Gallus_gallus Locus RSSA_CHICK
snOPY snoRNA Orthological Gene Database
Gallus_gallus RSSA_CHICK
Gallus_gallus
RSSA_CHICK
2
SNORA62, SNORA62
2693..2851, 3898..4053
6699
GAAGCACTTTTAGAGCTTACAAACACTTCCAAATTACAGTAATAATAGATTTTTTTTTT
ATTGATTCAAACAATTAACAGATGCTGGTGCAATGAAAGGAACATCAGTTGGTCACTGAT
AACATATTTGGTGGAGCTTTGTAGTATCTCAAAGGCTCAGCAAGAAGCAAACCACCTGAA
ATACCAGGTAGAGTGCTGCCGGGCAAATCAGTTGGCACCTTAAAGGGGCAAAGGGCAGCC
TTGTTCCATGTGAACCATCCACTGGACAGGAAGACGGAAGGTGATTTTTTGATAGGGGAA
GAGGAATTTATACGCAGAATGATGGGCAAGGTGTTACTTTTGCCAGAAACAGGTGCTGGC
TGCCCGCTGCACTCCTCAGCCTGCCTTCAGGGTGGCAGAGGAGCACTGTGGAAGAGCCAA
GGGACAGGGTCTAGCTGAAGGTGTGCTGACTCAAAGCCAGCTCGAAAGTGGTACAGTGGT
AATGGAGAAGTCTCCCCTACCTATTGAACACACCCCTTTTTAGCTTCTGCCCCAAATAGA
CACAATAGGTGTAGAAACATGACGGCAAGGAGAATCTCAAGTTAAGGGAAACGCTTAATG
GCAAAATTGGAAGCCAAAGGAATGTGATGAAACGAAATGCACAACACGTGGTTAGTGTGA
CTGATTTCATCCTCCTCAGAGTCACATATCAAAACACCCACTGCTCCTTTTTGGGGCGAG
GATTGTGGTTAGACTACTTTGGTGCGCAAATCACTACTCTTCGGTGTCGCTTAAAGGTAA
CATCAACTAACCCCTTTTCTCCTGCCGCGGTTTCCCCCATGCCACACACGACCCGCCCCC
ACCTGGCCCACAGTCCGCCATGACACACGCAGGCCCTGGGTCGCTAAGCGCCTACTTCCT
TAGCAACCCGCGGAGCCCCGCCCTTCCGGTGAACGCGACGCTCCCATTGGCTGGCGGGGA
GGGCATATATTGACGTCACACGGCGAAGACTTTCCTTTTCGTTCGGCGCCCGCCGAGGCC
TCCACACGGCGTTGTCCGCGTGAGTCCCGGCGCCGGCGGGGCGGGGCGGTTGAGGGGCTG
GTGGCGGTTGAGGGGCTGGTGGCGGTGCACGCACCTTGAGGCATTAATGGATGTTAGCGA
GCGTTCTCTGCGCGCTCCCCTCAGCGGGCCGAGCTTCTTTGGGGAGGCTGAGGGGGATAG
AAGGGTAGGCCGCCGGCGCGGGCAAGATGGCGGCCGGGGCGCCCGCCACGTGAGGCGCTG
AGCTGGGTGGTTGTGCCCGCAGGTTCCCTGTCGTCGCTTCCTAAGGGAAACCCCACGATG
TCCGGAGGTCTCGATGTCCTGCAGATGAAGGAGGAGGATGTCCTCAAGTTTCTTGCTGCC
GGGACCCACCTGGGAGGCACCAACCTCGACTTCCAGATGGAGCAGTATATCTACAAGAGA
AAGAGCGATGGTAGATCCCTGGGGTGGGAGCCCGGAGTGCAGCTGCTGGGCTAGCTGGGA
GTTGATGGGCAAAACTGGGAAAAAGAGCCAAGTGCTACTGCTTGAGTTTCCCAGCAGTTT
GTGGCCCTGGAAAGTACAGAAATCCAAACAAATCACATTCCTCAAAACAGTAAAACAAAG
CACAGATTATAGAACACAAATCAATTAGATTGGGGCACCCCTACTGGTTTCTGACTATAG
TAATAAGCGTTGTGTCTCAGTAGTTATCCGTGCTTCTTGTGCTGTTCTTAAGTCTAAACT
GCACCATGTTGAAAGGTTCCAGCTCATAGCAGACTCAGGTCCATATTTATGTGTTGGACC
ATAATGGCTAGAGTTACACTATCTTAAAATCATGTTGCTGTTTTTTTTCTTGGAACAGCT
TGCTGCTAACTGGAGTTTTGTAATAACTGCAGCCCTGTAGCAACTTTAAGAGCAGATGAG
TGATGTCTTGATTTAAAAATTTCTTTACTGGTTGCTCTAAATCTTTCTGTCACCTGTAGG
TATTTACATCATCAATCTGAAGAGGACCTGGGAGAAGCTCCTTTTGGCAGCCCGTGCTAT
TGTGGCTATTGAGAATCCAGCTGATGTGAGCGTCATTTCTTCCAGGAATACCGGACAGGT
ATGGGAGTTCTTTATTTACCCAAGGCCTTCAGTCTTGGGAGCAGGCCTGTTGCCCTGTAG
CAGTGCATGTCATTGGCAGCTTGATAAGAGTGACCCAAATTTTGGCATTCAGAGGCATGT
TTCTTGTGCTATGGTTGAAGTTTAAAGCAACTGTATGGAGGGTCCCTGCACAGCCCCAAT
TCCTGTAGAGTTCAGGGCAGATGTGAGTAGTTGGATGGTATGTTTTTTTCCTTTTAGCCT
TATTTGAATACATTCTGCTGGACCTACTCCATTCTTTTGGTCATTAATGTGGCTTTTGGG
AGCAAAAAGCACCTGATAGATCTAAGTTTTTTCCAAAGAGGAAATAGTGTTCTTTTACTG
GAAGGGGAATTGTAACAAGTAAACAAACACTTCAGATTTTTCTTGCAGATTTTAAGCAGA
AAAACTTCTGTAGAAGGGGATGCACCATTCAAATGAAATCTAATTGTTGCTGAAGTTTAC
TGCTGAACTTAATTACTTTGTCCTAATCTAGGCAGTGCCACGAACATAGGAGAGAGCGCT
GAATGATGTTGAGTGGATTTACAAGAGAAAGGTGTGAGCACCTACTTATGCAACTTGCAC
ACTGTTAAAGCTTGATGCTGAGGTCAGTTCCTGACCAATGAGCTCTCAAGTGTCGGAAGT
GTGCTACAACAAAGCTGTTGGCAGGGTGCTTGCTAATGCCAGGAGAGGAGCTGCCTCTAT
GATTGGAGTTTGATAGCAGCCCTGCCACATGCTCTGCTGGCTTATGCCTGAGGAATTGGA
AACTATTGCAAATGAGTAGGAGCTAGCAGTTTAGTCTTAGTGGACACTGTTAAAGTTTGC
ATATATGTACTAGTGAGCTTGTCTTGTAGTTAATGCAAGCTATGCTACTGCATAGTAAAT
GGATGCAGAAATAATGGAGGTGAATGGCTTTTTTTTTTCCTTTTATATGGCTCAAGAACA
GTCCAGGGAGAGCAGGAATGTGATTTAGATATTGGCATTTGTAGGTCAGGTTGATGGTTG
GATGTGGTGATCTTGAAGGGTCCTTTCCAACCTAGATGATTCTATAATGCTGTTTGTTTC
ATCTACCCTTTTGCTGGTATGGTGGAGGCTCATAACTTTGGAGTAGAGCATACAACTCAG
TTTATCGGGGGAAGAGAAACTTGTTCTTCCTACTGACTTCCTGCCTTGCTGGTGGATGTG
ATCTTCTAACTCCTTTTTGTGCTGTTGGTGTAGTTATTTTTAAAAGCAGTATTGTTTTCA
CTCATTCGGGGAACTGGTACATGAGCCCTGATGTCATAGGAATTGAAACAAGTTTATGTG
GTCACTGACAGCACACCAGGGTGAGTTGATTGAAACTGAATTTCCTACTTCACCTCTTGA
TTTGTTTTGCAGCGTGCTGTTCTGAAGTTTGCTGCTGCCACTGGGGCTACTCCTATTGCT
GGACGCTTCACCCCTGGTACCTTCACAAATCAGATCCAGGCGGCTTTCCGTGAGCCACGA
CTCCTGGTTGTTACAGATCCCCGAGCTGATCATCAGCCACTGACCGAGGCTTCTTACGTC
AACATCCCCACCATTGCGCTGTGCAACACCGACTCCCCGCTGCGCTATGTGGATATTGCT
ATCCCCTGCAACAACAAGGTTACTGCTTTGTAGAATTTAAAGCTGCTTTCTCTAGAGCGT
ACTGTAGGTTGCAAGATGTTTTTTGGTAGGTAAGGTTACGTGTATATCTGGTGTGACTCT
CAGGGTGATGAGCTAATAAATTTCTGCCAAGCCAATAGGTAGGTGAGGAGGTTTTGAGCT
TGCACACAGTTGGAACTTGGAGCTGAGGCCATCCTGTGGCCAAGGAACTCTCAAGCGTAG
GATGTGTGCTACAGTAACATGGCAGGACTTACTGACAGCCTGAGGGCCTTTGTGGCCCAA
TGAAAGGAGTTTGGTAGTCAATCTTGCCACAGTTCATGAACATGAAAGAAAAGTAATGTG
ACTTTGTGAAGAATCATAGAATGGTCTGGGTTGAAAAGGACCACTGGTTGAGTTTGAACC
CTCCTGCTATGTGCAGGGTCACCAAGGAAATACAGTCTTACTAGCAGCAAAAAGGTAAAG
TCTAGGGAAGTGGGAAACTAGCCTTGATCTCTAAACACTTACAAAACAATGTAAGCCAAA
TCTGAGCTTGAACCAATCTGTCAGATTAATTTCTTTGTATTAGCATATGGTATGGATGCA
TAATCCTTGTGTTTGTGGATAAGATTTACACAGAACATTGAATAGGAGTACTGACTGAGA
CAAATTCAGATGCAGGTGACTGCGGTGCTGCAGAGGCCTGAAAATATTGCTGTGAATTTG
AAAAGCTTCAATGTCCTGAGTCCATTTACATCATAGCTCTGTCAGGGATTCTCTTGCCTA
GAAAGAATTGTGTGCAAATAAGTTTTCCTCTTAAAGGTGTGTGAGGGCAGGGGAGGGGGA
AGGCATTTAAAGGCTTATATTTGGAGCCGATCTTGATGTAACCTTATTCTCCTGTTGCAG
GGAGCACATTCAGTGGGCCTGATGTGGTGGATGCTGGCTCGGGAGGTCCTGCGCATGCGT
GGCACCATCTCCCGTGAACATCCATGGGAAGTCATGCCTGACTTGTACTTCTACAGGGAT
CCTGAGGAGGTAAAGACCTGTGGGAGGAAGTGTGAGATGTGCTGCTTGTGTTCCTGCCCA
TGGTTCTCTGTGCTTGCCCCTGAGGACAGATACTTGCCAATGTCATGCATTTGACACTTA
GTGTGGTTAATTAGTTGTCTATCAGCTGGTACATGTTGTCTGGTGTGTGTGGTGAGATGT
CTGTTCCTGTGCAATGTCAGCTGTGTTCTTCATTGCAGATTGAGAAGGAGGAGCAGGCTG
CTGCTGAGAAAGCAGTGACAAAGGAGGAGTTCCAGACCGAATGGACAGCCCCAGCTCCTG
AATTCACTGCTCCTCCTCAGCCTGAGGTTGCTGATTGGTCTGAGGGAGTGCAGGTCCCAT
CTGTGCCAATCCAGCAGTTCCCCACAGGTCAGTTTTGTGGAAGGGTGTCTAGAGGAAGTG
GGATCTGGAAAGCAGAAATAAGTCTTCACTGTGATTAGCTGCGGGGATGTGCATGGTGCT
GGTGTACTGATTCCCTTGTCTTTAAGCAAGTCACAGATGTTGGTATTTTGTAGAGAAAAT
TGAGTAGTACACTTAACTTGCTTCATGCAAGTTTCTGCCAGCAATGTCTTTTAAACATTA
AAATGATAGATTTTTAAGGCAGAGTGGATGTGAGTGTGTACCTTAGTTACTGCACTTGGA
AGTCCGAAGTAAGTTGATTTGGGGTCATGAGAAGAATACTAGTTTGTATACTTGCATATA
CATGTACAAGAATGGCAGCGTGTACACCATGTTTTATGGATTAAAAGAGTAAGGATGCAG
TGAATTTTGTTGTGTTTGTAATTGCAGAGGACTGGAGTGCCCAGCCTGCCACTGAGGACT
GGTCAGCAGCTCCCACTGCCCAAGCAACGGAGTGGGTTGGGACTACCACGGAGTGGTCTT
AACTTCAGTGCCGCTGTACTATCAAAAATAAAGACTGGTTTAATACCCATCCTACTTTGT
ATGAGTGCTGGTTGGTGTGTTTTCCTTCTGATCAACATGCTGGAGGGCTGGGATGTCAGC
AAAAGGGCTCACAGACTTGAGAAGGTGGGCCTATGTGAACAATGTGAAGTTCAGCAAGGT
CAAGTGCAAGACCCTGCAGCTGACTCAGGGCAATCCCAGATGTATGCAGATAGGGAGGAA
AAACTCATTGAGAGCAGCCTTGAAGAGAGGGACTTGAGGGTGTTGGTGGACAGAAAATGA
CATGAGCCAGCAGTGTGTTTTTTGCAGCCTTTAAGGCTGACAGTATCCTGGGCTGCAACA
AACAAGGGGTGGCCAGTAGGGGGTTGGGGCTAATTGTACCTCTCTACTCTGCCCTTGTGA
GGCCCCATGTCAGTAGTATGTTCAGGCCTGGGGCTGCAGCACAAGGATTTGTTGGATTGG
GTCCAGAGGAGAGTCATGAAGATCACCAGAGAAGAGCACCTCTTGATGAAGAAAGGTTGA
AGGAGCTGTGCTTCAGCCTGGAGAAGGCTCGTTGTGGCCTTCTGTTTAAAGGAAGTGTAG
AGACCTAGAACAAAGGGGTAATGGTTTTAAACTAAAGATAGATGGGTTTAGATAAGGAAA
AGATTCTTGTCTATGAAGATAGTGAGGTTGTCCAGAGAAGCTGTGCATGTCCCATCCATG
AAGATGTTCATGGCCAGGTCGGATGGGACCCTGAGCAGCCTGGTTTAGTGAGTGACAACC
CTGCCCACAGCAGAGGGTAGAACTTGATGGCCTTTCCTGTCCATTCTAACTCAAAATCAT
TCTGTGATTAAGTGAAGTGTGGGTTCCTGAGCAGTCAGTTATACGTACTCCTTGGCCAAG
GAGTACCCTTCTGTCTCCTCACCTGTGATAGCATCCAATGTGCATTCTGTTTATCCCTGC
TTTCCTTAGCTCCACCCCACCAGATGTCATAGCTCCCCAGGGCTCTGTAGTGGCTCATGT
GTGTCTGTTCACCTGGAGGTGGTGGAAGGCATCAATTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1282..1449, 1979..2097, 3492..3737, 4620..4748, 4958..5126, 5547..5699
1317..1449, 1979..2097, 3492..3737, 4620..4748, 4958..5126, 5547..5638
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved