Gallus_gallus Locus RL30_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus RL30_CHICK
Gallus_gallus
RL30_CHICK
2
SNORA72
3767..3901
5460
TCAAAATAAGCTACATTATCACTGACTCAATGCAGCATGTTTTCACTTTGCTTTTTAGT
TAGTTACTACTTAACGCATGCTGGCAAAAGCATCAAACTTCCTAGGCTCAACAAACACAA
CATTATCCCATGCTTATGCAAACTCAGGTAAATGTCGAACAGATTTCATACTAGTTTTGC
CATTTCATCCATCATAACACATATATGTTGGAGTTCATATCATCAAATCATAGAATGGCT
TGGGTTAGAAGGGACCTTGAAGATCATCCAGTCCCAACCCATGGGCAGGGCTGCCCCCCC
ACCACCTCAGGCTGCCCAGGGCCCCATCCAGCCTGGCCTTGCATGCCTCCAGGGATGGGG
CACCCACAGCTCTCTGGGCTGCCCGTGCCAGGGCCTCACCACAATGTTGCATAAGATTCA
GTATATCCTATGTGTGTGAAGTATCATCAGCAGAATCATAGAATGACAGAATCCTTAGAG
TTGGAAGAGACCTCTGAAGGCCGCCTAGTCCAACAGCCCTGCAATGCACAGGGCATACAC
AATTAGATCAGGTTGCACAGGGCCTGATCCAGCCTCACCTTTAAAGTCTCCATGGATGGG
GCATCAACCACGTCACTGGACAACCTATTCCAGTGCCTCACCACCCTCACTGTAAAATAT
TTTTTTCTTATATCTTCCTGGATTGGTGCTTAAAGTCTCCCGTCAGGCTACGAAGAGACA
AAATCGCCCTGCGAAACACAGGGGTTTGCAGGAGGGGAAAACAGGCAGAGATAACGCCCC
TCCTATTGAGCCGCCACACCTATAACTGACAGCCGCGCACTCACAATCCCGCCCTGTTAA
TGGTGGCCGTGCGTAGCAGCAGGAAGGTGTGGGGAAGCTCTCGCGAGAGGCGGTGCGGAG
ATGTCCTCGCGAGAGGTGGAGCGGGGATAGGCGGTGCCCGCCGGGCGCTCGCTCCTTTCT
GGCGGCCCGGCCATCTTGGTGGCGCGTGTCCGGTGAGTGGGGCTCGGCCGGGCGGGCCCG
AGGAGCCGCTGTTCAGCGCTAACCCGACCCCCGCTCCTCCTGTCTTCCAGGTACCGCCCG
ACTTAACGCCAGGCAGCGACAATGGTGGCCGCAAAGAAGACGGTGAGTGGGAGCGGGCCG
CGTGTGGCCTCACGTGGCGGCGTTCCGGCCTCCGCCGACGGCGGGCGCTGCGCGCGGTGG
TGCGGCCGCGGGGCCGGGGCGCTCTGCCGGGCCTGAGGTAGGGAGCAGCGGCCCCGCGCA
CGGCCTGAGGCGGGGGCGGCGGGGGGACCTGGGCGCAGCTTGAGGCGCCTGTCGCGGCCC
TCTGGGCCCGGGCTGTAGTTCTGAGCATGGCACTGCAGCTCTTCGTTGCCAGCTTCTCTG
TACTCAGTTCTCTCCTGTGCAACATCCTAGCTGCTCCTGGGTTCCCTGCCCCAGCCGCAG
GCGAGGAGGACTGCAGCGGTGTTCCTAGTGTGGTTAAAGGGCTTCAGCGTTCAGATTTTG
TGTTTCCTGCCAACTTCTAGTCTTAAAGTTGCTGTAGCAAGTATGAGTTTCATTTGAGAT
GACGGTGTTCATTATTCCTTATTGGCTGTCACACACCTATTGGAGGGTCTTCACCTATTG
CATGTGGTTATTTGTTTCTACCAATGCGTGGAACGTGTATTAGTGCATGCCCTGCAAAGT
GCCAGACTAGAAACGTGGCTCAGGTTTGCAAGGCAGAGGTAGTTTATATTTGAACACGAC
CGGCTAAGTTTTGCAAATGCAAAATAAGTACTCCATGATGTGACTGGGTAACGTAGGTGG
CAATGGCAGTGCTTTTCAGTGCTAAGTGATGGATAAGATATATTTTGTGAAGTTGGCAAA
TGGTACCAGCATCGTGCTTACCCACAGGCTTTCTTGTAACAGTATGGCATGCTGGCTTTT
TTTATTCTGCGTTGCAGATAACTGGGGCAAGATTGCATGTGGTTGGAATTTCTTCACCTT
ACATTCTCTGCCACTTTGTGGAAGGTAAAATAACGTGTAATGAAACTCTTCTACTTACTT
CTGCAGAAAAAGTCCCTGGAGTCCATAAACTCCAGGCTTCAGCTGGTGATGAAAAGCGGT
AAATACGTGCTAGGATACAAACAGACTCTGAAGATGATTCGGCAAGGCAAAGCCAAGTTG
GTCATCCTAGCCAACAACTGTCCTGCTTTGAGGTAAGCAGATGTACAAAAAACAGTTCTT
GTTTAAAAACTAAGGCAGGTGCTTTGTAGAACTGTAGCATGTGATTCGTGCAAGCTGGTA
ATGCACAGTGACTTGTAGATGTACTCCGTAGTGCTGTGAAATAAACATGATGAGTTGTTT
GGTGTATATGGATTTTAGGTCGGGATGTGTTACAGTGCTTTCCAGCTGTTTTATAGCTTT
CTCATACAAAGAGTTCACCTTGCAGAAGATTCTGTAAGCTTTTTCACGCTGTGACGGCAT
AGGTTCATATCTGATCTGGTGGGTTGGAGCTGAGACATCTTCATGGTCCCTTCCAACCTA
AGCCATTCTGTGAAAGTAGTGAGACTCACTTCCTGATTTATCAAAGTTAGGTACTGGAAA
AGAATTTCACAAGTAGGAAAAACTAGTAATTGATAGCAATTCAAAATGTTTGAAGCATAG
GACATTTGCTGTTCTAGGAGAATGAAGTCTTTAGTAATCTTTGTCTCCTGACATGGTCCT
TACTGAACTTCTGGTCCCTTTCTGTCAGCAGTATCAACAGATTAAAGAAACTGCAGATGC
AGGAAAAAAAACAACACAGATGCTTGAGAAATGGGAAGACTATTTTAATTCCTGGCAGAA
AATAAATGTTTTTCTAGGCAGAAAGAATCTGTAGGATTGAAGTGTAATTGGGAGTTGAAG
CTGCTTTTGTTGTATAGTCGATCAAATTGTCAGTACTTTAACACTCAGTTTTTGAATCTT
AGAAAATCGGAGATTGAATACTACGCCATGCTTGCAAAGACTGGTGTCCATCATTATAGT
GGCAACAACATTGAATTGGGCACAGCATGTGGAAAATACTACAGAGTGTGCACGCTGGCT
ATTATTGACCCAGGTATGTGTCTTCTGCCATATAATGAACAAATTGGGTATATATCAGTG
GTTCCTGCATTCACCTGTGAGTAGCAGTGCTTAGCAAGTAAAGTGCAGAGGTAGGGTCAA
ACTCTGTCATAGTTCTCCTTTAGGTTAAACCGTGACCAAGATCTATTCTTATTTTGTTAG
TCCAAGAATTAGTTTCTTACATTTGCATACAGCTCCTTTTACTGTTCAACTTCGTTAATC
TAGGATCTTGGTAAAATAAGACAACTCACAATCCAGCAGTTTATGTATACACAAGGAATA
AGCTATATACAGGTGGATACTAATCCAGTGCTGGAGTTGAAAATCATATTAAATGTTAAA
ATCTTAAATCTGTGTGTAATTATTGTGGCTTGGTAGCACTCCTTGTTCCAGAGAATTGTT
CAAGCTCATTCTAGAGTCTCCTAACGATGTGATTTCCTATCTTCCTTCCAAAATCTTGAT
AAAGACAAGAATCAAATTTATCTTACATCGTTCTATTTGACCAAAAGCATCCTAAGTAAA
CGCACAGATTTCTGTTTTAACTACTCCCAAATGTTGCCCAAGTAACATCAGTTTAAATTC
CCCATTTCTTTAGAAACCTTTATTTAGCTCGTTGGTATTCTGACAGTAGCTGGAAGCTTT
AGTGTAAGCTAAAGAAGTGGAACTTAGCCTTTCTGCTGTGTAGTACGATGCGAATATTCT
CGCTGCCCTGATATTCCGGTGATCAGGGGAGGCTAGACATTCGCTATATTAAAACTATGC
ATTGTGTCCTCCAGGACTGGACTGCTGCTCTAGTACTGGCTTTGAAAATGCTAGTGACAT
ACATAGAATTATCACAAGCATATTGTGCATGGATTAGAAAAATGCAGCTAGAAGTATTTT
TGAGTCATCAAAATTACTTTTTTTTTTTCCTAATGGACTGTCTTTGCATTGCTTGAATGC
TTTGATTTTAGAGTCAATTGAATCTTTTTTTGCTTATTTCTGGGAATGGATCTTTCTGTA
GATCTTGTAATAACGTATTTCTGTGTTTCTGTTCTGCAGGTGACTCTGACATCATTAGAA
GCATGCCAGAACAAACCAGTGAGAAGTAAATGCTGTAAAGGTGGTCTTTCTACAATAAAA
CTGGTTTTAGATCCATTTTAAGAAAAATGTGTATTGTATTATACTTCTGCTGGTTTTAGA
GAACAAACTATATAAATGAAGATTCATTATCACTGCTGTCTGTCTTGTTCTGTTAGAAGT
AACCTTCACAGGACAAAACTTGCCTGTTGCTTACTGTAGAAGTTGACCTTCAGTAGTAAG
ACCTGACCGTGGTAAGTATCAAATCCCAACAGGCTGTGGCTTTCTTTAGTTTAGTTTTTT
TGGAGTGCTCGTGGGGAATAAGTTCTTATGAGGTAGTGGCGAATTTGGGGTGTTGGTGGG
AGACCCCAGAGGATTGACTTACACTTAATTTCTTAACACTTCTTTTTAAATGTATTTGTT
ACTGCTAGTGCGTACTAAATAGGGCATAGCATTTTGCTGACACGTGGTTAAAGGAACACT
TAATGACAATCACTTGAACCAGCAGCCCTGAAGAACTTGCATTCTATTTTCTGAAGTGTA
TTAAAATACAGGGTGCTTCTTTGTACACATATGTGGTCATTAGATTATCCATGATCACTT
AAATCTAATTTTGCTGTAACTCTTATCTGTTTCTGGTGTGGAGTGGATGTGGTTGTGTAT
TTCAAGTTAGAGACATTAAAGGGGCAAACCAGCACGTGAAGCAAAGAAGAAACAGCTGGA
GTATGCACCTATTAAACTCTGGATTTGTATCAGTTCAGTAAACAGTTAAGTACTGTTGTT
GGTGTGAAAATAAACCTAGCAGAAGAGAGCTTTTGCTGCTAAGGGAGTAGAAGTAAAACT
TCAATTGGCCTTGAGACACTTCCAGAATGGCTGGAAGCAACTTGATATTTCATTTTCATA
TTAGCGTTTGATGAACAAATGTGCAGCTGGTTTTATTGCCCAGAGAATGTCTTTATAATT
AAAATACCAGCTGTATTCAGGAAAGCTCCAGAATCATGGAATGCTGACCAAGGCCTCTGT
AAGAGGGAAACATGATCTGGTCTGGATCAGGCAAGAGAAATGGTCCTTGAAATTTCAGAT
TGTGATGCTATGGTAACTCAACAGATTTCCCACTTTGTTTACATTCATCACCATTTCAAC
ACAGGTGTGTAAATCTGTATTTCTGCTTTCAACTGATGTCTGCAGTCTGCGCATGTTGGA
AAGATTGTATGAAACCTAACTGCTGTGAATGCACTATTCTGCTTGTGTGTGTGTGTGTGT
GTGTACATACACATAGTCACACAGATAGGATGCTTGAAACAGCAACAGAGTGAGTGGAGG
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 2046..2191, 2942..3072, 4119..4460
1101..1121, 2046..2191, 2942..3072, 4119..4165
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved