACGTACAGGTGAAAATATGAAGT
ATCTTTAACTTGCAGTTCTATACGTGTACTGGTTGTTAAAAGCACAAAAAAGTTGCATGC
TATTCACTCCTCTCTGAGATATCAGTGATTTGCATTCAGTTCTTGAAAGAGCACTTTGTT
CACATTGTTGATGTGAGGAAGACTCAGTCGCAATATCTCTTTATTTGTGACCCTCTCTTA
TGTTTTGTAGGATGGCGGTCATGACAGTAGAATAAACTGTGTGAGGTGGCATCAGGACAA
CTGCTGTTTGTATAGCTGTTCAGAAGACAAACACATTGTGGAATGGAACACACAGACCTG
CAAAGTAAAGTGGTGAGTGACCCTCTTGGTCTGATTTGCTGTCACTTGCTGTTGTGCGTT
TCCTCCTTCACAGGTGTTAGTGTTGTCCTGTTGGAAATGCTGCACTCTGCTATGCAAGCT
TCATGCTCGCTGTACTAAATTAGTGGTTGGTTACTACTTTAAATTCCTTTAAAGTAGTTT
GATTAAGGGATAAAAGAGTAGATCTTAGGGTGGATTTCTTCCTCTGTGTATTGGAAAGAT
GAAATACAACTTAGCTGCTCAGAGGGATGTGAGTCTCTCCATGCTAACTCTTAGTGAGGT
ATGGGCTTCCAGTTGCTTTTCAGACACTGAAAATCCACATTCTTAGAAATATCCTTAGAA
GTGCGGGGGAAGCAGATGCTGGAACACCTCATCCCAGTTAGATCTACTGTGCACACCTGA
CTTTGCCCCAAGGGCCTAGCTGTGATGATACCCAATTGGTTTCGCTCACTACTGATGTGC
AGTGGGGACAATTCCACTTGGCTGTCTGAGCAGGCTGCTGCCATTTAAACTGCTGCTGAG
TCAAACAAAACTTAGTGCTGAGTTAACAAGTTGTCTAGGGTAGGTATTTGCTTTCTTTTC
CAGTACAGTCAATCTTTTGTTTTAAACTCTAGGAAACTAAGTTTTCTGTTAGTGATTCTG
GTTATCTTAACTTAATGAAAGTCTAGTATGTGATGGCACCTTGACCCTTGTCTTCTACTG
TTGTTAGTTTTTTTTGGTAAAATTTCCCCATTGTTGTTATTCTTTCAGCATTTTACAGAT
TTTGCTGAAGATGTTTGGGCACTGCACACAGACCATTGCTGGTAACCTCCTCAATTTCCT
TAGGAAGGAAAGGTGTCCTTATGTTTAGACCCTGATGCAAAATAGCAAAAGATAATGATA
AGATCTCCCGTTAGCCTTCTCTTTTTGGGTATGAAGGAGCTCGTTCCTTCTCCCTTTCCT
CTTTACACTCCAGCCTCCAAACCTTCTTGGTGATCCTTCATTGGATTGACTACAGTGTGT
CAGTAGTTTCTCCAAACTGGATACAGCACTCAGGTGTAGTTTCAGAAGTGTTGCACAGAA
AAGGGGAATCATTTTCCTTGATCTGCTGGCCATGTTCTAGCTAGTGGAGGTCAGCATGCA
GTTGACCTCATTGCTGCAAGTACTCACTACTAATTCATGTTAAAATGGTCTATAAAGATC
TTTTTTTTACAAATATGTTTTATGGCCATTTGAACCCAGCCTATATGAGATTTTCTCTGG
CACATATGAAGACTGCTTTACCTTGTCCTTGGAGGTTTGACTGCCTGTATCTCCAGCTTG
TTGAGATGCCCCTGAATGAACAGCAGCTCTGTCTTCTGGCATATTTAGCAGCTGATCTCC
CTAATTCCTTAATACCAGTGAACTTGTTAATGGATGCATACTGTCATATTTTTCAAGGTC
ATTCATGAAGACCTGAGCAAGCACTGAGGTGGTTGAATGGAATTGGAATGTCCTCGGGGA
GTGACACCAGTAACTGGCCATCAGCTGGACTTCATGGCAGTGATTGCAGGTGTTTGAGCT
CAGTGTTCCATGCAGTTCTTATCCTACCTTGGAATCCATTCAGTTAGTATCCTTGCAGTC
AAACTGGAGTTACATAGTCTAATGTGAGACGTTGTCAGAAGCACTGCTAAATTCAATTTA
AATAGTGTACAGTGTGTGTCATCAAAGGCAGTCAGTTTGGTTAGGGATGATTTGCCCTTT
TTGAAGTCTATGCTTGCTGTTTCCAGTCACTTTTCTGACCTTTGTGTATTTGGAAATCTT
TACCAGTGGATTTGCTGTGTATAATCTTTCCTCTCATTTCCTGTATTCTTTCTGCAGATA
GGTTTGTCTTTTTTGTCATCAGAAATTTCTCCTGAACAGTGCAGCCAGAGATGATGGAGT
AGTCTTGCAGCATCACAGACTTAAACATTTTTGGCACATCCTGTTCCATCTTAGAGGCTG
CATGTGTGAACAACTTGCTGTTGTGATCTCTGATTTTACCTATCTTGATGGATGATGTTC
TGTTCTGTCTGATTCTGACACTGGGTTTGAGAACATGGGAGGCCTGAGGGCAGTCTTTGA
TCTTCTGTGGTTTGGCTTTTTCTTTGTGCTGAACAGATCCCTACACCATTCAGCACTGGG
CCCACACATTTCTCAGTCCTAATCTTACTGCTGCTGACTTGCCATTAGATCTCCTTTTTG
TTGGCCTTCCTATTTCTTGTTGTCTGAACATCCAGCTGAACTTTGGCTTTCCTGCATGCC
TAGGCAACACCTGGTGATTTTTGTTCATGTTGGTGTGTGCCATTCTTGTGCTTTAAGATG
GTTATCCTGGAAGAACAACCAGCTTTCCTGAGCACCTTTTACTCTTCAGAGCAGTCTCCG
GTGGAATATTGCCCGTCAGTTCTTTGTATAAGTGGCAGTCTGCTTTTATGAAGACCAGAG
TTGTAATTCTGCTGTTTGTCTTGCTCTGTAGCGGATGCTCAGCACGTCATTCCTTGTTGG
CCTCTTCTAATAAATACCTGTAAGTTCTTCACTGGCTCTCAGAGTGTTTCGAAGCAAAGC
TTCATGCACTCAAACCCACCTTTATGTGTAGAGAAAACCACCTTCTTGACATGTCTTCAC
TAAATAGCCTTCCTAAAAGTCCATTAACTGCAGTATTCCTGTCTTGCATACTATTCCACT
GGTTCTATGTGGTCTTCATAAGATCAAAACTACAAAGCTCTCCATGGGTATCTAGCTCAT
CCTGTTTGTTTTTCATAGAGCGTGTTCATGCACAGCTACTTGAGATGGACCCAGCCATGC
TGTTGTCTCCTGAAATATGAAAACATTTCTTGTTGCTCTTCGCCCTGGGTGTTTCCCTCT
GCATTGCCTTATACTCCTGCTTCTTTTGTGACTGGTTATTGTTATTGTCTCACACCAATC
CTAGCTTAATTCCCTCTTTGCTAGGTTAACAAGCCTGTGGACAAAATTGCTCTTGTCCCA
CTTTGCAGGGTGAATATTGTCTCCCCTCAGCAGTCCTTGTAGCTGGAAGAGTCCTGTGGT
TACACAAGCCAATGAGGTGTTGATGTGCAGGATGTGCCTACTCCTATGTGAGTCTTTTCC
ACTGAATTGAGGAGAACACCACATACAAACTGCTTAAAGTTTGACTGTCAGGATACTTCA
TGGCAGCTCTTGTTTTCAGTTGCAATGCATAGGAAAATGCCAAGAAGTACTACTAGATTT
GATGTATGAGCTGCCTGTCAGAGGCAATGTTCTCTAATTTTGAAGACAGCAATGAGTAAC
TATCATTATTGGAGTGCAAAAATGAAAAGTATGCTGGCAATATAATATCACACTTTTTAC
CAGGAGTCATATCAGACACATCAGTCGTATTGGAAGTCATATCTGAGGTAAAAGATATTG
GAATCATAGAATCATGCAAAGGCTTGGGTTGGAAGGGATCTTAAAGACCATCTAGTTGTA
CATTTGGATATAATTTCTTGGGTTTGCTACATTAAATGGATATTGATCTGAAATTCTTAG
TCCTGACTTACAGTTTGGAAGAGAATACAGAATTTTGTTATACTCTGTGTAAGGTATGAT
GTTGTTTGTGAAGTTTGTAGTGATTTCTATGAAATCTAGTCAAAGGTGATAGTGCAAATG
AGTTCTCTTGTGGAAGACACAAGAGGTGCTGCTTGGCATAAGAGAGATCTCAGGAAGTAT
TTAAGAGGGGCTGTTCACAATCAGAACATGATGGATTGGGTCATGATTATTATGTATAGA
GGGGTTCGTGTTCATGATTTCCTGGTAGTTTTGTCCTCTTAGAAATATGCAATACTCAGA
CTCTTTCTAAGCAGGTGCAAGCTTTCCATGCCAGCATCTTTCTTTTTCTTAGACAGTGCT
TTCAAGCATGGAGTTCTTAAACCTTTGAGGCCAAGGTTCTTACTGTCAGTGTCACTGACA
GACGTAGGAGGAGTGTTGGGAACTGGGTGGGCCTTAAAACTCCAAAGTCCATTCTGAGTA
AGCTGGTGTAAGCTTTGTGGATTATGGTTCCAAGACTTCCAAGAGAAGTCTTAATGGTGT
GGCTCCTCTTGCCTAATCCTGAGTAGTAAACAACTTCGAGGATGGATATTGAGAATAGGG
TAAGCAAATATATGTGTTTTTTAAAGAGCAGCAAAGCAAAACAAAGTAGTTTTAATTATT
TCTGTATTTTTGAGTGAACTAATTTGAAATTGAGGAGCTGAAGCAGAATGATTTTTGACC
TGATTTTTGGCTACTTAGCCTTTTTTTAAAGTACATTTTGCCTTGGATTACCCAGCAGAG
TTGTCATACATTTTGAAGTTATGCTAATGAATATCCTTTCTATGTTTCCATCCAAATTCT
AGCAAGTGGAAAGGTGACAATAGCAGTGTCAGCTCTTTGTGCATCAGTCCAGATGGCAAA
ATGCTGCTGTCAGCCGGTAGAACTATAAAACTGTGGGACCTGGAGACCAAAGAAGTCTAC
AGAGTAAGTAACTTCATGCAACTAGGGTTTAAAAATTATATATGTATATGTTCTTCTTGG
TTGGTGACGTTGGGATTTAGTGTTTCCTAATAGGACATCTGAAAGTTTTGTAGGGTGGAA
GGAGACAGCTGGCACCCTTGGGGCTGCTGGAAGCTATTTCTGTGATGATACCTTCAACTG
TGGTTTCAACTTCCTGACAGTTGAATGAGGACGTTGAATTCCTTGGCTGTGTCTGAGAAT
GCTGCCAGCAGCCTTTCTTGATCCTGTAGCATAAGGATAGGTGCTGTTCTCTTTCACTGT
GTTCCTTTCTGAAGCCCCCCTCTATTGGGGAACTCATTTCATTGTACTATTAGTTTCTGC
TGATGTGTGTTTGTGAGAGCTCCTGTATCCTTGTGCTCAGCATCACTTTAAAGCCTTCAG
CTCTCTTAGCTAAACTCTGTGTAACAGGTGTTATCAGTATTGCTGTGGAAGCAATTGGAG
GGCAGAGAGACAAAAATGTTGTTTTCTGGGCAGGGCTCAGACACAAGGAAATTACCATGT
TTTGGCTGTTCCTTAAATGCAGTCGTGTTCTACTGTATGACAGCAGATAGGAAGCAGCTA
GTCTCTGGTTTCCTGGTGTTTGCTGTCAGGTAAGTGTGCACACGTGTTACTGTGGAGTTG
CTGACACATGGCATCTTCTGTGTGTCTCTGCATCCCATAGTGACCAAAATCACTATCTGT
GAAAATAAAAGTTGAAGTGTTTATTTATTTTATTTTTTGTGTGTCGTCAGACCTGTGTGA
TCATCTTCTAGTTGAAAATGAAACTGTAAATCTCGTTCTGTTGTAAAGTGTGACATGCTT
TCTGACAGTAACAGCAGTACAGGCAGGTGTGATTCTTTCACATGAGCTTAGTTCCAGTAA
TTTTGCCTTTGATTCCCCATTAAACTTTAAATTCTGATGAATAGGTGGAGTGCCAGGAGA
TAGTTTGGTGAAATGTAGAAATGTAAGGAAGCTGATCACCAGTTAAACAGGAAAAACACT
GAAATACTCTTGCTAACTTGGATCTTTCTTAACATTCTTTCTTAACTAATGTTTTAATTT
TCATCGTATGGCTGTTGGTGACAGTAATTGAATTTCCCCCCCATTCTCTTAGCATTTCAC
AGGCCATGCTACATCAGTGTCATCATTAATGTTTACCACAGTGAAACCTATGAACGAAAA
CAAACCCTTTGATGGAATTACAGGACTTTATTTCTTGTCTGGGGCTATACACGACCGGTT
ACTGAGTGTTTGGTATGTAAACTTTTCTCAGTTTTTAACTTTGATTATGACTGTTACTGA
GGATAGACTGAACAATTATGTTCTGAACTCTGATTAAGCAGAAGTGGCACTCTGGAAAAA
TGCAGTGATGATCTCTTAAGTAGTGGTTTCAATTCACTGATTGTTGAATGAAGACCTGAA
TTTCCTTGGCTGTGTCTGAGCATGTTTCCAGTAGCTGCCACTTGACTTCCCAGCATATGC
TAGGAATGTAGTGCGTGGTATGCTTCTTGTTCTTTGTATTTGCTGCAAAGTTTGTTTTCT
TCTTTGCTGAATTTTGCTTGGTGGTTACTTTGCACTTGAAATCTAGAACACCTTTTAAAG
CTGCAAGCTGCAGTTATGACATTAGTATTTCTGGATGAGGTGCATAGTATACCATGATAG
CGACAATAGTAGAGCATGACTTGTAGGCTCTGTAACACTGTGCTGCTTTTCAGATGTGGA
GGATGCTGCTTGTGCTCTGTTAAATAATGTGTGCTGTTTGTGTCTCCAGGCAGATCAGAT
CAGATAGGAAAGAAAAGAATGCTGTGATGTCTTTCACGGTAACAGATGAACCAACGTTTA
TTGACCTGACCGTGTCAGAACTCAAAGAAGAGGTAGGAGCAGTAGTTTGTAACCAGATGT
GTCCAACAATTTCACACCAGTTGCCTTTCAGGGCATTAAAAAAAAGGTTTGGTTTGTATT
TGGTTTCTGTTGTGCAAAGATGAGATCTGAATGCAAGCTCAGTAGTGTGAGGATAATTAT
TATAGCTGCACTTGTGTAGCTGGCAGTTTGGAATAATTATTTTCATAGCTACTAAGTGCA
AATTCCATTTTTCCTTCAGAAATTTTGCTTGTGATGGCAGAAATATAATTTGTTTCCTAT
TTGGAACAATTTAACAATCAAAATGTTTCTTAGATTTCAGTAGTAAAAGCTAGTGAAGGT
TTCTTTCTGAAATACAATTGGAGCATGGTTCTGTTTTTTGTCTCATCTCAGGTGGCTATG
GTAGTATAACTGTGTTTTGAATTAACCAGCCTTTATGAATTGAAATAGCTGAGCACATTC
CCCAAGTCTCTGTTTCAGCAAGAAGTTTCAGAATAGTTGTCTTATGAAAAGTGTCTGCAT
ATGAAATGTTCACAAATCATTTCTGTAGTTACTTAAAACATTTTTTCTCCTATTGCCTTT
AGATTCCTTTATAAAAAGAGTATTTCATGCTGTAACTCCTAACGTTTCCATTTGTGCCCT
CTCACTGCATGTATAGGAGCTGGGAGTATTCTGTGATGTGCACTTGGAATTTAACTGCTC
AGAGTACCCTGTTTTAGTTTCTTTGTGAGCTTATCTAGTGTGTCAGTGCCTGTGTAGTTC
AGTGCATCCAGACACCTTGGGTACTATATTTTTGGAACATTGCTGCTTATACTCTTATCT
GCTAGTGTCCAAGCTGATCAGATTTGAATATTTCAATATTGATACAGTAAAGCACAGGTT
TGAATTATTACGTTTTTGTTTTCTAACTGCTATAAATGTTCCTGAGATGTTACTGTGTCT
GATCTATTTGTATGGATTTAGCTGTATGTCTAATATTTGTAGTTGCTGTAAAGAGTCAAA
TCATAACCTGCAAATAGCTCTTGATGTCTGTTGTTTGGTCTAATCAAAATCTTCTATTGT
GACTTCTTTCAGCCTGTGAAGTTAGCAGTTGTTTGCAGAGATGGGCAGTTGCATTTATTT
GAACACATCTTAAATGGGTAAGGTAGTATTCCTTCTGAGAGTATATTGGGCAAGGTCTGG
GATTACTGGGAGGCAAAGCTTATTTTGTTGTGCTGCTGCCTTTGAACTCTTGCATCTGTA
CACAAATTGAGTTCCAACTGGTTCTTTGTCTTGGGTTACTTGACGTGTTTTCAGAAATGC
AGGAGAGCTTATTTGATGGGGGTTATGCTGTACTTTGTTAGTACTTGTTGCTTCAGCCAA
GATTTTACCTGATTTAGCCTCATTTAAACTATCTCTAAGGGATGTAAACTAGTCGAGTTT
AAGGATTTGTTAATGAAGGGTGCATACTTGTGCAAGATATGGAAGTCTTCAAAGTCTTTA
AGCTGAACATGCTGTTGTTTTTCTTTCCTTTTTTTCTTTCCCCCAGCTACTGCAAAAAAC
CCTTAACATCAAACTGTACTATCCAGATAGCAACACCTGGAAATGATGGAGACTCCACGC
CAAAACCAGTCCCTATTTTAGCGGCTGCGTTTTGCACAGACAAACAGTCTCTGCTGCTTG
TGTATGGAAACACCTTACAGCCCATCATAGAGAAAGTGGTACGTAAACCATATTGGAAAG
GTTTTGGATTTCATACTTCTTTGGAATTGCATCTTGAGATTGAACTTACTCTTTCTCCCT
TCTCTGGGACTATTGCCCTTGAGTTGTTTAGAAAGGGGATTTGCATTCCGCTCATTCAGT
TAAAGTGTAACTTGGCATTATTGCTAGCTGTTTCATGCTGTCTCAGCTGTTAATTCATTA
GGCCATTGAAACTTTCTAAAACTGTTTCAATTTGCCTGCGTGAGCTTCTCTGCAGAGCAC
AGAGATCTGGTAACAAAAGGCAGATGTGCAAAGCAACTGCTATTCTAGGGGAGGATAAGA
AGCTCATTCTTGTTTGTACCTCTGGAGTTTGTTCTCCTCTTTTAGTAGTTTGATGAATCA
CCACTGTGATTCGTTGGCAGTTAACTGTTTTTATTCCTGTCCTTCCAGTCTTTGAACACC
AGCGAATCCCACATATGTTTGATAAGGGACGTCCAGAAAGCGTTGGCGCTTAAAACAGAT
GATGCTGTAACAAAGGTGAGCTTGTGTGAAACACAGTTGTCTTGCATCTCTTGATTTACT
TTGAAAATGCTAGAATTCTCCGCTCTCTTCTAAAATGAACTTGGATTTTTGAATAAACCT
GCTCAGAGCTGCAGTGTAGTTACAGAGACCCACAGCCCTTGTCTGCCTTGTACACTGATA
GGCCTTCCCGCAGTTACCTTCCTGTAGCTCGTGCCACAGCTGCTAACATTGGTATAGTGA
GCAGACAGCATCGGTTTTCTAACCCTCAGGTTAGCTACCAGTTCTGGTGCTCCATCAGCC
TGGTGGAGCTTTGTGCTAATCCCCTGGTCCTGGAGCTGGAGGGTAACAGAGCTGAGATGC
AGTGAAAGATGTGGGAGCTCCCTGGCATGCAGTGATGATCTCCATCTTGGTTTCGCTTTT
TGCTGAGTTCCAGTGAAGACTCATTTCTCTTGGCTGTCTGAGCATGCCTTGTGGAGAGAA
AAGTGATGATTTGTGTATTGAGCGAAGTGAGTAGTATTTTAATTTTACTATTTTTCTCCA
GTAAAGTTCTCGAACCGTGAAATCGGATTCTTATCTGTAGAATATGACTTGTATGCACAT
CATCTGGAAGTTGCAGTGCTCACTGCAGTATGTGTATTTGGATCACTTTAGTGGGCACAC
AGCATGGCTCCCATAATGTGCACAGGGTTGGGTGGGTACTTAAAAAAAAAAAAAAAAAAA
AGCACAGCACACAGAACTGCAGTTATGAAAGAAGGGTTCTGGAAGTAGCATGTAGCATTT
TCCCAATAGGTTGTGGCAGGCTGGTTTTAACATAGGTGAGAATCTCAAAGTAAAATCAGT
ATTTAAAACCAGGAGGAAGATTAAGATATTAGCAATTTATTCTTATGTGTTTCTCTTTTT
CTGCCAGGTGAGGACGCCAGTTGTGAACTCAGACACCAAAGTTCTAGTGCCTGGCATTCC
AGGACATAGTGCAGCTGTTAAAACTCCGTCCTCGGGAAAGGAGAAAAAGAAAAGCAAGAG
GAAACCAGGAGAGACAGAGGTAAAGTGCTTCCTCTTTTAAACCCAACAATCATTTAAAAA
GCAATCATAAATGATCATTGCAGCTTCTTTGGGTGTATTTGAACTTGAGTTGTTTGCCTT
CATTGTTTGCATGAGGGCAAAGTGAATCATACTGTCTTCTTGTAGGAAAAGGTCTTCCCT
TTGATCAAAACCTTTCTCTTGTTGAAGCCCTGACTACTCTGCCCACAAATTTGCCTGTTA
CTGTAGAACTTTGTCACACACTTGCCTGTCTCTCTCTGCTAAGATCCATTACTGCTTCTT
AGTCAAAACTTCATCTTCTCTTTTTCCAGCTATCCTCTCAGTATGTTTATTTCCAGCAGG
ATAAGAGGGAATGGTATATGTTTGCTACTTTGCTTTCAGCTGATATTTCTAAGAAATGGC
CCTGAAACACTTATTTCTTGTCTACAGGACAGCATTGAGGAGCGCCTAGGGGCATTGGAT
ATCGATGTGAGCAAAGTAAAAACTCCAGGTGGCCTTCCACAAACAGATAGCTTTGCAGTG
CTTTTGGTTCAGGGCTTGGAAAGCAACGATGAAGATATCTTAAATGTAAGTGTTGCATGA
TCCCTGTATGCTGTTTAAACTATTTGCTGAGACTTGTGGGGAGCTGAACGGTCAAGACCC
TGTTGTTCCTCCTGGCTGCTTTTTGCTGATATGCTGATAAGGCAGTGGTATTATGAATGA
TGGTAGTGGTATTTTAATGCTAGCTACTTTGCTTTCTGAGTCATCGCATGAACTTTGCAG
CACTTCTGTTTATGGTAAATTTGTTGTGTCAGAGTTCAGATATTTTACAAGTGATGTTAC
TAGTGCAGCTATCTCCCTTTTAGCTTCAGCTAGATAACAATCTGTGCTTAGTCCAGAGTG
TACCATTTCCAAGTAGGTGTTGTTTGAAAAATGCATCAGTGACAACAATTTGACCTGAAA
AGCTTGTTGCTGCACTTGGACTAGGGGGAATTTATACTTTCAGGGCAGGAAATCTCTTAA
GGATTTGTTATTGAGTAGAAATTACTTGTCAGTGGTGCAGGTGAAAGGCATTTATTTGCA
AAGTGAAGCATAGAAATAGAAAAACAGCACGGGAAGTTCTTGTTAATATGTCTGTGTCTG
TTATACGTGTCCACCCATCTCATGTTAGAAACTAGGGGCAATGGCCAATTGTTTTAGACA
GTTTAATCAAGTGTTTGTTATGTTAGTTGTAGCTGACTTGAAAAATGGAACTCCTTTTCA
TGGTGAATTTTACTTTACGCATTATCCTCATCTGAGCATATAGAGGTAATGGAGTAGAAG
AAGAGATTTAAACCCAGGAACTTTTGATTTTTGTTCGTACGTGTGTTAAAGCTGAATGCT
CATCTGATTTATTTTTCCATTTTAACAGAAAGTGCTTTCCACAAGAAAGGAAACTTTAAT
AAAGAACACAGTAGCCAGAATGCCTATACACGCTGTCATTCCACTGCTGCATGAGGTAGG
AGAGATTGCATTTCATCTACCTGTCATACAAACCACATTTGGCTTGCCTTTCAGCTGGGG
AAAATTAAGGATGTGTCTCTCAATTTCAGTGAATAAATCAAGTCAAATAATGTTGATTTA
GTAGTTTTATAATACTAAACTTATTCGTAGCTTATTTCTGTCTTACTCTTACCTCATCTG
GCTGAAGCTTAACCAAAGGACAAAGTGCCACTGTCAAAGCTAGGAAAAACCGTAGATCAT
GTGGTGTTATCTTAAATGAGTAAGCAGGAAAAAAGAAAGAGGTTAAGCTAAAGCTTGTTT
AGTCCATGGCAGGGAAAAAAAAAACAAACCACAAAACAACACATTACTTATTTAATACTA
TTAAAGTAGATGATAAATTGAAACTTGAAAATAGCAGTGCTAGTTATGGTTATATTTCTC
TTGTATTTTAATCTGCTGGCCTCAAAGTGTATTCTTAGTTGTGGTACTAATCTTTCTGCC
CAAATTCTGGGGCTGTCATGTGGATGGGCTTTAACCTCAGTATGCATTTCTAGCTTTTAA
TTGTTACCATTTTTGTTCCTCTAGCTTACAAAGAGATTGCAAGGCAACCCATACAGGTAG
GATTCAATTTATCTGAAAACCTTTATTCTATGTTTTATGGTCTGTGCTTCCCTGTGATGA
CTTCCATAGTAATTGTAATTAACAGTTGCTATGTTAATAGTGTCTTGAGGTAAAAATTAT
CACCTGATTGTGGGTGCAAAGAATAACTTTTATTAAGACTATGCTGTTTTGGGCTGACAT
AAATGACATTAAAAAAGAGAATGGGATACCTGAAGTGAGCATGCTAAGTAAGTATCTGAA
GTAGCAGACAGCTCAGATCTGATCAGAACGTCGACTCAAATCACTTTAGGATGTGTAGCT
TGTATTTAAGAAAAACAGTCGCAGCTCTTCCTGCACCTACCAATCCTGCTATACTGCTAT
AGCAATAGCTTTGCTGTGACTAGATGTCTTCAACTGGATTAAAAAAAACAAGAAAAAAAG
ATCCAACACACTGTAGATGAAGAAAGAAGTAGCGTTAGTTTGATCTCTTCTCCATTGAAA
TCTCCAATTAAAAAAAAAAATCAGAAACAGATCCTCGAGCATGTCTAATTTGTCTTTCTC
TTAAATGTCTGTTCTTTTCCCAGTATCTCTTACATGGGCATCTCATCTGGATAGCCAAAT
TATTTTATTTCCTACTGCATTTTTCTTTTATGTAATGAAAGTGGAGCACTTCTTGTAGAA
CAGCTTAGCAACTAGAAAATAAAATGTGTGTTGTCTGTCAGCCAGTATCTCAATATGTAT
GATATCATTTCCAGTGCCTCACAAATGGTTCGATGGCTGAAGTTTGTTTTTACTCTACAT
GCGTCCTACCTTTCCACAGTAAGTATCTTGCATTAAAGTTATTGCATATGGCTGAAACTA
GACTTATGTGCTTAAATGTATGTATATTCTTTCTTCAGGGATCTGTCTCTTGCTCTCCAC
GTATGGTAGTGCCCAAACCAATGTGTAGAGGGCTGTACTTTACCATTTTGCTGAATTGAT
GGGTGTTTGTTATAAGTTGTTTATCTTGGTCATCCGTGACATAATAATAGCATCCCAAAG
TCAAACCAAAACAAGTTATGTCATGGGAGAGAGCCAAATAACTGTCAAAGCATGATCCAG
CTGTTGTCATTAATGCTTACAGAACTAAATATCTGTATTGAGTATGACTGGATATATAGG
GTAAAGGTATGACAAAGTTGTCAGAGTAGCAGGTAATGTAGTAGCTTCTGGGTGGAAATC
CAGCCTTCCCTAGATGAAGCACTCTAGCTCAGTTTACAAAACAAACAAATGTATTGTGAC
ACTGTTAGTCTTTTCTATTCCTGGGGATCTCCCTTTTATTACAGTACCATTGTATGTCAA
AACTTGTACGCATTGCTAATAGTGGGTTTGAATACTGGAGTGTATTCAGTTTCCATTCAC
ACTGCTTTCCAAGTAATGCTTCTAAATGTGCTATTAGGAATGACTGTGGAAGGAAAAGGT
AGTGTGAGCAGACGGGGTTATGGTTATAGACATGCCTACATGTTAACTGGTTGGGTGGCA
GGTGATTCCTGTGAATCCTCAGCGATTCCTTCTAACCAGAGTGATGTCAGCAAGGATTGC
TTGTCCCACACATGTAAGGATAGTTTAAAAATGTAAAAGTAAGGTAGACGTTATGTACTG
GGTAACAGCTTTGTTTTAATTCTTCCTTCTCTTCTCATAAGTTGCCAGACCTTATTCCTC
AGCTGGGAATGCTATACCAGTTAATGGAGAGCAGAGTAAAAACTCTGCAGAAGCTTTCCC
GTCTACATGGAAGACTCTTCCTTCTCGTCACCCAGGTGAGTTCAGCTGAAGAACACAGGA
TATGTAGAAGTGTTATTTGCAGGCTTAGCCTTCTGTTGTGAGAGCATCTGATGGGACCTG
TCATCAGGAGCTTAGTGCAGCTGCTGTATGGCTACAGTGGTAATACTCAAAGCACTGCAG
TTGACTGACCAGACAGTCAGACAATGGTCACAGAAGGTGTTGCATGTTCTTTTCTGCCAG
ATGAGTGTACTAACTCATAGCATTTTAAATGGGAATAAATGAGAGATACTGGGCTGCTTT
GAAGCAAATGCCTCTGAAATTTTACTTTGTCCTTCCTATTTGTGTGGCTGTTAAACTACA
ATAATAAATGAATGCATGTTAACCTCTGTGTAGATTTCATTTATGTTGTTGAGAGTCTTA
CTGACTTCAAGTTTGGGGAATATGTGGTTCCATGTAAGGCTAATCTGCAAATTCCATTCA
GGTTGCAGCATCGGAAACAGTTCAGGATGTGACGGAGGTTAATCAGACTGCGAAGCTGGT
ATATGAGGATGGTAAGTGTTGTATGCTAGATATAGCTCAACTCTGGAATTTGTGTGACAG
CTGATAGGTGGTGGCTGTTCATCATGCTCCTGTGATATTGGTAGTGGACAGTCTCCAAGC
AGGGAGGTTTCATGGGAAATCTATGGCAGGCAAGTGAGTGACTGATCATGTAGGCATCTT
ACGGTTCATTGTGTCTTTCTTCCCCTCTTTTGGTTTCCTTCCCTTCTATTCTATTTTCTT
GGCGGTGAAGTCAGGAGGGAGGCCAGCAAAACTGCAACCTTGGACTTCTGGAGGGCAGAC
TTTGAACTGTTGAGGATGCTGGTAGGGGAGGGTCCCTTGGGGTTCAGCACTGGGGGGTAA
AGGGGTCCTGGAAGGCTGATTGCTCCTCAAGAAGGAAGTCTTAAAGGCACAGGAGCAGGC
TGTCCCCCTGTGCCGCAAGATTGAGCCGATGGGGAAGATGACTGGCATGGATGAACAGGG
AGCTTTTCCTGAGGCTCCGGGAGAAAAAGAGAATCTAATTCCTCTGGAAGAAGGGATAGG
CAACTCAGGAAGAGTACAAAGAAGTTGTTAGGGTGTGCAGGGAGAACACTGGAAAAGCAG
AAGCCCAGCTTGAACTCAACTTTGCCGTTGAGGTAAACATGAACAAAAAACTTTTTTACA
AATATATTAACAGTAAGAGGAGGGCTATGGAGAATCTCCATCCTTTACTGGATGTGGTGG
GGAATATGACCACTAGGATAAGGAAAAAGGCTGAGTTTCTCAATGCCTTCTTTGCATCTG
TCTTTAGTAGTCAGACCAGTTATCATCAGGGAACTCTACCTCCTGGCGTGGAAGTCTCAG
ATGGGGAGCAGAATAAACCCCCCCATGATTCAGATGGAAACAGAGATCTACTGCTCCACC
TGGACTGCTACAAGTCCTTGGGCCGGATGGGATCCACCTGAGGGAGCTAGTGGAAGTGTC
AGCCGAGCCACTTTCCATCATCTGTCAGCATCGCTCAACTGGAGAGCTCCCAGAGGATTG
GAGGCTTGTTGTGTGTGACTCCTCTCTACAAGAATGGTTGTAAGGAGATTCCAGGGAACT
ACAGGCCTGTCAGCCTAACCTTGGTGCCAGGGAAGGTTACAGAAAGGATCACTGTGAGGG
AGATCACAAGGCATGTGTGGAGCATCTCAGGGATCAGGCCTAGCCAGCATGGATTCATGA
AAGGCAGGTCCTGTGTGACCAACCTCATCTCCTATGATCAAGTGACCCGCTTGGTGGAAG
AGGGAAAGGCTATTAAAAGGGCAGCAAAGCTGTGAAGGGTCTGGAGCGCAAGTCTTACGA
GGAGTGGCTGATGGAGCTGGGATCGTTCAGTCTGGAGGAGTCTCAGGGGAGATCTTACTG
CTCTCTACAACTGCCTGAAAGGGAGGTTGTGGTGAGGTGGTGGTTGGCCTCGTCTCCCCT
GTAACAGTGATAGGACAAAAGGGAATGGCCTTAAGTTGCACCAGAGGAGATTCAGATTGG
ACATTAGGAAACATTTCTTCTCTAAAAGAGTGGTCAGGCACTGGAATGGACAGCTCAGGG
AGGTGATACAGTCACTAACTCTGGACGTGTTCAAGAAGTGTGTAGATGTTGTACTGAGGG
CCACAGTTTAGTGGGAAGTATTGGTGATAGGTGGATGGTTAGACTGGATGATCTTGGAGG
AGGTCTTTTCCAGCCTCGGTGATTCTATGGCTTCTGCTTCACGAATGAAGGAATCAATTA
ATTGATAAATCTTGAAGTACTTAGCTGATGACATCAGATTTCTAGTGCTAACTGCCCTTA
TGCTGAGGTAGGTGCAGTCAAGGAGCTGCTACATTTGAATCAGTGAGACTTCGCAGTAGT
GTGTGCGTATATAATTCCAGTTTGGGCCTGACGTTTCTACTACAACTGTATACTGTATAA
TCATAGCAAAGTGACTAGTTTCTGATTTGTGTCGATCAACCTAGTCTTCATATGGAATCA
GTTTTGGAATTTAAATAGCACGGTTTAGTGGAGGTTTGGCAGCATATGGAGTTGAGTTTT
GTTTGAACGTATTCAAGTCTGTTTTCCAGACTGAGGGATTGTTTTCTTTTTGCAGAATCC
TCAGAGGAGGAAGGTTCAGATGATGAGATGATTGCGGATAAAGACTCAGATGTAAGTGGA
GTTGAATTGAATCTTCTCCCAGTCAGTTGTCACAGAAGTTGTGTTAATGTCAAAGATTCA
AACATTCCTGTTTTGTTCAACCCTCCAGGAAAACTGGGATGAGGATGAAGAAAAAGAGGA
GCAATCAGATGAACAAGACATGACTGTTGAAAAGGAAATGAATGGTGATTCTGATTTGGA
ACCAGAAAATGAAAGTGAAGAAGAATAACGGCATAAAAGAATAAAGTTAACAGTTTAAAG
AAGTGGGCCACCAGAACTTTCTAATTCTGGATCATCTTGATGAAAGATGCCATATTTGCA
TATAGGGGGTGCAGACTTAATGCACAGCCTATGTGTAGGGGCACGTGTGGGGCACTGTGC
ATTTCTGAATCCAGAATGTTTAACCACGCCAGCCTTCTCTTGCCCTATTTCCCTGCGCTT
ACTATAGAAACATTTCTTCCACCTCTCATGGTCAGATTATGCCTGTCATGTGGACATGCA
TTTGTATCTCAAGTGAAATAAATCTGCCACCGCTGTTTGTGTGGTAAACTTGGTTCAGCT
TTACATTGAATTTGTTTCAAATGTTCAAGGATCAAAACCAGCTGATCTATACCTTCTTTC
CATGCTTCAGTTAGCAATAGCAAGTGGGCATCCTGCTGCTTTTTTTTGTTTTCCAGGAAA
AGAAAAAAAAGGAAAAGTTATTTTTGTAACGTTTAAATTCTCCAATGAATTTCCTTTCCT
TCTTCCCATCCTCCATTGGTTCAGCCATGCCTTGGCAATATTTAAATGCCAAAGTGGCTT
AAAAACAGCTTTTTTTTTTTTTAAACAAATTTGAACTTGAGACTTTTATATGTAGAATCA
ATGACTTTTCTCATGCTTTAAAAAGACATTAGAACTATCACTGTTCCCTAATTTCATTTT
AATTGAGGCTGTATGTAAGATTAATGCTAACCCAGAAGATAGACTGTTGAGGTGGATGGG
GAGAGGGGAGTAACACAGGGAAATGAGAAGGTGGATACTTGTGAATACATAGCGCACAGC
TATACGTTTATTATCAATTTTTAACCTCAGTGGCAGAGCAAGGACAACTGATTGCTCAGC
TAATGGAAGCTGAAGAGGTACAAACACATTTTTAAGAGCAAAACATGGTAAAGGTCTGAG
CCATTCACCACTATAATGTACAATATATTTGTCTATAAATGGAGCTGTTGCAACTAAATG
CTGCCCTCTTTGTAAAGTGAATAAATATACATCTCCTTTACCAAATACCTGTCCTGTGGT
TTTGTTGAGATTGCCCTTAGATACGTAAGGGTGGTGGTGAAGGATGAAATGCCCTGTTTG
TACAAACCATCTCTCTTGTGGAAGAGGAAGCCAGCCTCGTAGATTACAAGGCAAAGTATC
TGTAACTGCTTTCTTAGCTCCTTGTTGCATTGGGGCTGCAGTGTTGTCTGGAGAAACAGT
GGATTGTGTCATACGTTAATCTGATGTGTAGCTTTTCAAGCAGTACTGATGTTTCTGTAG
ACGGGCTGACTTTGAATCTGGTGAAAGAGGGATGTGAATGATGGTCTGGTGAATCTCCAG
TGAGTGCTGACCTGCTGAGCTCTTGGGCCATGGAGTAACATGAGCACTTGTGTTTCAGTA
GTGCAATGTCCTACACAGCTGCGTCTCAGCCTTTCCAGAAGGCAAAGCAGGACTGTGGGT
TTGGGTCAAGGAGTGGGCTGAGTACTTTGCTGGCACTGTTGGGTTATGGGTCTGTGTTGC
TCTGTCAAGGTGGGCGTTACCTGTGTCCATCACTTCAGCACAACAGAAACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 4786..4920, 5710..5831, 10202..10322, 11452..11595, 12113..12211, 13272..13336, 13726..13897, 14328..14414, 15307..15438, 15867..16004, 16828..16914, 17484..17515, 18254..18317, 19181..19294, 19741..19810, 21892..21980, 22048..22750
1002..1112, 4786..4920, 5710..5831, 10202..10322, 11452..11595, 12113..12211, 13272..13336, 13726..13897, 14328..14414, 15307..15438, 15867..16004, 16828..16914, 17484..17515, 18254..18317, 19181..19294, 19741..19810, 21892..21980, 22048..22164
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved